Actions

Work Header

Rating:
Archive Warning:
Categories:
Fandoms:
Relationships:
Characters:
Additional Tags:
Language:
English
Series:
Part 5 of The File
Collections:
Mcuficslesgooooooo, Pjooooooo, Irondad Creators Awards 2022, PJO+ YALL, Best Stories, FunnyFicsForARainyDay, Sustenance for my maladaptive daydreaming, Percy Jackson, Series that I want to read once they are complete, You haven’t lived if you haven’t read this, C’s Favorite Riordanverse Fics, C’s_Favorite_Fics, Fics That Get Me Good, 🌑 𝑫𝒂𝒓𝒌 𝑴𝒂𝒕𝒕𝒆𝒓 🌑, Gorgeous Fics We Deserve
Stats:
Published:
2021-07-09
Updated:
2025-11-01
Words:
171,098
Chapters:
58/?
Comments:
5,600
Kudos:
12,456
Bookmarks:
1,014
Hits:
407,076

The File: Dumb Texts Behind The Scenes

Summary:

PJ: i almost suplexed your child

 

TS: what?????

 

PJ: i was in the garage. he was in the garage. I was unaware of who he was

 

TS: did you punch him?

 

TS: i swear to god

--

YES i needed to make a gc fic to soothe my soul. do not question me.

Notes:

i wrote this just because i wanted some Dumb Family Bonding. im sorry.

this spans chapters 8-11 by the way

(See the end of the work for more notes and other works inspired by this one.)

Chapter 1: percy becomes God

Chapter Text

 

we had a bonding moment! I cradled you in my arms!

 

PJ : im bored

 

TS : ok????

 

PJ : entertain me

 

TS : im working right now

 

PJ : damn guess i’ll get up and go find something myself

 

TS : NO

 

TS : percy if you move i swear to god

 

TS : there is a HOLE in your LUNG. ask fri to get something

 

PJ : :(

 

TS : don’t :( me

 

PJ : :(



---




we had a bonding moment! I cradled you in my arms!

 

PJ : [Image: Mrs. O’Leary is sitting on the couch patiently. She has neatly done pigtails in, and looks very happy]

 

TS : heh.

 

`TS: nice



---



we had a bonding moment! I cradled you in my arms!

 

TS : im going to call the kid. Invite him over to the labs at some point

 

PJ : good.

 

PJ : he seems like a good kid

 

TS : he is.



---



we had a bonding moment! I cradled you in my arms!

 

TS : was there fucking crack in those cookies

 

PJ : no?????

 

TS : cookies arent that good. Its not how life works

 

TS : it felt like crack

 

PJ : why do you know what crack feels like???

 

PJ : Tony?????

 

PJ : TONY?????



---




we had a bonding moment! I cradled you in my arms!

 

PJ: i almost suplexed your child

 

TS: what?????

 

PJ: i was in the garage. he was in the garage. I was unaware of who he was

 

TS: did you punch him?

 

TS: i swear to god

 

PJ: pffft no. where the trust?

 

TS: you spartan kicked a reporter yesterday.

 

PJ: they were fucking rude, tony.

 

TS: not the point. what did you do.

 

PJ: nothing!! 

 

PJ: i just kinda looked at him for a second then left

 

PJ: no harm done

 

TS: ….

 

PJ: i can feel your judgmental squint from here

 

TS: good

 

PJ: you really like the kid, huh

 

TS: well

 

TS: yeah

 

TS: hes hella smart

 

PJ: thats not it

 

TS : ?

 

PJ : you actually like him as a person

 

PJ : i can tell

 

PJ : you’re gonna adopt him

 

TS : What?? No.

 

PJ : ooooh someones busting out the capital letters and punctuation

 

TS : how do you even know that?

 

PJ : fri

 

TS : ...ok. but im not going to adopt him, he already has a family and i dont need a kid

 

PJ : uhhhh huh. that’s why you anonymously donated to his school’s chemistry program

 

TS : how the shit did you know about that

 

TS : i just did that

 

TS : how

 

PJ : ;)

 

TS : mildly upsetting. anyways

 

TS : not my kid. 

 

PJ : ooooh wait

 

[PJ has changed TS’s nickname to ‘Father of 5’]

 

PJ : :)

 

Father of 5 : wh

 

Father of 5 : why

 

PJ : peter, U, dum-e, butterfingers, and fri

 

Father of 5 : i still deny that

 

PJ : its a nice name! I worked hard

 

Father of 5 : ...you just learned how to do that, huh

 

PJ: mayhaps

 

Father of 5 : shouldn't you know technology? You are like 20

 

PJ : not my fault i never had a phone

 

Father of 5: i still think that is weird

 

Father of 5: thats like. the one thing someone your age should have

 

PJ: ‘someone my age’ shut up old man

 

PJ: im actually an eldritch being from centuries ago. I Know Everything. 

 

Father of 5: ...that fact that i sort of believe that is a little concerning. 



---




Father of 5: where the hell did you and mrs o’leary get matching pajamas

 

Father of 5: please i need to know



---




Father of 5: fri said you had a nightmare last night. You ok?

 

PJ : fucking snitch

 

PJ: yeah im fine.

 

PJ: ive had worse

 

Father of 5: i hate that

 

PJ: life do be like that sometimes

 

Father of 5: for fucks sake

 

PJ: a n y w a y s

 

PJ: spidey coming over today?

 

Father of 5: yeah

 

Father of 5: at 10:30

 

PJ: awful early time to make your child get up

 

Father of 5: he gets up early

 

Father of 5: and hes not my kid

 

PJ: your nickname begs to differ

 

Father of 5: oh for hell's sake

 

Father of 5: if i have to suffer, you do too

 

[Father of 5 has set PJ’s nickname to ‘crack dealer’]

 

crack dealer: what

 

Father of 5 : im still not forgetting those cookies

 

crack dealer: of course not. 



---




we had a bonding moment! I cradled you in my arms!

 

crack dealer: hey where are you

 

crack dealer: nvm im coming down




---




Peter Parker and Tony Stark

 

Underoos : mr stark your friend is scary



---



            we had a bonding moment! I cradled you in my arms!

 

crack dealer: ok im stealing your child now. going to go feed him lunch. 



---



we had a bonding moment! I cradled you in my arms!

 

crack dealer: i think your kid just helped me track down a shooter

 

---



Peter Parker and Tony Stark

 

Underoos: ok i take it back his dog is cute

 

---



we had a bonding moment! I cradled you in my arms!

 

crack dealer: your son was very helpful

 

crack dealer: i can see why you adopted him. 10/10, gave lea good pets

 

Father of 5: not my kid

 

Father of 5:

 

Father of 5: glad he could help, though

 

---



we had a bonding moment! I cradled you in my arms!

 

crack dealer: i have the power of god

 

Father of 5: why do i hear boss music

 

crack dealer: i have an idea

 

Father of 5: im already scared



---



[PJ has added Tony Stark and Peter Parker]

 

[PJ had changed their name to ‘God’]

 

God: told you

 

Tony Stark: are you really gonna pull the kid into this?

 

God: family bonding, tony

 

[Peter Parker has changed their name to ‘soup’]

 

soup: hi????

Tony Stark: why soup?

 

soup: like soup

 

God: mood

 

God: like food….but can use straw

 

soup: mmm yes. swirly straw for soup

 

God: s̸̢͉̯̖̬͇̺͇̜͖̗͆̋̇̏̓̈̇̽̌͛̄̓̇̑ơ̸̧͙̣̣̜̤̹̤͕͐͋͒͑͂̋̋̏̊̈́̾̆͐̑̿̋͆̚u̴̢̧̱̰͍̫̻̣̲̲͈͚̝̮̠̤̜̞̣̩̐̉̒̾̋̐̇͗͑̋̅̈́̊̋̌̌́̉̄̔̾͂͜͝ͅp̸̧̧͕̠͍̝̰̦͔̈́̇̎̽̏̌̀̊̊̉̍̅͂̐̎̃͆͘͜͝

 

soup: finally someone Gets It

 

Tony Stark: what the fuck

 

Tony Stark: why does that cover other messages

 

Tony Stark: how did you do that

 

soup: we did nothing. twas but the power of s̸̢͉̯̖̬͇̺͇̜͖̗͆̋̇̏̓̈̇̽̌͛̄̓̇̑ơ̸̧͙̣̣̜̤̹̤͕͐͋͒͑͂̋̋̏̊̈́̾̆͐̑̿̋͆̚u̴̢̧̱̰͍̫̻̣̲̲͈͚̝̮̠̤̜̞̣̩̐̉̒̾̋̐̇͗͑̋̅̈́̊̋̌̌́̉̄̔̾͂͜͝ͅp̸̧̧͕̠͍̝̰̦͔̈́̇̎̽̏̌̀̊̊̉̍̅͂̐̎̃͆͘͜͝

 

Tony Stark: you two meeting was a mistake

 

God: your anti soup ways are tearing this family apart

 

Soup: mr stark :(

 

Tony Stark:

 

Tony Stark:

 

Tony Stark: dear god

 

Tony Stark: fine

 

Tony Stark: im just going to say it normally.   s̸̢͉̯̖̬͇̺͇̜͖̗͆̋̇̏̓̈̇̽̌͛̄̓̇̑ơ̸̧͙̣̣̜̤̹̤͕͐͋͒͑͂̋̋̏̊̈́̾̆͐̑̿̋͆̚u̴̢̧̱̰͍̫̻̣̲̲͈͚̝̮̠̤̜̞̣̩̐̉̒̾̋̐̇͗͑̋̅̈́̊̋̌̌́̉̄̔̾͂͜͝ͅp̸̧̧͕̠͍̝̰̦͔̈́̇̎̽̏̌̀̊̊̉̍̅͂̐̎̃͆͘͜͝

 

Tony Stark: what in the fresh hell

 

Tony Stark: why did it do that

 

Tony Stark: what did you do

 

God: we did nothing. soup is just like that

 

soup: indeed

 

[God has changed the group name to ‘SSEA’]

 

soup: soup speed eaters association?

 

God: yeah B)

 

soup: nice B)

Chapter 2: Ned Gets Emplyoye

Summary:

Not a loser: peter. What did you do

 

Loser 1: ok so you know how we

 

Loser 1: like

 

Loser 1: looked up that Deathstroke guy

 

Not a loser: peter.

 

Loser 2: uh oh

Notes:

thanks to black_victor_cachat for some of these ideas!

edit: i cant believe that none of you fuckers told me i misspelled employed

(See the end of the chapter for more notes.)

Chapter Text

 

Judas!!!! no!!

 

Loser 1: ok dont be mad

 

Not a loser: what did you do

 

Loser 2: im already mad.

 

Loser 1: i said DONT be mad

 

Loser 2: you arent making this better

 

Not a loser: peter. What did you do

 

Loser 1: ok so you know how we

 

Loser 1: like

 

Loser 1: looked up that Deathstroke guy

 

Not a loser: peter.

 

Loser 2: uh oh

 

Loser 2: she sounds pissed

 

Loser 1: nobody got hurt

 

Not a loser: not helping. What. did. You. do. 

 

Loser 1: ok so like

 

Loser 1: i was in the lab. Minding my own business

 

Not a lose: bullshit

 

Loser 1: i was!!!!

 

Not a loser: get on with it

 

Loser 1: ….

 

Loser 1: deathstroke came in. he said hi. I said hi. I pet his dog

 

Loser 2: P E T E R

 

Loser 1: i got a dog pic

 

Not a loser: you spent time with one of the worlds most deadly mercenaries?

 

Not a loser: his name is Deathstroke 

 

Loser 1: ok but he was really nice!!!!!

 

Loser 1: he makes really good cookies!

 

Loser 2: damn now im jealous

 

Not a loser: what is wrong with you two

 

Loser 1: ~trauma~

 

Not a loser: fair

 

Loser 2: ok but

 

Loser 2: was he nice

 

Loser 1: yes actually

 

Loser 1: i helped him track down a shooter

 

Not a looser: what????

 

Loser 1: long story. Anyways

 

Loser 1: he said he liked my suit. Very nice colors

 

Not a loser: he knows you’re spiderman?????

 

Loser 1: ...yes

 

Not a loser: oh my god

 

Loser 2: why do i feel like there’s more

 

Loser 1: because there is

 

Loser 1: i can now proudly say i am in a group chat with mr stark

 

Not a loser: and deathstroke?

 

Loser 1: and deathstroke ! 

 

Not a loser: for fucks sake

 

Loser 1: no its ok. he likes soup

 

Loser 2: oh ok

 

Loser 1: ooh

 

Loser 1: i d e a

 

Loser 2: oh????

 

 

---

 

SSEA

 

[soup has added Michelle Jones and Ned Leeds]

 

[soup has changed Michelle Jones’ name to ‘mindiana jones’]

 

[soup has changed Ned Leeds’ name to gitc]

 

soup: :)

 

God: owo whats this

 

Tony Stark: never say that again

 

gitc: peter

 

gitc: is this what i think it is

 

soup: do you think its a groupchat with mr stark and mr deathstroke?

 

gitc: i think its a groupchat with mr stark and mr deathstroke

 

soup: then yes

 

mindiana jones: parker i swear to god

 

mindiana jones: mindiana? really?

 

Tony Stark: kid…

 

God: i thought it was funny

 

gitc: wait who are you

 

God: mr deathstroke, apparently

 

gitc: oh my god

 

gitc: im so sorry

 

mindiana jones: forget that. did you just owo

 

God: indeed i did, mindiana.

 

mindiana jones: you are deathstroke????

 

God: i prefer percy

 

gitc: your name is percy???

 

God: sometimes

 

Tony Stark: jackson for fucks sake

 

Tony Stark: stop messing with them

 

God: oh you think you’re all high and mighty, huh

 

Tony Stark: ?

 

God: with your boring ass nickname

 

God: but you know what

 

[God has changes Tony Stark’s nickname to ‘Tony Stank’]

 

Tony Stank: i see you have been talking to rhodey

 

God: what gave me away

 

Tony Stank: i regret meeting you

 

God: xoxo no you dont

 

Tony Stank:

 

Tony Stank goddamnit

 

God: just be glad i didn't change your nickname to match the other one

 

Tony Stank: whatever crack dealer

 

God: :/

 

mindiana jones: you sell crack?

 

God: no comment

 

soup: i feel like this is going well

 

gitc: i dont even know anymore.

 

gitc: deathstroke owo-ed. life is a lie

 

God: there is no rule against mercenaries owo-ing

 

God: i know the law

 

mindiana jones: did you study law?

 

God: no i just commited a bunch of crimes

 

soup: valid

 

gitc: but you’ve never been caught???

 

God: oh sweet summer child

 

God: this was w a y before the mercenary thing

 

Tony Stank: wait what

 

God: i blew up a gym.

 

Tony Stank: WHAT

 

God: listen…

 

God: teenagers all make mistakes

 

God: not that though

 

God: that was on purpose

 

Tony Stank: what the fuck

 

soup: its ok i kinda broke a ferry on accident once

 

God: i did that once!

 

God: except it was a yacht

 

God: and also on purpose

 

mindiana jones: you really like blowing things up, huh

 

God: well yes

 

God: you see i met my best friend by blowing up a toilet

 

gitc: oh that's nice

 

God: yeah it was fun

 

gitc: was it on purpose, mr deathstroke?

 

God: actually no

 

God: it was either that or drink sewer water :/

 

mindiana jones: i see absolutely no correlation between the two

 

soup: yeah me neither

 

God: that's ok

 

Tony Stank: ……...alright

 

Tony Stank: ted please stop calling him mr deathstroke. I take hit damage every time it happens

 

gitc: but what do i call him

 

gitc: he has so many names

 

God: ?

 

gitc: uh

 

gitc: we may or may not have

 

gitc: looke you up a little

 

God: oh

 

God: did you see the bounty?

 

mindiana jones: yes

 

God: pretty sweet right

 

mindiana jones: sure?

 

Tony Stank: theres a bounty on your head?

 

God: yeah my cousins set it up

 

soup: well thats rude

 

Tony Stank: why? what did you do to them?

 

God: well

 

God: partially they were upset because i forcibly vaccinated them

 

God: but mostly so they would know who did it when i am inevitably murdered

 

God: and it was just easier that way

 

mindiana jones: how does that make things easier

 

God: that way i know whos out to get me

 

God: and i get them first (✿◠‿◠) 

 

Tony Stank:

 

Tony Stank: thats

 

Tony Stank: innovative? I guess?

 

God: thanks

 

God: hey wait ned

 

God: how long did it take you to find all that stuff on me?

 

gitc: uhhh like 20 minutes

 

God: are you serious

 

gitc: wait am in in trouble

 

God: no??????? It just

 

God: it only took you 20 minutes????

 

Gitc: ...yeah

 

God: ok

 

God: are you looking for a job

 

gitc: what

 

God: job. Do you want one

 

gitc: doing what?

 

God: some of my cousins are idiots who forgot to exist on paper

 

God: and now im getting the youngest one a fake identity for her birthday

 

Tony Stark: wtf your family is so weird

 

God: oh tony

 

God: this is NOTHING

 

gitc: a job sounds great???????

 

soup: awww good for you ned. 

 

soup: going to work for the scary murder man

 

mindiana jones: child labor laws are a thing that exist

 

God: eh

 

gitc: eh

 

God: ive been paid to kill people since i was 12

 

God: and look at me now

 

Tony Stank: percy what the hell

 

Tony Stank: are you ok???

 

soup: wait 12?

 

mindiana jones: mildly concerning

 

God: well

 

God: i was exaggerating

 

Tony Stank: oh thank god

 

God: i wasnt getting paid 

 

Tony Stank: 

 

soup:

 

gitc: 

 

mindiana jones:

 

Tony Stank: i worry about you

 

God: the feeling is mutual 

 

gitc: wait how would i get paid? Dont i have to like. Do something with taxes?

 

God: no

 

God: i have never paid taxes my entire life

 

Tony Stank: what

 

Tony Stank: percy

 

God: taxes are for rich people

 

mindiana jones: yeah thats fair

Notes:

hazel and nico set the bounty up, btw. percy's cousins who 'forgot to exist on paper' are like. all of them.

2 cousins from the past, 1 raised by wolves, and 1 was a tree. so.

Chapter 3: An Environmentally Friendly Dictatorship

Summary:

peter gets bonked, mj and percy plot

Notes:

thanks to black_victor_cachat and mayaellise for some of the ideas

(See the end of the chapter for more notes.)

Chapter Text

soup: mr starbk i think i jit my hef

 

Tony Stank: what

 

soup: bonmk

 

mindiana jones: karen says he hit his head

 

gitc: hes not bleeding out

 

Tony Stank: not promising

 

gitc: a Small Concussion

 

Tony Stank: peter

 

soup: yesh ?

 

Tony Stank: come to the tower

 

soup: i toootaltly would

 

soup: but i domnt kniw where i a m

 

Tony Stank: for fucks sake

 

Tony Stank: ted where is he

 

gitc: rooftop on Knowlers and 8th

 

Tony Stank: im in a meeting right now. Pepper will kick my ass if i leave

 

Tony Stank: percy

 

Tony Stank: @God

 

God: what

 

God: oh

 

God: yeah ill get him

 

soup: oooooh

 

soup: mr tall mans is gunna gett me

 

mindiana jones:

 

mindiana jones: are you actually that tall?

 

God: no

 

God: im actually the shortest on my dad’s side. My little brother is like twice my height

 

gitc: how tall are you???

 

God: 6

 

gitc: 6?

 

God: yeah it was 6

 

mindiana jones: im assuming 6 feet. how old is your brother?

 

God: not completely sure. I found him in a cardboard box, you see

 

God: like. 8?

 

Tony Stank: there are so many things wrong with what you just said

 

Tony Stank: also you’ve never mentioned a brother???

 

God: i have so many…

 

God: also yeah he lives underground

 

gitc: wh

 

gitc: like in the sewers

 

God: no

 

gitc: ok

 

Tony Stank: are you almost there?

 

God: yeah

 

God: found him

 

soup: hnnfdg beeg dog

 

mindiana jones: ??

 

God: hes sitting on my dog. she’s taking him to the tower

 

mindiana jones: and you think people just arent going to question why spider-man is getting a ride from a dog(?) with deathstroke walking behind them

 

God: nah

 

God: trust me on this

 

gitc: sure . why not

 

soup: doggyyie 

 

Tony Stank: thank you for your contribution, peter. 

 

soup: : )

 

----------

 

Tony Stank: i just found out coca cola can remove rust from stuff

 

Tony Stank: imagine what its doing to peoples bodies

 

God: pfftt getting rid of the rust, idiot

 

Tony Stank: thats not how that works

 

God: ive been drinking soda…...my body is rust free…..not sure where you’re getting your facts from

 

Tony Stank: no

 

mindiana jones: no he’s right

 

Tony Stank: you go to a science school

 

Tony Stank: what are they teaching you

 

gitc: right now?

 

gitc: global warming and stuff

 

mindiana jones: except our teacher is very much ignoring the fact that most of pollution comes from large corporations :/

 

God: yeah, it was the same at all of my schools. a lot of kids parents were business people, so. school didnt want to upset them

 

mindiana jones: its not that bad at midtown, but the principal did try and stop me from organizing a school protest 

 

gtic: she ended up staring him down. It was amazing

 

God: hm

 

God: if you want to get more involved without the school getting in your way

 

God: call this number

 

God: ***---***---****

 

gitc: thats not sketchy at all

 

God: its just my friend grover. He runs the new york environmental association

 

mindiana jones: grover underwood?????

 

God: yeah!!! 

 

mindiana jones; you know him?

 

Tony Stank: please tell me you didnt try and kill him

 

gitc: or that he hired you to kill someone

 

God: he would never. Ive offered, but

 

God: he’s been my best friend since the 6th grade where he broke into my cabin with no pants on, passed out, and then i dragged him to safety after i fought a bull

 

Tony Stank: why do you always say things like this

 

God: i have no idea what you mean

 

God: but dont call that number from your own phone. Use a payphone, or someone who you dont like’s phone

 

God: tell him percy jackson sent you, and the code word is enchilada

 

mindiana jones: alright seems legit

 

Tony Stank: i am very concerned right now

 

God: what???? He’s an environmental activist, not a terrorist

 

God: though i do know a few of those if you need one

 

gitc: great

 

gitc: wait i just looked him up

 

gitc: grover underwood is suspected for stealing animals from aquariums and sabotaging Dare Enterpises facilities

 

God: hah

 

God: yeah

 

Tony Stank: ok to be fair william dare sucks ass

 

God: yeah i met him a couple times

 

God: he liked me well enough, though

 

mindiana jones: what?

 

God: i was staying at his house

 

Tony Stank: why the fuck

 

God: im friends with his daughter

 

mindiana jones: you know rachel dare????

 

God: yeah who do you think helped her plan the Sea World heist

 

mindiana jones: it was YOU????

 

Tony Stank: you stole a fucking whale?

 

Tony Stank why am i not surprised

 

gitc: holy shit

 

gitc: thats so cool

 

God: yeah the three of us plus my cousins hunting club plan to take over the oil industry within the next 10 years

 

mindiana jones: wow

 

mindiana jones: im in

 

God: cool

 

Tony Stank: im a little scared but

 

Tony Stank: carry on

 

mindiana jones: >:)

 

God: >:)

 

----------

 

Tony for fucks sake go to sleep

 

Honeybear: why did i just see on the news that a Dare Enterprise facility just got destroyed

 

Honeybear: and WHY do i feel like you had something to do with it

 

Dumbest genius: i did nothing of the sort

 

Honeybear: ….

 

Dumbest genius: except look the other way

 

Honeybear: tones for fucks sake

 

Dumbest genius: at least it will be an environmentally friendly dictatorship

 

Honeybear: what????

Notes:

percy did mission impossible but with fish. i take no critisism

ok guys the 'soup' thing at the bottom. do you see it too??? i cant get rid of it. the power of soup

Chapter 4: Flash Thompson's In BIG Trouble

Summary:

Tony Stank: all of my money will be going to keeping me out of jail

 

Tony Stank: because i will have committed aggravated assault

 

soup: DO NOT

Notes:

thanks to mayaellise and SnufflesThePig!

(See the end of the chapter for more notes.)

Chapter Text

SSEA

 

God: Tony’s fine. No need to worry. 

 

soup: what happened

 

God: bomb :/

 

mindiana jones: what?????

 

God: we were in the building. There was also a bomb in the building. 

 

gitc: alright then

 

soup: but mr stark got hurt?

 

God: a Small concussion. 

 

God: he’s very whiny

 

soup: so what im hearing is the two of us match head injuries

 

God: yeah basically

 

soup: did you guys get rumlow?

 

God: yeah hes fucking dead

 

gitc: oh my god????

 

God: no dont worry it was on purpose

 

mindiana jones: wait like. You killed him?

 

God: he tried to shoot tony i have no regrets

 

God: we fought to the death in a basement

 

gitc: did you get hurt?

 

God: eh. I spent 8 months wrestling wolves in california. Ill live

 

mindiana jones: the fact that i cant even tell if you’re joking anymore---

 

God: :)

 

God: anyways

 

God: tony’s asleep right now so im going to do what i want

 

soup: what does that mean

 

soup: percy

 

soup: PERCY????

 

--------

 

SSEA

 

soup: one day im going to kill him i swear to god

 

Tony Stank: woah woah woAH WOAH

Tony Stank: kiddo?

 

soup: wrong chat

 

soup: ignore that

 

God: i can hide a body

 

Tony Stank: NO

 

Tony Stank: NO murder.

 

God: uhhhhhgg

 

God: you never let me have fun

 

Tony Stank: people die when you have fun

 

God: :(

 

Tony Stank: anyways

 

Tony Stank: you alright, underoos?

 

soup: yeah im fine

 

mindiana jones: liar. flash dumped his lunch tray on him today

 

soup: mj!!

 

soup: its was nothing, mr stark. promise. 

 

Tony Stank: too late

 

Tony Stank: who the HELL is flash

 

soup: nobody

 

gitc: flash thompson. he’s an asshole to peter all the time. its been going on for like 3 years

 

soup: NED

 

soup: betrayed by my own friends….unbelievable. 

 

gitc: he needed to know

 

gitc: im sorry dude

 

mindiana jones: im not

 

Tony Stank: peter

 

Tony Stank: 3 years?

 

soup: its nothing. I barely even notice it anymore

 

Tony Stank: that's even worse

 

Tony Stank: has any of it been reported?

 

mindiana jones: yes. most of the time there’s no evidence

 

gitc: and other times he just gets off really easy. his parents make a lot of donations to the school

 

Tony Stank: so what i'm hearing is

 

Tony Stank: i just need to out-donate this dumbass’s parents

 

soup: no!!!!

 

soup: do not!

 

soup: i can handle it, mr stark

 

soup: if its not me, its going to be someone else who cant take it

 

Tony Stank: just because you can handle it doesn't mean you should, kid. 

 

mindiana jones: i've been trying to tell him that for almost a year

 

soup: he barely even touches me. I’m fine. Seriously.

 

Tony Stank: 

 

Tony Stank: 

 

gitc: uh

 

gitc: mr stark

 

gitc: are you alright?

 

Tony Stank: He hits you?

 

gitc: uh oh

 

gitc: full capitals and punctuation

 

soup: not usually

 

mindiana jones: he shoves him into lockers like all the time. I’ve seen the bruises on his shoulders and back.

 

soup: MJ!

 

mindiana jones: he needs to know. Still not sorry. 

 

Tony Stank: ok so im not going to out-donate his parents to make him stop bothering you

 

soup: thank you

 

Tony Stank: all of my money will be going to keeping me out of jail

 

Tony Stank: because i will have committed aggravated assault

 

soup: DO NOT

 

gitc: no its ok

 

gitc: he hits you, peter. 

 

soup: im spiderman!

 

soup: i can take a hit

 

soup: and i shouldn't be punching my classmates. I'm a superhero!

 

Tony Stank: well i'm an avenger

 

Tony Stank: and i kicked a justin hammer in the nuts once

 

soup: well he’s evil

 

Tony Stank: no this was before we knew about that

 

Tony Stank: he was just an asshole

 

mindiana jones: hell yeah

 

mindiana jones: i've always hated that guy

 

Tony Stank: you can't stop me

 

Tony Stank: and really

 

Tony Stank: i'm not the one you should be worrying about

 

soup: what do you mean?

 

Tony Stank: dearest pj has been rather silent

 

gitc: uh oh

 

soup: oh no

 

God: lucky for us. i am not above murder OR clotheslining a teenager

 

God: <3

 

soup: percy. do nOT

 

mindiana jones: eh as long as he doesn't kill him

 

Tony Stank: don't track blood in the tower

 

soup: no!!!! No blood!!!

 

Tony Stank: yeah

 

Tony Stank: none in the tower

 

soup: no blood in GENERAL

 

soup: because you should NOT hurt flash

 

soup: percy???

 

gitc: pretty sure he’s already on his way, dude

 

mindiana jones: everything will be fine

 

soup: not for flash!!!!!

 

mindiana jones: everything will be fine. 

 

soup: percy?????

 

God: [Image description: Percy is crouched on a roof in full gear, except for his helmet. Only his head and shoulders are visible, and you can see the swords strapped to his back. He is smiling, and giving a peace sign to the camera.]

 

God: see you on the news

 

Tony Stank: be home before 8

 

soup: is that flash’s neighborhood

 

soup: please tell me it isn't flash’s neighborhood

 

gitc: i'm pretty sure he’s standing on his roof, dude

 

soup: how did you get there so fast????

 

mindiana jones: pretty sure he’s a little too busy to respond to you, peter.

 

soup: aw, beans.

Notes:

and we never heard from flash again. the end uwu <3

Chapter 5: Peppers And Bread

Summary:

the AcDec kids make their first appearances!

Notes:

im so tired

(See the end of the chapter for more notes.)

Chapter Text

 

Mr Harrington please stop sending memes challenge

 

peterman: i feel like a dried pretzel crumb and the only way to combat that is the shove my head into a bowl of hot lima beans

 

President lincoln: hi what the fuck

 

peterman: you heard me

 

nedleedle: peter i love you but why

 

Scary Captain: parker i swear to god

 

peterman: leave me alone !!!!

 

moonmoon: no no let the man speak

 

moon moon: hes onto something

 

peterman: thank you CINDY


The news(™): pete are you alright?

 

peterman: just dandy

 

peterman: i mean im throwing up into a toilet for the 4th time but

 

President lincoln: what happened?

 

Peterman: jal a pe no s

 

The News(™): translation please

 

moonmoon: you ate a bunch of peppers?

 

peterman: yeth

 

peterman: at the expense of my own morality

 

Scary Captain: the the fuck did you do that for

 

avril lavigne: are you alright?

 

peterman: am fine

 

peterman: im being laughed at though

 

Scary Captain: i guarantee you deserve it

 

nedleedle: peter were you serious about that

 

avril lavigne: about what?

 

nedleedle: he texted me asking if i thought he could beat pj in a pepper eating contest

 

murphy’s law: excuse me what is a pj

 

nedleedle: the scariest man alive

 

peterman: he works for mr stark at my internship

 

fastest man alive: parker for fucks sake stop with the internship

 

fastest man alive: nobody believes you

 

---------

 

Rowdy boys

Small™: hey flash is talking shit

 

Jalapeno eating king: on it

 

-------

Flash Thompson --- Unknown Number

 

Unknown Number: watch your mouth

 

-------

Mr Harrington please stop sending memes challenge

 

Fastest man alive: ok im sorry i take it back

 

moonmoon: wha

 

avril lavigne: whoa

 

President lincoln: what just happened

 

peterman: ;)

 

The News(™): very threatening i like it

 

The News(™): but whats with the jalapenos

 

peterman: well you see

 

peterman: my dearest friend pj and i were watching this video of a guy eating a ghost pepper

 

peterman: and he went “pft i can do better than that”

 

peterman: and i challenged him

 

peterman: but we only had jalapenos so

 

Murphy’s law: this sounds fabricated

 

peterman: i have Never Lied Ever

 

Murphy’s law: i demand an audience with this so called spice god

 

peterman: adsfdgjrthtfd

 

nedleedle: on it

 

[nedleedle has added PJ to the chat]

[PJ has changed their name to ‘spicey’]

 

moonmoon: hello peter’s mystery friend

 

Murphy’s law: we have Questions

 

spicey: hm

 

spicey: ask away

 

The News(™): did you or did you not eat a bunch of jalapenos with peter

 

spicey: yes i did

 

The News(™): who won

 

spicey: me obviously

 

spicey: i ate all of my peppers and then all of peters once he left to go throw up

 

President lincoln: you didnt go to help peter??

 

spicey: no i was eating jalapenos

 

spicey: if i didnt my dog would

 

spicey: and im not letting that happen for a 6th time

 

nedleedle: 6th???

 

spicey: yeah

 

nedleedle: ok

 

Scary Captain: how many peppers did you two eat?

 

spicey: well peter had like 12

 

Murphy's law: peter oh my god

 

peterman: and pj had over 300

 

moonmoon: yo what the fuck

 

avril lavigne: what is wrong with you

 

spicey: i think im going to go for an even 1000

 

President lincoln: ARE YOU STILL EATING THEM???

 

peterman: yes i can confirm

 

peterman: he’s sitting with me on the bathroom floor just eating them out of a grocery bag

 

Murphy’s law: wait i just did the math

 

Murphy’s law: about 960 jalapenos will kill you

 

Murphy’s law: do NOT go for 1000

 

spicey: no its fine i drank laundry detergent as a kid and now my blood is toxic

 

The News(™): i

 

The News (™): ok then

 

Scary Captain: he can do it trust me

 

moonmoon: whats this????

 

moonmoon: michelle jones putting faith in someone????

 

Scary Captain: well i actually like pj. he’s punched a cop in the face

 

spicey: dont forget i stole a cop car

 

Scary Captain: he also stole a cop car

 

moonmoon: good for you…..good for you

 

President lincoln: do any of you know where tyler grayson is?

 

Avril lavigne: im in english with him right now why

 

President lincoln: i decided to not let my feet touch the hallways this month

 

President lincoln: so every day i have been bringing a skateboard to school

 

The News(™): you know how to skateboard?

 

President lincoln: no

 

President lincoln: and thats why i hired tyler to pull me around using a jump rope while i t-pose to instil fear amongst my enemies

 

nedleedle: icon

 

President lincoln: i know but where’s tyler

 

avril lavigne: he said he’s going to be late because he got streamers to attach to your skateboard

 

President lincoln: hm

 

President lincoln: alright i can accept that

 

peterman: what color streamers

 

avril lavigne: rainbow and shiny

 

peterman: oh hell yeah

 

moonmoon: stylish

 

-----------

 SSEA

 

Tony Stank: which one of you fuckers ate all of the bread

 

gitc: ?

 

Tony Stank: there were like 5 loaves

 

Tony Stank: they are all gone now

 

soup: would you be less angry if i told you it was for science

 

Tony Stank: i would not

 

soup: forget i said anything then

 

Tony Stank: peter what did you do

 

soup: nothing!!!

 

Tony Stank: percy?

 

God: i wasnt there

 

God: my friend piper and i are in my cousins attic right now

 

God: we’re making hissing noises and suspicious scuttling to try and convince him we’re raccoons

 

God: we want to see if we can get him to call animal control

 

Tony Stank: 

 

Tony Stank: alright good luck

 

God: thanks

 

Tony Stank: mj? ned? 

 

gitc: peter im sorry

 

soup: ned no!!!!

 

gitc: you know i cant lie to him

 

soup: betrayal…….from my own guy in the chair…..

 

gitc: we wanted to see if peter can eat enough carbs to become immune to bullets

 

Tony Stank: you fucking ate all that bread

 

Tony Stank: wait IMMUNE TO BULLETS



Tony Stank: do not test that. Peter parker i swear to god

 

soup: …….

 

Tony Stank: stay where you are

 

Tony Stank: im already on my way

 

Notes:

if any of you have funky ideas for this please drop them in the comments being funny is hard

also does anyone here know how to put a photo into ao3???

edit: guys i figured out the photo thing. the photo above is in NO WAY related to the story. i just liked it.

Chapter 6: baby avenger :)

Summary:

finally some demigods content !

Notes:

(See the end of the chapter for notes.)

Chapter Text

Judas!!!! No!!

 

not a loser: where the fuck are you two?

 

Loser 1: well

 

Loser 1: uh

 

[Loser 2 has changed Loser 1’s nickname to ‘one hit KO’]

 

one hit KO:  n e d

 

not a loser: what did you guys do???

 

Loser 2: well,,,,,,you see

 

not a loser: holy shit

 

not a loser: i just saw flash leaving morita’s office with a bloody nose

 

not a loser oh my god i think its broken

 

one kit KO:

 

 

Loser 2: 

 

not a loser: oh you FUCKERS

 

not a loser: I CANT BELIEVE YOUVE DONE THIS

 

one hit KO: we’re sorry!!!!!!!

 

Loser 2: it wasnt planned or anything i swear

 

Loser 2: it just

 

Loser 2: happened

 

not a loser: and what, pray tell, actually HAPPENED?

 

one hit KO: flash started talking shit and i gave him what was coming to him

 

Loser 2: 0-0

 

not a loser: wow

 

not a loser: i mean i love the bloodthirstiness but

 

not a loser: peter where the HELL did that come from

 

one hit KO: percy gave me a pep talk (✿◠‿◠) 

 

not a loser: yeah that sounds exactly like him

 

not a loser: how much trouble are you guys in?

 

Loser 2: both suspended. flash was hella close to getting expelled, though

 

Loser 2: and thats not even the best part

 

not a loser: can it really get better than that?

 

Loser 2: yep!

 

Loser 2: so basically may was working and couldnt come get peter, so his ‘brother’ came in. and we were all like tf? Brother? 

 

Loser 2: Then BOOM it was percy fucking jackson

 

not a loser: no shit?

 

one hit KO: yeah it was wild

 

one kit KO: he had a fake identity with a doctorate and everything

 

Loser 2: then he intimidated a confession out of flash and convinced my mom to come with him and peter to get ice cream

 

Loser 2: my mom actually likes him a lot??? they're talking about seagulls.

 

one hit KO: its been going on for like 15 minutes

 

not a loser: wack

---

we had a bonding moment! I cradled you in my arms!

 

crack dealer: and then i pushed him down a well

 

Father of 5: huh

 

Father of 5: is that how all of your grocery trips end?

 

crack dealer: yeah usually

 

Tony Stank: good to know

 

---

 

Preator Party

 

pecan pie: hey have any of you seen hazel????

 

punch: I am also looking for her.

 

panda: not since our lunch date

 

pecan pie: perce?

 

puddle: mcdonalds roof with me and nico

 

panda: may i ask why there?

 

puddle: frank i love you but

 

puddle: no you may not

 

punch: Please tell her she cannot run from her Centurion duties. There is a Senate meeting soon. 

 

puddle: she says “tell reyna i know and thats why im hiding”

 

pecan pie: oh gods

 

pecan pie: can you bring her back please?

 

puddle: hmmmmmmmMMMMMMMMM

 

pecan pie: cmon bro. for me?

 

puddle: for you bro <3

 

pecan pie: bro <3

 

punch: Disgusting. 

 

---

our family tree is a wreath

 

horse girl: percy jackson prepare to die

 

sparky: oh????

 

horse girl: you too, jason. I know he wouldn't do it unless you asked. 

 

pied piper: wait what the shit happened

 

horse girl: i may or may not have been running from a senate meeting

 

horse girl: and nico invited me to hang out with my dearest older brother figure

 

horse girl: so we were on a roof, right

 

horse girl: but then stuPID JASON AND REYNA TEXTED HIM TO BRING ME BACK

 

my chemical ron weasley: it was pretty brutal

 

mcshizzle: nico??? explain????

 

mcshizzle: and wow hazel. tone down the language please.

 

horse girl: sorry i am just VERY ANGRY

 

my chemical ron weasley: she tried to run

 

my chemical ron weasley: a fatal mistake. 

 

sparky: percy??? what did you do?

 

has a buzzfeed unsolved episode: well you see

 

has a buzzfeed unsolved episode: i just so happened to have come directly from work :)

 

my chemical ron weasley: next thing i knew he was grabbing a duffel bag and

 

horse girl: HE FREAKING TRANQ-ED ME 

 

horse girl: HE PULLED OUT AND ASSEMBLED A RIFLE WHILE I RAN FOR MY FREEDOM

 

horse girl: AND SHOT ME

 

my chemical ron weasley: it was terrifying. he did it all so fast

 

pied piper: P E R C Y

 

sparky: BRO

 

has a buzzfeed unsolved episode: and i’d do it again

 

my chemical ron weasley: she was like half a block away-

 

RARA: You shot Hazel with a tranquilizer dart from half a block away?

 

RARA: Impressive. 

 

has a buzzfeed unsolved episode: :)

 

---

 

SSEA

 

Tony Stank: hey percy? :)

 

God: yes tony? :)

 

Tony Stank: why the fuck did i just get a notification from fri that one of our satalites got footage of you chasing and shooting somebody from a mcdonalds? :)

 

mindiana jones: that smiley face looks like its screaming inside

 

God: oh, that

 

Tony Stank: yes, THAT

 

God: i was hanging out with my cousins

 

God: and two of my friends texted that one of them, hazel, was in fact hiding from a Very Important Responsibility 

 

God: and they requested i bring her in

 

gitc: so…..you SHOT her??????

 

God: with a tranquilizing dart, yes

 

soup: oh wow

 

mindiana jones: cool

 

Tony Stank: is your cousin ok????

 

God: yeah of course

 

God: besides she almost killed the earth when she was like 13 so

 

God: she can handle it

 

Tony Stank:

 

Tony Stank: ok.

 

---

 

SSEA

 

[God has changed soup’s nickname to ‘baby avenger’]

 

God: they grow up so fast :,)

 

gitc: ???????????

 

Tony Stank: spiderbaby has joined the avengers jr. reserves

 

gitc: !!!!!!!!!!!!!!

 

baby avenger: :D

 

mindiana jones: good job, peter. 

 

baby avenger: love you to mj!!! <3

 

mindiana jones: … 

 

mindiana jones: …<3

 

gitc: hoLY SHIT

 

gitc: MJ USED A <3

 

mindiana jones: shut up or ill take it back

 

God: we’re proud of you for expressing your emotions, mj.

 

mindiana jones:

 

mindiana jones: thank you percy

Notes:

mj using a <3 is something that can be so personal-

and yes the preator party is just reyna, jason, frank, and percy. i chose to Ignore some canon. currently reyna and frank are the preators.

Chapter 7: He's a war criminal, Barbara.

Notes:

ok so i know you guys are ready for the sequel. but. im not. i also have a bunch of little oneshots written---stuff that didn't make it into The File, or stuff on Percy's past that I changed. (With SHIELD, missions, tartarus, etc.) i was thinking of just posting a collection of them. the timeline would be all over the place---some stuff pre-canon, some during The File, some inbetween The File and the Unnamed Sequel. Nothing super important for the plot moving on, but. if you guys want it?

also SnufflesThePig this is for you <3

CHAT NAMES:
crack dealer/God: percy
gitc: ned
baby avenger: peter
mindiana jones: mj
father of 5/tony stank: tony

(See the end of the chapter for more notes.)

Chapter Text

 

 

Coolest Intern @peterparkour

 

900K Followers | 105 Following





You Know Who I Am @TonyStark

 

425.7 Mil Followers | 32 Following




nick fury @12yearoldterrorist

 

623.1 Mil Followers | 1 Following






Coolest Intern @peterparkour

the internet doesnt get to see the weird stuff that goes around the tower daily and i am very sorry for that

 

Coolest Intern @peterparkour

like??? y'all actually respecting these people 

 

Frogsareneat @littlegreenboy

What??? Does this mean????

 

Coolest Intern @peterparkour

it MEANS that the avengers are all meme loving disasters. all of them. they are so weird. 






merp @lowla

ok so you guys know that avengers intern account right

 

weenie @cissiesmith

The one just called the avengers memers???? 

 

merp @lowla

thats the bitch. anyways. 

 

merp @lowla

What do you guys think he MEANS????

 

mossboy @localfungi

if he tells me thor knows vines ill cry i swear to god

 

Mindy @mindyydnim

Ok but you guys just believe him???? Hes probs lying

 

astrology, hoes @starcharts

Shut the fuck up i would trust him with my life






 

SSEA

 

gitc: hey mr stark?

 

gitc: is nick fury alive?

 

mindiana jones: is this about the twitter account?

 

gitc: YES THIS IS ABOUT THE TWITTER ACCOUNT

 

Tony Stank: what are you talking about?

 

baby avenger: ill send you the link

 

 


 

 

SSEA

 

Tony Stank: i

 

Tony Stank: he’s alive but. I have no clue if this is him or not

 

Tony Stank: im going to follow him

 

 




You Know Who I Am @TonyStark

 

425.7 Mil Followers | 34 Following






ferris wheel fighter @uhov4hiorei

uh hey guys???? am i having a reaction to my meds or did tony stark just follow that intern kid AND the cryptic nick fury account???????

 

Turtleducks @duckys<3

HE DID WHAT THE FUCK

 

astrology, hoes @starcharts

PB DESERVES IT HES THE BEST INTERN

 

astrology, hoes @starcharts

that nick fury account is just mad funny though

 

Pepper potts marry me challenge @deno

Is that the actual nick fury???????

 

merp @lowla

Nick fury does NOT run a crytpid conspiracy meme account. I refuse to believe. 

 

merp @lowla

Hes also dead but thats not the weird part

 

chiecken @bord

tstark only follows people he knows?????? Plus a few charities and shit

                

chiecken @bord

And the nick fury account is an Experience but its not a charity. That means it HAS to be nick fury himself

 

I feel like a sad rug @woooooo

i am Confused

 

ferris wheel fighter @uhov4hiorei

Dude check out the account its @12yearoldterrorist






nick fury @12yearoldterrorist

 

623.1 Mil Followers | 1 Following



 

 

nick fury @12yearoldterrorist

I once defeated a peacock because it looked at me funny. I hissed at a gargoyle and it shattered into dust. I eat nails for breakfast and strawberry milkshakes for lunch. dont try me

 

nick fury @12yearoldterrorist

an amendment: unless you’re captain america. please try me so i can effortlessly defeat you in hand to hand combat. 

 

 

 

nick fury @12yearoldterrorist

poll: hey guys should i or should i not dump this catcaller in the bay

Decimate him : 83% | same answer but over here: 63%

 

 

 

nick fury @12yearoldterrorist

hey google how much paper can i eat before dying



 


 

 

I feel like a sad rug @woooooo

this guy is fucking crazy, i love it

 

I feel like a sad rug @woooooo

He literally has more followers than the president

 

Turtleducks @duckys<3

are we going to ignore how the poll somehow got higher than 100%??? My mans got 146% of votes. what. 

 

suspiciously round dog @ORB

he(?) issues public threats to captain america.

 

weewonk @weewonk

Ive never loved a man more

 

Babs @BarbaraLewis

This man is threatening an American icon! This isn’t funny, or a joke!

 

I feel like a sad rug @woooooo

he’s a war criminal, barbara.

 

astrology, hoes @starcharts

Manifesting that the nick fury imitation(?) account tracks down and defeats captain america






Trending:

#he's a war criminal, barbara

#stark clean energy

#met gala

#mr. fury please duel him

#sokovia accords

 

 


 

 

SSEA

 

Tony Stank: it sounds NOTHING like fury but the security is so good?? an imitation wouldnt have that kind of firewalls

 

gitc: should i try hacking it?

 

Tony Stank: ...no. No, i want to see how this plays out.

 

 


 

 

nick fury @12yearoldterrorist

due to popular demand, i will be fighting steve ‘bitchass’ rogers. swords at dawn, coward. 

 

Frogsareneat @littlegreenboy

GUYS HES FUCKIN DOING IT-

 

merp @lowla

HE RESPONDED ASDJGSDLHFJ I FEEL LIKE I JUST SPOKE TO MOTHMAN

 

ferris wheel fighter @uhov4hiorei

Captain america is shaking in his boots






we had a bonding moment! I cradled you in my arms!

 

Father of 5: this is going to sound weird but

 

Father of 5: would fury have social media?

 

crack dealer:

 

crack dealer:

 

crack dealer: what

 

Father of 5: hypothetically, of course

 

crack dealer: i have no idea?????

 

crack dealer: the only time we talked was when he sent me on a mission or yelled at me

 

Father of 5: hmm

 

Father of 5: thanks anyways

 

crack dealer: why do you ask? 

 

crack dealer: tony?

 

crack dealer: tony????????






SSEA

 

God: i just got a vaguely threatening message from tony what happened

 

gitc: nothing

 

baby avenger: nothing

 

mindiana jones: nothing

 

Tony Stank: mind your own business. 

 

Tony Stank: we’re investigating. 


God: ?????????????????????

Notes:

the nick fury account idea came from one of you. i looked through like, ALL of the comments, but for the life of me i couldnt find who it was. if you are the genius who birthed this idea, please tell me.

edit: i figured it out, boys. lilithdcclxxvii, you have my eternal gratitude. genius.

Chapter 8: Family Reunion

Summary:

babey avenger: percy?

 

Tony Stank: he’s probably not on his phone right now. He’s at a family reunion

 

mindiana jones: like. his mom’s family, right?

 

Tony Stank: i sincerely hope so.

Notes:

a godly family reunion is something that is very funny to me

(See the end of the chapter for more notes.)

Chapter Text

SSEA

 

God has changed their name to ‘Godly buttkicker’

 


 

Tony Stank: is everyone really going to just ignore that name

 

mindiana jones: yeah

 

baby avenger: yeah

 

gitc: yeah

 

Godly buttkicker: yeah

 

Tony Stank: ok

 

---

Mr harrington please stop sending memes challenge

 

moonmoon: would you guys do the nasty with hawkmoth

 

nedleedle: why would you ask this. Right in front of god??

 

murphy’s law: would i  w h a t

 

moonmoon: you know. The Nasty

 

moonmoon: cork the onion

 

moonmoon: dip the fondue

 

moonmoon: illegal breakdance

 

President lincoln: im begging you to stop

 

moonmoon: only if you answer the question

 

Avril lavigne: i would 100%

 

Murphy’s law: SALLY

 

Avril lavigne: what????? Have you seen that guy

 

president lincoln: dilf

 

murphy’s law: NO

 

moonmoon: thank you abe

 

moonmoon: @peterman @nedleedle @TheNews(™) @scarycaptian

 

peterman: what?

 

President lincoln: scroll up

 

peterman: 

 

peterman: cindy are you alright

 

moonmoon: i will be as soon as all of you answer the question

 

nedleedle: he’s rich?

 

moonmoon: yep

 

nedleedle: then hell yes

 

The News(™): no bc i like adrien and his dad is a piece of shit

 

moonmoon: fair point

 

moonmoon: so to recap:

 

moonmoon: sally and abe would bc they think hes hot

 

moonmoon: ned would because he likes money

 

moonmoon: charles wouldn't because hes a party pooper

 

moonmoon: betty would not because hes a bad dad and doesn't deserve her

 

murphy’s law: i wouldn't do it because hes old ugly and mean!!!!!! 

 

moonmoon: uh huh. Anyways. mj? Pete?

 

Scary Captain: No.

 

moonmoon: 

 

moonmoon: ok have a nice day

 

peterman: i cant answer

 

Avril lavigne: booooo!!!!

 

Murphy’s law: we all had to answer !

 

peterman: yes but consider this: 

 

peterman: i am babey

 

The News(™): hes got a point guys

 

President lincoln: yeah thats fair

 


 

ned-->peter

 

Peter: are you thinking what im thinking

 

Ned: 100%

 


 

SSEA

 

gitc: mr stark

 

gitc: percy

 

gitc: would you do the do with hawkmoth

 

Tony Stank: i worry about you kids sometimes

 

mindiana jones: but would you?

 

mindiana jones: im actually a bit curious

 

Tony Stank: no, i am cuter and richer than him

 

babey avenger: fair

 

babey avenger: percy?

 

Tony Stank: he’s probably not on his phone right now. He’s at a family reunion

 

mindiana jones: like. his mom’s family, right?

 

Tony Stank: i sincerely hope so.

 


 

Godly buttkicker: Photo Attachment

[Percy is standing in what looks like a giant field. A few temples high up on a far away hill can be seen in the background. He is posing with ten people---a girl with dark skin and curly hair, a pale boy in an aviators jacket, a punk-looking girl in silver, a blonde boy with glasses and a scar on his lip, a man wearing gold with a startlingly bright smile, an auburn haired woman with a bow on her back, a curly haired man wearing a UPS uniform, a man with a scowl and a buzzcut, a portly man holding a coke, and a burly man with leg braces]

 

Godly buttkicker: me and some of my first cousins!

 

mindiana jones: s o m e

 

Tony Stank: dear god

 

babey avenger: gods, actually.

 

gitc: all of those are gods except for the four we met right

 

Godly buttkicker: yep :)

 

gitc: ok then

 


 

Godly buttkicker: Video Attachment

[The cameraman is shakily holding a phone, laughing behind the camera. Percy is seen standing with a strong looking brunette girl wearing camo pants. They are in the middle of what looks to be the longest handshake known to man. The cameraman whispers into the microphone, now recognizable as Hazel:

 

Hazel: he and clarisse have known each other since they were 12. They do this every time they see each other. We’re about 4 minutes in so far.

 

The two do a fistbump and then a series of handshakes and a clap

 

Percy: you are the ugliest person i’ve even met. you get worse every year. every time i see you i gag a little. 

 

Clarisse: i have never met anyone more worthless or pathetic than you

 

They bump elbows and then knees, then continue on for half a minute.

 

Clarisse: Wait a damn minute, you little shit---

 

End of description]

 

Godly buttkicker: she falls for it every time. The last i remember of her face was when she was like fifteen. 

 

babey avenger: that handshake inspires us all

 

gitc: pete and i will strive to do better

 


 

Godly buttkicker: pic with the fam :)

 

Godly buttkicker: [Photo attachment]

 

[It is an aerial view of a field jampacked with people. Seriously, it’s like a football stadium’s worth of people, standing shoulder to shoulder. There are so many people here. What the fuck.]

 

Godly buttkicker: most of the nature spirits werent able to make it, plus we didn't invite the super evil ones, so its not everyone, but we did our best

 

Tony Stank: 

 

baby avenger:

 

mindiana jones:

 

gitc:

 

Godly buttkicker: im in the corner by most of the horses :)

 

Tony Stank: HORSES????????

 

mindiana jones: i have never considered the ramifications of the greek gods being real until now. I regret that deeply. 

 

Godly buttkicker: i’m related to a whirlpool with teeth

 

gitc: now you cant just go around saying stuff like that

 

baby avenger: why.

 

Godly buttkicker: my dad’s a whore and i suffer for it

 


 

Our family tree is a wreath

 

Horse girl: percy where are you 

 

Horse girl: the mild grievance matches are about to start

 

Has a buzzfeed unsolved episode: on my way

 


 

SSEA

 

Godly buttkicker: Video Attachment

[It is what looks like a boxing ring. Two people are fighting in it, weapons discarded at a table next to the entrance. They are both swearing at each other loudly and viciously]

 

Tony Stank: theres a boxing ring at your family reunion?

 

Godly buttkicker: there isn't at yours?

 

Godly buttkicker: oop---

 

Godly buttkicker: Video Attachment:

 

[The crowd is cheering as the two fight. In the front row, one person accidentally twacks someone in the face with an excited arm. They punch them back, and soon enough the two are rolling on the ground, fists flying]

 

mindiana jones: oh my god

 

gitc: violent

 

Godly buttkicker: i know its great

 

Godly buttkicker: hey i love this partaasdfghjkgrehreds

 

Tony Stank: 

 

Tony Stank: perce?

 

baby avenger: they killed him

 

gitc: damn :/

 

mindiana jones: dibs on his knives

 

baby avenger: we’ll take care of mrs o'leary together

 

gitc: a group effort to raise her right

 

Tony Stank: ill pay for her college

 

mindiana jones: we expect no less

 

Tony Stank: i can get her into MIT with one phone call

 


 

Godly buttkicker: Video Attachment

[Everyone is fighting. The entire field, people are yelling and swearing. Some are wrestling, some fistfighting, some sword and knife fighting. Spears, clubs, and batons are being used as well. Somebody throws a shield. There is a group of kids off to the side arming cannons towards a specific group of people. Another kid gets turned into a piglet by a cackling girl. Arrows are being shot all the way across the field. Many things are on fire.

Percy is in the middle of this. He is beating down a man---the one with the buzzcut from the cousin's photo. There is a small ring of people around them cheering.]

 


 

Godly buttkicker: Video Attachment: 

[Its even more chaotic now, somehow. Lightning is striking down. Percy is standing with a group of very pretty looking people on a raised platform of earth that he clearly made, and he is smiling while they all issue random commands that, for some reason, the people down below are following. 

 

Unknown: Alright, that’s enough!

 

Lightning begins to strike down. Percy laughs, as does the girl next to him.

 

Percy: Bring it on!

 

Unknown girl: Try us, Sparky! ]

 


 

Godly buttkicker: Video Attachment: 

[Mid-air now, Percy is wrestling with ‘Sparky’, now identified as his cousin Jason. The punk girl is cheering Percy on until the girl from before sneaks up on her and tackles her to the soggy grass. ]

 


 

Godly buttkicker: Video Attachment: 

[The phone is now being held by the pale boy with the aviators jacket.

 

Nico: Hey, it’s Nico now. Percy gave me his phone because his third least favorite half brother showed up. Percy’s going to beat his ass. It’ll be great.

 

He zooms the camera in to a clearing in the field, where a young man, with a vague resemblance to Percy, stand. The man’s chin in tilted up, nose in the air. 

 

Nico: That’s Triton. He sucks. Over there is his mom, Amphitrite, and Poseidon. 

 

Indeed, a pretty woman is standing, looking a little annoyed, while Triton gloats. Poseidon just looks resigned.

 

Triton: —father’s favorite, I’m his heir—

 

Percy: —you’re both immortal, dumbass, you’re not gonna inherit shit—

 

Triton: —if he hadn’t wasted his time with that mortal, you wouldn't have—

 

Percy: —you little pissbaby, get a fucking hobby—

 

Triton: —I'm actually Atlantean, unlike you, halfbreed—

 

Percy: —you pathetic little bitch, seriously, you've been saying this almost a decade, i still don't care—

 

Triton: —soiled our bloodline with that peasant of a mortal woman—

 

It grows scarily silent. Poseidon raised a sole eyebrow. 

 

Percy: did you just insult my mom?

 

A collective ‘oooh’ goes across the thousands watching. Triton takes a step back. 

 

Triton: I—

 

Percy is already running at him.]

Notes:

how many of you people have read six of crows? i have a fun little fic idea for it. mostly crack, but it'd be something with the crows repeatedly breaking into the palace, just for fun. thoughts?

opinions on fucking hawkmoth, drop them down below

Chapter 9: he do be knitting though

Notes:

(See the end of the chapter for notes.)

Chapter Text

SSEA

 

baby avenger: you know

 

baby avenger: i feel like the internet misses out on a lot

 

Tony Stank: what?

 

baby avenger: you know. everyone looks up to the avengers and stuff

mindina jones: but they still dont know how stupid you guys are

 

baby avenger: h e y

 

mindiana jones: are you going to look me in the eyes and tell me im wrong?

 

baby avenger:

 

baby avenger:

 

baby avenger: damn

Godly buttkicker: im a dumb bitch, sure 

 

Godly buttkicker: but everything i do is calculated to the decimal

 

Godly buttkicker: you guys just dont like my math

 

mindiana jones: fair

 

Tony Stank: i do hate 70% of the things you do

 

Godly buttkicker: thank you i try

 

Godly buttkicker: my friend piper is reading over my shoulder and says she agrees

 

baby avenger: i just realized the internet dosent really know anything about percy

 

Godly buttkicker: wdym

 

Godly buttkicker: oh wait

 

Godly buttkicker: i forgot you guys didnt know about the terrorist thing

 

gitc: the what

 

Tony Stank: the WHAT

 

Godly buttkicker: uh later skaters

 

Tony Stank: PERCY

 


 

baby avenger: ok so while mr stark is going to try and chase percy down

 

baby avenger: i will be informing the masses

 

baby avenger: mr stark? Any objections?

 

baby avenger: none?

 

baby avenger: ok thanks for you compliance (✿◠‿◠)

 


 

Coolest Intern @peterparkour

The Newest Cryptid: The Agent Who Lives In Stark Tower

 

[ Video description: The camera is set on a counter, slightly hidden behind a bowl of fruit. In the kitchen, Tony Stark is facing away from it, focused on a cutting board. He works in silence for a minute, before another person enters the kitchen.

 

TS: Hey, Aquaman, is my water boiling?

 

‘Aquaman’ turns towards the stove and walks over to the pot. He then proceeds to stick his hand into it, up to his wrist. He holds it there for a second.

 

PJ: Yes.

 

He pulls his hand out of the pot, seemingly unbothered. He then picks up an apple, and leaves the kitchen. End of video description. ]

 


 

Frogsareneat @littlegreenboy

hey hi yes what the fuck

 

merp @lowla

who---

 

mossboy @localfungi

god bless mr. parkour for keeping the tony stark fans well fed

 

weenie @cissiesmith

well yeah but WHO THE FUCK IS THAT

 

Frogsareneat @littlegreenboy

and he just stuck his hand in boiling water???????????? Um???

 


 

Tony Stank: peter. 

 

baby avenger: yes?

 

Tony Stark: what did you just post

 

baby avenger: documentary

 

gitc: its quality stuff

 

Tony Stank: i swear to god you live to give me gray hairs

 

baby avenger: i needed to spread the word, mr stark. I will be their messiah

 

Tony Stank: 

 

Tony Stank: i dont even know how to RESPOND to that

 

Tony Stank: did you ask percy?

 

baby avenger: kind of???

 

Tony Stank: elaborate. 

 

baby avenger: i walked over. i asked him if i could do something

 

baby avenger: he cut me off and said, and i quote

 

baby avenger: “i dont care as long as its to cause chaos”

 

Tony Stank: everything about that man unnerves me a little bit.

 

baby avenger: “also you wouldn't last in jail. keep that in mind.”

 

mindiana jones: its true you look like you belong in a pixar movie

 

baby avenger: :(

 

mindiana jones: my point? proven. 

 


 

Mr harrington please stop sending memes challenge

 

[Scary Captain has removed fastest man alive]

 

President lincoln: oop--

 

The News(™): ppft

 

peterman: MJ!

 

Murphy’s law: and we love to see it

 

moonmoon: i saw this and almost crashed my car

 

nedleedle: oh i forgot! Hows drivers ed?

 

moonmoon: scary. dont like it

 

Avril levigne: god thats a mood 

 

peterman: i think you are the only two taking it right now

 

Scary Captain: yeah, none of us have our license 

 

moonmoon: so none of you can help me cheat on my test (¬_¬)

 

peterman: well you see. None of us have taken it.

 

Avril levigne: fake friends smh

 

peterman: :(

 

Avril levigne: not you peter you amaze us all every day

 

peterman: :)

 

Scary Captain: disgusting. 

 

nedleedle: you say it like you dont love peter with your whole heart like the rest of us

 

Scary Captain: thin ice, leeds.

 

President lincoln: im not seeing any denial 👀

 

The News(™): oop

 

peterman: hey wait a second

 

peterman: !!!!! idea

 

peterman: there is one among us who can drive

 

Avril lavigne: pete, you know mr harrigton got his license revoked for hijacking that truck

 

peterman: well yeah duh

 

peterman: but

 

peterman: @spicey

 

spicey: im busy what you want

 

Murphy’s law: oh my god i forgot he was here

 

spicey: all in a days work

 

peterman: but you know how to drive right?

 

spicey: i can drive, yes

 

peterman: ok cool so you have a license and stuff

 

spicey: ...i can drive, yes

 

moonmoon: dubious but ill take it

 

moonmoon: how do i win the drivers test

 

spicey: take car. drive away. go fast.

 

moonmoon: thank you for your wisdom

 

Murphy’s law: im pretty sure thats horrible advice, cindy

 

spicey: and im pretty sure you’re failing english, charles.

 

The News(™): WOAH

nedleedle: GODDAMN



peterman: WHY WOULD YOU KILL HIM LIKE THAT

 

spiecy: i didnt get shot on international television for this

 

peterman: what

 

President lincoln: McScuse Me

 

Avril lavigne: ???

 

nedleedle: explain??

 

spicey: no

 

moonmoon: uhhhhhh ill send pictures of my dogs if you do??

 

spicey: oh hell yeah thats a deal




 

Rowdy boys

 

Small™: percy you cant see the pictures???

 

Jalapeno eating king: they’re for mrs oleary duh

 

Small™: oh shit my b

 

Small™: also i know you can drive but

 

Small™: can i ask how?????

 

Jalapeno eating king: 🤪

 

Small™: fear

 

 


 

Mr harrington stop sending memes challenge

 

spicey: remember like. The stark gala a while ago ?

 

Avril lavigne: holy shit yeah it was super scary

 

moonmoon: yeah i remember it was all the news would cover for like a month

 

spicey: heh yeah

 

spicey: and remember that guard that took the bullets

 

nedleedle: yeah?

 

The News(™): w

 

The News(™): THAT WAS YOU?????

 

spicey: yeah

 

peterman: PJ

 

peterman: DUDE

 

spicey: nah its chill i got to keep the bullets

 

Scary Captain: literally why would you want that?

 

spicey: they entered my organs. im keeping them. I deserve it.

 

spicey: legally nobody can stop me

 

Murphy’s law: i mean

 

Murphy’s law: i guess????

 

moonmoon: but you just. got shot??

 

spicey: three times on tv yes

 

President lincoln: are you ok??

 

spicey: lmao yeah

 

spicey: if i get a few more ill be up to 69

 

Murphy’s law: nice

 

moonmoon: nice

 

Avril lavigne: nice

 

President lincoln: nice

 

nedleedle: nice

 

Scary Captain: nice

 

The News(™): nice

 

peterman: nice

 

President lincoln: wait one second

 

President lincoln: you'll be up to 69 what

 

moonmoon: bullet wounds???

 

The News(™): wait PLEASE tell me this man is not talking about gunshots like pokemon cards

 

nedleedle: honestly

 

peterman: we dont even know either

 

peterman: pj???

 

Murphy’s law: dude??

 

The News(™): mr pj spicey please we are on the edge of our seats

 

Scary Captain: and there he goes. He has delivered his cryptic message

 

nedleedle: and now, he is gone

 

President lincoln: pj is the only valid cryptid

 

Avril lavigne: rt

 

Murphy’s law: also i love how he didnt react at all to the knowledge that mr harrington hijacked a truck

 

nedleedle: tbh pj probably helped him

 

Scary Captain: yeah, he’s like that. 

 

peterman: he just walked over to me and went “you see, that’s the exact type of person who should be influencing young minds” then went back to his knitting

 

moonmoon: h

 

moonmoon: he knits?

 

nedleedle: yes he makes us sweaters


peterman: god bless

Notes:

ok so i need your guys opinions on calypso. because like. immortal lady, older than most of the gods, falls in love with a 14 year old boy and tried to get him to stay with her forever? and then curses a 14 year old girl out of jealousy??? idk man. kinda fishy.

Chapter 10: violence on SIGHT

Summary:

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i straight up dont believe this im sorry

 

baby avenger: see for yourself then

 

gitc: dibs on making the account

Notes:

percy on twitter??? more likely than you think

(See the end of the chapter for more notes.)

Chapter Text

SSEA



Godly buttkicker: are none of you really gonna explain what the questions about fury were about

 

Tony Stank: no

 

Godly buttkicker: tell me or else

 

Tony Stank: or else what

 

Godly buttkicker: OR i send pepper and rhodey the video of you laying on the floor covered in spaghetti

 

Tony Stank:

 

Tony Stank: you are the worst person alive

 

Godly buttkciker: <3

 

mindiana jones: weak.

 

Tony Stank: you underestimate how hellish my life would be if the two of them get their hands on that photo

 

Tony Stank: i dont even know how percy got it, honestly

 

Tony Stank: i was alone when that happened

 

Godly buttkicker: thats what they all think 

 

baby avenger: o-o

 

mindiana jones: i present percy jackson, deathstroke, the living embodiment of the >:) emoticon

 

baby avenger: ppft

 

[baby avenger has changed Godly buttkicker’s name to ‘>:)’]

 

>:):

 

baby avenger: WAIT

 

gitc: ?

 

[baby avenger has changed >:)’s name to’ ( ̿ ̿▀‿▀)▬▬ι═══════ﺤ’]

 

Tony Stank: oh my god its perfect

 

mindiana jones: how long did it take you to find that

 

baby avenger: like 15 minutes but it was totally worth it

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: thank you i love it

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: but dont think you can distract me from the fury social media questions

 

Tony Stank: damnit

 

gitc: percy, do you have social media?

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: no

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: demigods and phones dont really mix

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: its basically a homing beacon for monsters

 

mindiana jones: holy shit really???

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: yeah i never really had a phone growing up, other than a landline

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: even after i was an Adult(™) and moved out, and my family wouldn't be in danger, i only really used burners

 

baby avenger: wack

 

Tony Stank: yeah a lot makes sense now

 

mindiana jones: huh

 

mindiana jones: interesting

 

mindiana jones: but basically, theres an account that people believe is nick fury

 

gitc: and it has like, mad firewalls. I cant crack it

 

baby avenger: the account literally has more followers than the president

 

gitc: its all shitposts, too

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: ...and you guys actually think that’s fury????

 

Tony Stank: with that kind of encryption?? Absolutely. 

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: 

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i straight up dont believe this im sorry

 

baby avenger: see for yourself then

 

gitc: dibs on making the account

 

Tony Stank: oh god

 

Tony Stank: this wont end well

 


 

kelp face @localcryptid

 

0 Followers | 0 Following

 


 

SSEA



( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i knew introducing you to Thalia was a mistake

 

gitc: shrug emoji

 

mindiana jones: did you just type shrug emoji

 

gitc: no

 

mindiana jones: *squint*

 

mindiana jones: aight that checks out

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: HEY WHAT THE FUCK

 

Tony Stank: what??????

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: IM the 12 year old terrorist here!!!

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: ooooooh when i find this bitch its game over

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: thats my thing :(

 

mindiana jones: i mean if you can find them

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: >:)

 


 

kelp face @localcryptid

@12yearoldterrorist

 

kelp face @localcryptid

@12yearoldterrorist

 

kelp face @localcryptid

@12yearoldterrorist

 

kelp face @localcryptid

@12yearoldterrorist

 

kelp face @localcryptid

@12yearoldterrorist

 

nick fury @12yearoldterrorist

What

 

kelp face @@localcryptid

Bitch

 

nick fury @12yearoldterrorist

oh

 


 

SSEA



baby avenger: !!!! he made contact!!!!

 

gitc: finally some plot development

 

baby avenger: what

 

gitc: what

 


 

tony stark stan account @ilovehim

Shoutout to the one and only billionaire ever

 

Iron man <3 @starkswife

*slides you a double-sided piece of notebook paper written in gel pen*

reasons i love tony stark:

-clean energy!!! Icon :)

-simps for pepper potts

-kicked justin hammer in the nuts, on live TV

-this was before we knew he was a supervillain

-gives so many scholarships, dude

-hot 

-im just kidding

-sort of.

-found out his business partner was selling under the table weapons to terrorists and nazis and just straight up killed him

-uses his position to uplift other peoples voices!!!!!

-pays for damage the other avengers *cough cough captain america cough cough* cause

-sells prosthetics for free???? Because he can???

-pretty :)

 

Captain America Hate Blog @teamironman

You also forgot that he either 

  1. Has a teenage intern who regularly makes fun of him, and allows it

Or

  1. Just follows the account because he thinks its funny



Iron man <3 @starkswife

god youre so right

 

Coolest Intern @peterparkour

ive been summoned

 

Coolest Intern @peterparkour

oh???

 

Coolest Intern @peterparkour

a simple addition:

-always tells his bots he’ll donate them to a community college, but once punched a general who was mean to them

-makes me hot chocolate

-let me keep a kitten in the tower for a week until it was healthy

-gives good hugs

 

tony stark stan account @ilovehim

we’ve been graced with the presence of a god

 

Avengers!!!! @superherostan

Mr parkour ill give you my kidney to describe what his hugs are like

 

Coolest Intern @peterparkour

I would never take your kidney!!!!!! Ill tell you for free :)

 

Coolest Intern @peterparkour

they are WARM and SOFT and he smells NICE

 

Coolest Intern @peterparkour

easily a 12/10

 

Iron man please marry me @starklover

oh my god,,,,,,,,,,,

 

Avengers!!!! @superherostan

soft 

 

Captain America Hate Blog @teamironman

soft 

 


 

merp @lowla

Wait nobody @ed the intern kid

 

merp @lowla

How did he find the thread

 

tony stark stan account @ilovehim

OH MY GOD

 

tony stark stan account @ilovehim

mr. parkour were you just scrolling through the tony stark stan pages???

 

Coolest Intern @peterparkour

...no comment

 

Frogsareneat @littlegreenboy

A W W W W

 


 

You Know Who I Am @TonyStark

 

425.7 Mil Followers | 35 Following

 


 

weenie @cissiesmith

ok so we agree the intern kid is legit, we’ll never find out about the nick fury account

 

weenie @cissiesmith

but TS just followed someone else???

 

mossboy @localfungi

oh shit who

 

weenie @cissiesmith

@local cryptid ??????

 

Mindy @mindyydnim

alright now who the FUCK is this

 

Mindy @mindyydnim

they aren’t following anyone, never posted anything????

 

astrology, hoes @starcharts

wait no he just posted something

 

astrology, hoes @starcharts

he called the nick fury account a bitch????

 

ferris wheel fighter @uhov4hiorei

the account was JUST made

 

ferris wheel fighter @uhov4hiorei

so let me get this straight

 

weenie @cissiesmith

you cant get anything straight but continue

 

ferris wheel fighter @uhov4hiorei

bitch i---

 

ferris wheel fighter @uhov4hiorei

ANYWAYS as i was saying

 

ferris wheel fighter @uhov4hiorei

this person makes a twitter account, gets followed by tony stank but dosent follow him back, because they were too busy verbally attacking the cryptic nick fury account

 

Pepper potts marry me challenge @deno

and it was on SIGHT too

 

weenie @cissiesmith

wild

Notes:

i mean i KNOW tony stark has fan pages. i know he does.

im also accepting ideas for this now btw :) my brain bank account is broke

for anyone wondering: the photo percy was talking about was taken while tony was cooking. it was directly related to how tony found out percy could stick his arm in boiling water without dying on sight. screaming and fear were involved.

Chapter 11: girlbossing B)

Summary:

The News(™): i cant believe tony stark outed himself as a thot

 

moonmoon: the world will never emotionally recover

Notes:

(See the end of the chapter for notes.)

Chapter Text

Mr harrington please stop sending memes challenge

 

moonmoon: gaslight, gatekeep, girlboss. mansplain, manipulate, malewife. 

 

moonmoon: choose your alignment 

 

Scary Captain: girlboss

 

nedleedle: gatekeep

 

The News(™): also girlboss

 

Murphy’s Law: mansplain

 

president lincoln: i feel like i could pull off malewife

 

peterman: i do too

 

peterman: gaslight is pretty tempting tho

 

avril lavigne: peter you couldn't lie to save your life

 

peterman: hey!!!!

 

peterman: yes i could >:(

 

Murphy’s Law: dude you cant keep anything a secret

 

Murphy’s Law: when betty planned a surprise party for me last year?? Remember?

 

moonmoon: charles asked what we were talking about, you freaked out and yelled “apples aren't real” 

 

peterman: I PANICKED OKAY???

 

avril lavigne: don't worry peter, we still love you

 

avril lavigne: even though you couldnt keep a secret if your life depended on it

 

peterman: 

 

peterman: ok

 

nedleedle: what do you think mr. stark is???

 

peterman: i have no idea

 

moonmoon: peter. If you go up and film you asking him, i will give you my kidney

 

peterman: hmmmm

 

peterman: well i have been in the business for a new one

 

peterman: you’ve got yourself a deal, moon

 

---

 

Rowdy Boys

 

Small™: im about to do something hilarious

 

Small™: come to the lab

 

jalapeno eating king: im running—

 

---

 

peterman: Video Attachment

 

[Video description: Peter is walking with his phone, the camera sneakily pointed at the floor. All we can see is his socks---they are patterned with Thor’s hammer. He is heard quietly snickering as he walks across the shiny tiled floors.

 

Peter: Hey, Mr. Stark? 

 

Tony: What’s up, kid?

 

Here, Peter clears his throat, clearly psyching himself up. Then, through a laugh, he says:

 

Peter: Do you feel like a girlboss?

 

Tony: … 

 

Tony: What?

 

Peter giggles.

 

Peter: Girlboss, gaslight, or gatekeep?

 

Tony is silent. 

 

Peter: Or, perhaps, you feel a stronger connection to mansplaining? Manipulate, or malewife?

 

Here, Peter risks moving the camera up to get a shot of Tony’s blank face. 

 

Tony, quietly: Is this one of those trends you like?

 

Peter: Irrelevant. 

 

Tony sighs and turns back to his workbench. It is silent for a long moment, the man focused on his project. Then, consideringly, he adds;

 

Tony: Manwhore. 

 

Peter’s roaring laughter is cut off by the video ending.

 

End of video description]

 

moonmoon: PFFFFT-

 

President Lincoln: BHAHAHAHAHA

 

avril lavigne: WHAT THE FUCK OH MY GOD

 

nedleedle: p e t e r

 

peterman: your kidney. hand it over. 

 

---

 

SSEA

 

baby avenger: percy is on the floor laughing

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: adfrejkrekjbgrebjk can you blame me????

 

baby avenger: oh my god you keysmash

 

baby avenger: does percy jackson is do gay?

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: pete. 

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: im ancient greek

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: at this point i think its an inherited trait

 

mindiana jones: mmm fair point

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: when i came out to my dad he was just like “yeah” 

 

gitc: f

 

gitc: cindy is losing her mind rn

 

Tony Stank: i stand by what i said

 

mindiana jones: ive never liked you more than i do now

 

Tony Stank: thanks? I think?

 

---

 

Mr harrington please stop sending memes challenge

 

The News(™): i cant believe tony stark outed himself as a thot

 

moonmoon: the world will never emotionally recover

 

president lincoln: peter. If you know tony stark

 

president lincoln: and HE knows pepper potts,,,,

 

peterman: !!!!!!!!!!

 

avril lavigne: DO NOT

 

Murphy’s Law: if you ask pepper potts if she’s a gatekeeper, i think god will strike you down without question

 

Scary Captain: peter. Im warning you

 

Scary Captain: dont bother ms potts

 

nedleedle: i think its too late

 

nedleedle: hes probably running up the stairs in the tower as we speak

 

The News(™): a preemptive rip for one peter benjamin parker

 

president lincoln: rip

 

avril lavigne: dont even go there abe

 

avril lavigne: you are the one that started all of this

 

---

 

peterman: Video Attachment

 

[Video description: Peter is sprinting up the stairs and down a nice-looking hallway at inhuman speeds. He stops at a large oak door. In the placard by the room number, the name V. Potts is displayed. Peter knocks politely on the door. 

 

Pepper, muffled: Come in!

 

Peter briskly opens the door and walks to the desk. He slams a hand down on the wood.

 

Peter: Ma’am.

 

Peter: Would you classify yourself under the category of girlboss, gaslight, gatekeep, manipulate, mansplain, or malewife?

 

Pepper looks distinctly amused. She cups her chin in her palm, tilting her head to the side a little. 

 

Pepper: Hmm… 

 

She nods once. 

 

Pepper: I’d have to say I’m partial to girlboss, myself. Though manipulate is a good one as well. 

 

Peter: Thank you for your service.

 

The video cuts to a confused man in decorated military dress sitting on the couch, looking up at Peter from a stack of paperwork. 

 

Rhodey: I’m sorry, what?

 

Peter: If you had to classify yourself, Mr. Colonel Rhodes War Machine Sir. What would you pick?

 

The Colonel still looks a little confused, but considers it. 

 

Rhodey: Uh, gatekeep? 

 

Rhodey: And what have I told you about calling me that?

 

Peter laughs. 

 

Peter: Thank you for your time, Colonel.

 

The camera cuts, once more, to a different setting. An abnormally large black dog is sitting on the couch, drooling on what looks like a very expensive pillow. She wears an ocean colored collar and a white harness with fluorescent stripes. 

 

Peter approaches the behemoth of a dog, cooing and baby talking.

 

Peter: Who’s a good girl? Aw, it’s you. Best girl. Fantastic dog. 

 

The dog breaks out into a smile, showcasing canines as long as Peter’s pinkie. He reaches forward and rubs her head. 

 

Peter: You’re a girlboss. I just know it. 

 

She licks his hand. 

 

Now, he moves the camera away from the dog to the cushy armchair next to it. A tall man is sitting in it, elbows on the knees of his spread legs, sharpening a long steel xiphos. Dark hair hangs over his eyes, obscuring most of his face. 

 

Peter: Hi, PJ!

 

PJ doesn't look up, but he gives Peter and acknowledging nod. 

 

PJ: Hey. 

 

Peter inches forward.

 

Peter: Ok. So. 

 

Peter: Gaslight, gatekeep, girlboss. Mansplain, manipulate, malewife.

 

Peter: Which one are you?

 

Momentarily, the steady scraping of PJ’s sharpening pauses. He cocks his head to the side, then resumes his steady motions. 

 

PJ: Manslaughter. 

 

Peter: 

 

Peter: ...okay

 

End of video description]

 

peterman: PS if you guys show this to anyone MJ is gonna shove your eyes down your esophagus

 

Scary Captain: 🔪 

 

moonmoon: peter i cant believe you

 

moonmoon: you give us god’s gift to man

 

moonmoon: but we cant even show anyone

 

President lincoln: forget T H A T

 

President lincoln: war machine classified himself as gatekeep???

 

The News(™): and pepper confirmed she knew she's a girl boss

 

avril lavigne: okay but

 

avril lavigne: i know rich people are ✨quirky and eccentric✨

 

avril lavigne: but having a fucking bear on the couch is a tad much, methinks

 

peterman: oh thats just my friends dog

 

President lincoln: d o g ? ? ? ?

 

peterman: yeah :)

 

peterman: shes a sweetheart

 

Murphy’s Law: and that scariest man i’ve ever seen??? Just sitting on the couch with a sword??

 

moomoon: yeah like i know superheroes are funky

 

moonmoon: but the broadsword was a little much

 

peterman: oh he’s not a superhero

 

peterman: that’s my friend PJ

 

peterman: the one who ate all the jalapenos, remember?

 

moonmoon: 

 

The News(™):

 

President lincoln: 

 

Murphy’s Law:

 

avril lavigne: 

 

nedleedle: i think you broke em, pete

 

peterman: ?

 

moonmoon: THATS PJ????

 

President lincoln: ARE YOU SERIOUS

 

The News(™): I THOUGHT HE’D BE LIKE. SOME RANDOM GUY

 

The News(™): NOT AN ACTION HERO WITH A SWORD

 

avril lavigne: HE LOOKS LIKE THE MAIN CHARACTER

 

Murphy’s Law: and that bear is his???

 

peterman: dog* and yes

 

peterman: also he would like you to know its not a broadsword

 

peterman: its a xiphos

 

peterman: hes very particular like that

 

moonmoon: peter, and i cannot express this enough,


moonmoon: what the fuck

Notes:

percy just LOOKS like the main character, okay

happy pre-emptive halloween, folks.

i'll try to drop an out-of timeline halloween chapter at some point

Chapter 12: flash, p l e a s e

Summary:

murphy’s law: I JUST SAW SPIDERMAN SWINGING ABOVE MY STREET

Notes:

(See the end of the chapter for notes.)

Chapter Text

 

Coolest Intern @peterparkour

 

[Video description: The camera is facing Peter, who is wearing a thick jacket with the hood pulled up. “It’s cold as fuck.” He whispers into the mic of his earbuds.


The camera then flips around to the rubber chicken in his hands. He is very determinedly fitting the other earbud in the mouth of the chicken. Without a word, he slowly squeezes it and throws it. As soon as he lets go, the infernal chorus begins.]

 

Coolest Intern @peterparkour

Oh my god i forgot my phone was plugged into my headphones

 

You Know Who I Am @TonyStark

You post something like THIS

 

You Know Who I Am @TonyStark

And that is the thing you regret?

 

Coolest Intern @peterparkour

😔




 

Mr harrington please stop sending memes challenge

 

Scary Captain: god fucking damnit

 

Scary Captain: flash snitched

 

Scary Captain: now morita says i have to add flash back to the chat

 

President lincoln: gross

 

The News(™): ill call the fucking exterminator

 

nedleedle: absolutely disgusting

 

[Scary Captain has addled fastest man alive to the chat]

 

Scary Captain: behave or i’ll beat the shit out of you

 

fastest man alive: whatever, jones

 

murphy’s law: HOOHOOHO MY GOD



murphy’s law: PAUSE THE FLASH THREATENING PLEASE



murphy’s law: I JUST SAW SPIDERMAN SWINGING ABOVE MY STREET

 

peterman: spider-man*

 

fastest man alive: spider-man*

 

moonmoon: jesus christ theres two of them

 

Avril lavigne: peter, you like spider-man too?

 

peterman: 

 

peterman: 

 

peterman: 

 

peterman: hes ok i guess

 

fastest man alive: ugh

 

fastest man alive: further proof that penis is a fucking idiot

 

fastest man alive: spider-man is the best superhero ever

 

Scary Captain: what did i say, flash?

 

fastest man alive: what, like im wrong? 

 

fastest man alive: or do you hate spider-man too?

 

peterman: i never said i hated the guy

 

Scary Captain: i like spider-man a fair amount. Its good we have somebody fighting for the average citizens, to do what the avengers can’t. 

 

peterman: 

 

peterman: ok

 

moonmoon: peter just dropped his phone

 

moonmoon: you good bud?

 

peterman: peachy, thank you cindy

 

fastest man alive: ok back to spider-man

 

fastest man alive: he’s just the best hero. nobody really does what he does, going out there every day and keeping the streets safe. It’s really admirable. He’s a hero, through and through. 

 

Avril lavigne: wait for it

 

fastest man alive: id also let him snap by spine like a glow stick

 

Avril lavigne: there it is




 

 

Rowdy Boys

 

jalapeno eating king: is,,,,,,,,,

 

jalapeno eating king: is this a normal occurrence

 

Small™: what?

 

jalapeno eating king: flash

 

Small™: how the fuck do i consistently forget you are in the chat

 

jalapeno eating king: easy

 

jalapeno eating king: because im an ~international super spy~

 

Small™: wa

 

Small™: was that a fucking backyardigans refrence

 

jalapeno eating king: absolutely. I binge it with my little sister.

 

Small ™ : i-

 

jalapeno eating king: im a uniqua stan. She prefers pablo, but only because he is blue, which i can respect. 

 

Small ™ : im shaking why are you giving me this information

 

jalapeno eating king: because nobody

 

jalapeno eating king: will ever

 

jalapeno eating king: believe you. 

 

Small™: oh you sick bastard

 

jalapeno eating king: <3 <3 <3

 

jalapeno eating king: now answer the question

 

Small™: percy i swear to god

 

jalapeno eating king: im fucking crying peter is it normal

 

Small™: 

 

Small™: yes

 

jalapeno eating king: one day, far in the future, this is going to be even funnier

 

Small™: i hate you

 

jalapeno eating king: liar

 

Small ™ : :/

 

jalapeno eating king: but speaking of flash

 

jalapeno eating king: say the word

 

jalapeno eating king: ill make that kid believe in god.

 

Small™: that is very threatening thank you

 


 

Judas!!!! No!!

 

one hit KO: nobody: 

 

one kit KO: percy ‘older brother’ jackson upon being within a mile of flash:

 

Loser 2: i think that’s how he shows affection

 

not a loser: hey when you think about it

 

not a loser: kind of like mrs oleary

 

one hit KO: what do you mean?

 

not a loser: remember when we took her on a walk and that guy shoulder checked you and me?

 

Loser 2: and she untied his shoelaces so he tripped in that gutter? how could i forget?

 

Loser 2: i didnt even know dogs could do that

 

not a loser: yeah i dont think anybody here really believes shes a dog

 

one hit KO: fair

 

not a loser: but if you r e a l l y think about it they are both very similar

 

not a loser: they both do that head tilt thing when they hear a noise

 

not a loser: they're like the same size but are somehow so goddamn stealthy

 

not a loser: both can fire automatic weapons

 

not a loser: both really like spicy peppers and have a weird aversion to lettuce

 

not a loser: same hair color

 

Loser 2: except from percy’s stress induced(?) grey streak yeah

 

one hit KO: i always assumed he had like. A birthmark.

 

one hit KO: but holy shit ive never really thought about it like that

 

Loser 2: consider the fact that im not sure we’ve ever seen them together

 

not a loser: consider that we literally have?????

 

Loser 2: maybe he’s just fast, michelle. 

 

one hit KO: orrrr

 

one hit KO: theYRE THE SAME PERSON

 

Loser 2: BRO OH MY GOD

 

one hit KO: BRO

 

Loser 2: IT ALL MAKES SENSE NOW

 

not a loser: 

 

not a loser: 

 

not a loser:


 

 

Coolest Intern @peterparkour

 

[Video Description: A compilation of pictures with a voice-over

 

“This is Todd, he ate his parents.” 

 

A picture of an absolutely enormous dog chewing on what looks like a full size training dummy is shown. 

 

“This is Gustavo, he’s normally ok but every so often he cries until he throws up.”

 

This one is a picture of Peter, wearing a giant hoodie that clearly wasn't his, the hood up and the drawstring tight, obscuring his face as he curled up in a ball. 

 

“These are the twins; Free Willy and Free Britney.” 

 

Overtop, the words “my emotional support friends” are written. MJ and Ned are standing there, MJ with a sketchpad under her arm.

 

“This is Greg, he hates everyone, so if he likes you can have him for free.” 

 

This one is ‘Aquaman’ from Peter’s earlier video, standing with his arms crossed, an instrument case on his back. His scowl is something of nightmares.

 

“This is Let It Gopher, the lady who found him thought he was a gopher snowman, but he was actually a cat.” 

 

Once again, there are words atop this one. They say “This is Tony, we thought he was a responsible engineer, but he actually can’t boil water.”

 

“This is Death By Chocolate Lab, he has three legs and seven eyes, so he’s either cursed or really weird. But no ones died yet so we’re leaning towards weird.” 

 

Here, there is just a short clip of Spider-Man crawling on a ceiling. 

 

“This is Camilla Caballo. She is a horse.” 

 

It’s the giant dog again. End of video description.]

 

Frogsareneat @littlegreenboy

oh? my? god? 

 

Iron man <3 @starkswife

would i die for tony stark? Yes. will i make fun of him for not being able to boil water? Also yes. 

 

merp @lowla

that,,,,,dog,,,,,

 

weenie @cissiesmith

WAS THAT INTERN? WAS THAT PB???

 

Mindy @mindyydnim

!!!!!i think it was!!!!!

 

ferris wheel fighter @uhov4hiorei

that was so fucking cute i-

 

flash @fastestmanalive

holy shit was that spider-man???





Coolest Intern @peterparkour

Okay you guys really liked the last one so heres another bc im nice

 

{Video Description:

 

Another series of clips with voice overs

 

“Every friend group has… big tiddy identity crisis,”

 

Colonel Rhodes sits on a couch in the lab, his head in his hands. You’ve never seen a man look so tired. It’s a bit hard to hear over the audio, but Tony Stark is laughing maniacally.

 

“Sweet but no brain,”

 

It’s Peter, doing a very excited cartwheel.

 

“Omnipotent God,”

 

Mrs O’Leary, doing that cute little dog stretch they do after waking up from a nap.

 

“Wine Step Mom”

 

It’s Pepper in all her regal glory at her desk. 

 

“Encyclopedia Bitch”

 

Ned. He is standing in front of a projector in the “had to do it to em” stance. The projector is displaying a slideshow entitled ‘The Government Tells Us About The Moon. Should We Believe Them?’

 

“The one with goals”

 

MJ is standing, clipboard in hand, yelling at various classmates.

 

“Unbridled rage”

 

It’s Percy. He is sitting still. Too still. In the lens flare on his eyes red, or does he just look like that?

 

“Rich.”

 

It’s Tony, obviously, laying face down on the carpet, a mug of coffee in hand. End of video description.]

Notes:

YES i classified rhodey under big tiddy identity crisis. thats because it is a state of being, completely unrelated to your physical body.

also i was thinking of doing a pure fluff holiday chapter to soothe my soul, what do you guys think?

what other alignment charts should i put the Gang(TM) in and how would you guys classify them?

Chapter 13: Holiday Chapter :)

Notes:

Happy Holidays everyone! And for everyone who celebrates, Merry Christmas!

(See the end of the chapter for more notes.)

Chapter Text

Friday, December 24th

7:12 PM

Camp Half Blood, Long Island, New York



Christmases at Camp were always a little bit too much, in all the best ways. Tinny holiday music was blasting from at least three speakers that Percy could pinpoint,  all playing different songs. The entire camp, from the big house to the cabins, smelled like peppermint and pine. 

 

The warm weight on his shoulder shifted. “Perce, you should fuckin’ see this place. The Stolls,” Piper laughed. “Everythin’s covered in tinsel. I dunno where they even found it all.” Percy bit his lip against a smile. “Is it shiny?”

 

Piper flopped dramatically into his lap. “ So shiny.” She whispered, reaching an arm out to scratch Mrs. O’Leary on the head.

 

Putting a steady hand on her side to keep her from falling into the grass, Percy raised a brow. “Pipes, how much of Pollux’s eggnog have you had?”

 

She smiled. “A lot.” 

 

He snorted. “Right. Lovingly, you’re a mess.” She hummed in response. “You gonna leave soon?” 

 

Percy’s hand went to her hair, moving some of it off her face. “Yeah.” 

 

Piper nodded distantly, slowly shutting her eyes. As her breathing steadied out, Percy kept his ears open for Jason or Reyna’s familiar voice. Piper was definitely going to be out for a while, and he couldn’t stay here for much longer. 

 

It was the low timbers of the daughter of Bellona’s voice he caught first, standing by the bonfire with Gwen and Nico. As careful as he could, Percy shifted Piper into his arms. He moved carefully between the crowds, trying his best to not jostle his friend. 

 

Nico noticed him first. “Hey, Perce.” He gave the Hellhound a few greeting pats.

 

Reyna, who was either smart enough to stay away from the Dionysus kids’ eggnog, or could just hold her drink, turned towards him. “You got our girl, Jackson?” In response, Percy just lifted Piper a bit higher. Like always, as soon as her eyes fell on Piper, Reyna’s heart sped up, just a little. Percy smiled a little. He doubted Reyna even knew it happened; he certainly wouldn’t tell her. It was adorable, certainly, but an embarrassed Reyna was a violent one. 

 

“Where’s Jay?” 

 

The Preator cast a look over her shoulder. “With Hazel and Frank, I think.” She looked down at the mug held in her mittened hands. “I’m about done anyways. I’ll stay with her.” 

 

Percy nodded, adjusting his grip on Piper. As he walked, she turned her face into his chest. Probably getting drool all over his sweater, but, whatever. She assured him it was absolutely hideous when she picked it out, anyways. 

 

He and Reyna made the trek to the Poseidon cabin in silence, instead soaking in the chilly December air. It was barely windy, just a light breeze that ruffled his hair and made Piper grumble in her sleep. He could still hear the noise of the party, overlaid by the crunch of his and Reyna’s boots in the frost-coated grass. 

 

As they skirted around the canoe lake, Percy took a minute to feel the soft mist rolling across the surface, clinging to the ground and around his ankles. Mrs. O’Leary snapped at it with her fangs out. 

 

Reyna was the one to break the silence, her eyes still on the Hellhound’s fight with the cold mist. “So.” She shoved her hands into the pockets of her coats. “An Avenger, huh?” He had no doubt she was smiling.

 

Percy rolled his eyes. “Shut up.” He muttered. Reyna laughed quietly, as to not wake her girlfriend. “No, seriously. What’s it like?” 

 

He grinned. “Honestly? A lot of paperwork.” 

 

“They got a braille printer for you, right? I don’t need to do any ass kicking?” She questioned.

 

With a huff, Percy turned his head towards her so she could see his face. “Yes, Rey. Tony Stark and his fancy AI have so many goddamn accessibility options that it makes my head hurt. I’m doing fine.” 

 

“I know. We just…” She sighed. “We worry about you, you know?” The softness of her tone was one she used rarely. Percy swallowed. “I… I do. I appreciate it. Really.” He broke off for a second as they approached the wide circle of cabins. Reyna stepped in front of him, opening the door. 

 

As Percy stepped through the doorway, any terseness in his body evaporated. Even after all these years, Cabin 3 always had that effect on him. With Reyna’s help, Piper was placed on her usual bottom bunk on the far wall, blankets pulled up to her shoulders. 

 

The two of them sat on the edge of the only permanently unoccupied bunk, legs stretched out, Mrs. O’Leary between them. It was quiet, save for the sound of Piper’s soft breathing and the wind rustling through the leaves. 

 

Percy folded his arms over his chest, leaving back against the wall. “I know you guys worry.” He said, voice low and quiet. “It’s just…for the first time in a long time, I feel like I’m actually helping people.” 

 

“I get that, Jackson. I do. I’m glad you’re happier now.” She tugged at the end of her long braid. “I never really trusted those SHIELD people.” 

 

He shrugged. “That makes two of us. I tried to warn them. They didn’t listen. I cut my losses.” 

 

She hummed. “I know you’re living it up in the Avengers Tower now, but if you ever get tired of being shot at…” Her lips twitched. “You’re always welcome with all of us in New Rome. Our armies have never looked better since you were there to drill ‘em.” 

 

Percy laughed. “Right. Thanks. I’m pretty sure everyone else would object to that, though.” 

 

She rolled her eyes. “You weren’t that bad.” 

 

He raised a brow. “I believe brutal was the word everyone else used.” 

 

Reyna just shrugged. “It worked.” 

 

They didn’t talk for a bit longer after that, just listening to the soft gurgling of the fountain in the corner. That was one of the things he had always liked best about Reyna; she was just as content to sit in the silence as he was. 

 

If he focused, he could feel the crowd in the amphitheater start to wane as the younger campers retired. He knew, if he went over there, some of the Dionysus kids would be breaking out the harder stuff, like they did every year once the kids below the drinking age went to bed. 

 

He swung his legs over the side of the bed. “That’s my cue.” 

 

Reyna opened one eye to squint at him. “Goin’ to try an catch her before you leave?” She asked through a yawn.

 

Percy nodded, stretching his shoulders. “Gotta get home soon, too. Mom promised to keep Stella up ‘till I got there. Don’t wanna keep them awake for too long, though—” Percy paused, tilting his head to the side. “Nico and Hazel.” He announced. 

 

Reyna sighed, letting her head thunk back against the wall. “Seven years, and that’s still creepy as shit.” He smiled at her.

 

True to his word, not even a minute later, Hazel opened the creaking door and gently as she could. “Piper asleep?” She whispered. Percy nodded. 

 

Nico closing the door behind them, they both made a beeline for Percy. “You heading out?” Nico prodded, though he already knew the answer.

 

“Yep.” Percy affirmed, catching both of them under his arms in a tight hug. Nico pulled a face, like always, but leaned into Percy’s side. Also like always. Hazel, from his right side, hummed. “Frank’s gonna be here in a few. You seen Leo and Jason?” 

 

“Why no, Hazel, I can’t say that I have.” 

 

As Hazel’s ears pinked, Nico jabbed him in the side. “Asshole. I know you know where they are.”  He muttered. Percy laughed. “Jason’s with Gwen, Leo’s with Nyssa and Harley.” Hazel nodded tiredly. Percy loosened his grip on both of them, not before planting a kiss atop Hazel’s curls and Nico’s dark locks. 

 

“I’ll visit soon.” He promised as he made his way to the door, Mrs. O’Leary hopping off the bed to follow. 

 

Nico crossed his arms. “You better!” He called. Percy just smiled and waved as he stepped outside. 

“If I see your dumbass on the news again, I’ll shadow travel to wherever the hell you are and kick your ass!” Nico’s aggravated voice called after him. 

 

It was just him and Mrs. O’Leary, now, her paws padding soundlessly on the grass. If not for the displacement in the mist and the slight vibrations in the ground, he might’ve not even known she was there.

 

They made it to the Dionysus cabin just in time. Emma stood on the porch in her pajamas, a thick fleece blanket around her shoulders. She was rocking back and forth on her heels, mug cupped in her hands. 

 

She squinted a little at Percy’s lone figure, the dark obscuring his face. Once he stepped close enough to the cabins that he was visible, Emma let out a loud squeal. She quickly set the mug down on the porch railing, then hopped over it in a singular smooth motion.

 

“Piper teach you that one?” Percy laughed as she barreled into him. Emma shook her head against his chest. “Reyna.” He rolled his eyes. “Right,” He muttered, arms coming up to wrap around her. “Should’ve known.” 

 

After a long minute, she pulled back a little. “I haven’t seen you in forever!” She accused. Percy smiled blandly. “Wish I could say the same.” 

 

“...You’re not funny, you know.” 

 

“On the contrary. I’m hilarious.” 

 

She scoffed, but a smile crept back up on her face anyway. “Where have you been?” 

 

Percy gave a small shrug. “Kind of everywhere, really. I’m sorry I’ve been so busy.” He said, tone apologetic. Her eyes gleamed. “Anything fun? Ooh, did you take down a drug ring? Or fight some magic terrorists? Have you met a wizard?”

 

He laughed. “Uh, yes, sort of, and that last one is classified.” 

 

She stared, unblinking. “Perseus Jackson, you better not be shitting me on that one. A wizard? ” 

 

He just smiled. “Anyways. I got you a Christmas present.” 

 

“Wh-wait, you can’t just move on from the wizard part—” She cut herself off as he thrust a wrapped package into her hands. She looked down at it, then up at him. Biting her lip to keep from laughing, she asked, “Did you wrap this?” 

 

He crossed his arms. “I can do many things, Em, but wrapping a present simply isn’t one of them.” His voice softened, his face taking on a smile. “Estelle insisted she do it.” 

 

The package was covered in at least six layers of Ariel and Flounder wrapping paper, and secured with pink duct tape. “Your sister amazes me.” 

 

Percy nodded. “She has that effect.” 

 

After a brief struggle, Emma tore it open. Inside, rested a beautiful curved blade with a serrated handle. Breath leaving her, she pried it out of its box and picked it up. “Holy shit, this is nice .” She whispered, tilting it side to side and watching the moonlight glint off the shining metal. “Where did you even get this?” 

 

She received a shrug in return. “I have a guy.” 

 

Emma barked out a laugh. “A knife guy?” 

 

“All sorts of weapons, actually. And I’m a mercenary, Em. Of course I have a guy.” Gently, he plucked the blade from between her fingers. “Now, listen to me about this.” She looked up at him. “This is sharp, alright? No practicing without supervision. I know Piper or Clarisse would be glad to teach you.” 

 

She nodded quickly. “Right. Don’t be stupid with weapons. And I’ll ask Piper. Clarisse scares me. I honestly don’t know how you befriended her.” 

 

“We just mostly beat the shit out of each other in our spare time.” 

 

“...Right. Well, thank you, Percy. I…I don’t have anything for you.” She frowned, hanging her head.

 

He nudged her with an elbow. “I don’t need a gift, Emma. I wasn’t expecting one. You didn’t even know I was gonna be here. Besides, what are surrogate older brothers for if not to randomly show up and give you weapons?” 

 

This brought a laugh out of her. “Still. Thanks. Merry Christmas, Percy.” Mindful of the knife, she leaned in and gave him another hug. He smiled. “Merry Christmas, Emma.” 

 


Friday, December 24th

8:42 PM

The Jackson-Blofis Apartment, New York



He went to his mom’s next. Paul and Estelle waited for him on the couch as his mom opened the door. 

 

Estelle was so happy to see him she almost squirmed right out of Paul’s arms as onto the floor. Percy barely caught her. 

 

He held her close to his chest, her arms around his neck, until she fell asleep. After he put her to bed, the three of them just sat in the living room and talked way past midnight.

 

“I’ll be gone by the time you wake up,” Percy said apologetically. His mom just nodded and kissed him on the forehead. “Merry Christman, filho .”

 

“Merry Christmas, Mom.” 

 

He slept on the couch that night, and, true to his word, was gone by the time Paul woke up to make coffee. 

 


Saturday, December 25th

11:03 AM

The Chase House, California

 

The Chase house never changed. Not really. 

 

When Percy went up the steps to the door, he could hear the laughter inside. Ms. Chase was the one to open the door for him. 

 

“Percy,” She said warmly. “We’ve been waiting for you.” 

 

He smiled and ducked his head. “Didn’t mean to keep you.” 

 

She shook her head. “Nonsense.” 

 

Bobby and Matthew both ran at him in the same time. Both of them were nearing their fourteenth birthdays, but he could still lift them both with ease. The two boys laughed, giving him a fierce hug. “Percy!” Bobby yelled. “I knew you’d come!”

Percy grinned. “Course, like I’d ever forget.” 

 

“Oh! Oh! Wait ‘till you hear what we got!” 

 

“Why don’t you go grab your new things from your rooms, boys.” Dr. Chase suggested. The twins ran off so fast it reminded Percy of the Stolls. 

 

Dr. Chase chuckled, watching the two speed out of the room. Then, he turned towards Percy. “Good to see you,” The man said with a smile. “How’ve you been? Anything exciting?” He leaned over the edge of the couch. “I hear you’ve been working with Dr. Stark himself.” 

 

Percy fought back a smile. “A little.” He agreed. 

 

The first time Percy visited the Chase house on Christmas, he was sixteen years old. Annabeth had taken him. Neither of them had come the year after; he was missing and Annabeth was still running herself ragged trying to find him. The year after that, he had been invited. 

 

The invitation had surprised him, at first. Grover was the one who told him he should go. “Annabeth…she’d want you to look out for them.” 

 

Percy knew the saytr had a point. So, that morning after Estelle had unwrapped all her presents, he threw on a coat and Mrs. O’Leary took him to California. Bobby and Matthew had remembered him, to his surprise. Annie’s cool boyfriend. 

 

“You were special to her. Maybe the most special. I…You can refuse if you’d like, Percy, but you’re a fine young man, and I’d like for you to stick around. She…I think she would have liked that as well.” 

 

So every year, he came back. He always brought gifts, too. 

 

The boys were easy. The first year, he’d gotten them each a good pair of hiking boots and, the next week, had supervised a trip to the Redwoods. Mrs. Chase had been a tad hesitant, but Fredrick just shrugged. “Personally, I can’t think of anyone better to protect our boys.” 

 

She’d relented eventually. 

 

The boys hadn’t stopped talking about it for weeks, afterwards. 

 

The two elder Chases were a bit more difficult. He figured it out eventually, though. Frederick liked almost anything he could read. Percy brought back the most interesting books he could find, from whatever corner of the globe he’d most recently visited. For Ms. Chase, it took a bit of asking, but she’d finally revealed that she had a deep passion for tea. So, wherever he stopped to get a book, he grabbed a new kind of tea, as well. 

 

“Tell me all about it.” The doctor practically demanded. Percy laughed. “Everything I can.” He promised.

 


Saturday, December 25th

4:13 PM

Stark Tower, New York

 

By the time he got back to Stark Tower, it was late in the afternoon. 

 

As he rode the elevator up, he could hear the Christmas music starting from floor 80. In contrast to Camp, everything was soaked in the smell of gingerbread and pine, instead of peppermint. 

 

(Long story short, it turns out spiders really don’t like peppermint. And, wouldn’t you know, their resident Spider was not fond of it either.)

 

Percy made a beeline to the kitchen, a giant tupperware of cookies in one arm and another of his mother’s hot chocolate in the other. He’d just dropped them on the counter when he heard Tony. 

 

“Hey!” Tony yelled. “You’re back! Great. I need you to hold this.” The engineer thrust a giant spool of lights into Percy’s hands. 

 

The demigod followed him obidiently as Tony strung them up across the fireplace. “How was Camp?” 

 

“Loud.” Percy offered. “My friend passed out on top of me. I hunted down her girlfriend, and we had to drag her ass back to my cabin. Got to talk to everyone again, though, which was nice. Saw Emma, too.” 

 

“Oh, yeah? How’s she doing?” 

 

Percy grinned. “Great. Has her brother wrapped around her finger.” 

 

Tony snorted. 

 

(Percy never mentioned going to the Chase household. Nothing against Tony; only a few people knew he did that every year. Maybe he’d bring it up one day, but… not today. It was Christmas day. They didn’t need a bunch of baggage with it.) 

 

Pepper showed up next. She kicked off her heels and dropped down on the couch. Percy got her a mug of hot chocolate. She kissed him on the cheek. 

 

Next was Peter and May, red-cheeked and bundled in a few too many layers. Peter especially. May had gotten word of his thermoregulation problems and, according to Peter, had gone majorly overboard. They brought a big thing of orange cinnamon rolls. Store bought, Peter had assured him. 

 

MJ and Ned showed up next. She brought apple cider and he brought muffins. Percy directed them to the kitchen while MJ grilled him on Dare Enterprise’s new land acquisition. 

 

Last was Rhodey, who came bearing his mother’s banana bread. On the way to the quickly overcrowding countertop, he turned on the fireplace, coating the room in a soft, warm glow. 

 

They ate in the living room while Tony turned on the audio description for Home Alone. The engineer was squished in the middle of Rhodey and Pepper on the small couch. May took up the armchair. Percy stretched across the loveseat with Mrs. O’Leary.  MJ and Ned sat on the soft carpet in front of the loveseat with blankets around their shoulders, leaning back against the two of them. Peter sat with them until he got cold and shoved his way into Percy’s side, burying his face in Mrs. O’Leary’s fur. 

 

In the midst of MJ and Rhodey arguing on whether or not Kevin was a sociopath or not, they started to drift off. Peter was first, his breathing slowly evening out. Then Pepper. Then May. Ned. Tony. MJ and Rhodey. 

 

Percy laid there awake the longest. 

 

“Hey, Fri?” He whispered. “Pause it, please.” He then added on, “Oh, uh. I’m pretty sure the lights are on. Can you turn them off?” While he obviously didn’t give two shits about how bright the room was, he didn’t want it to wake any of the others. 

 

“Of course.” The AI responded quietly. “Merry Christmas, Mr. Jackson.” 

 

He smiled, tilting his head up towards the ceiling. “Thank you. Merry Christmas, Fri.” 

 

Percy listened to the soft, steady heartbeats of the people around him until he fell asleep. 

 

He slept uninterrupted for the first time in months. 

 


 

When Percy woke up, the first thing he did was listen around him. It seemed only Rhodey and MJ were up; he could hear them softly moving around the kitchen. 

 

A part of him wanted to get up, to stretch out his joints and help with whatever they were doing, but, as if he knew what he was thinking, Peter let out a soft snore, curling into Percy’s side. 

 

Percy didn’t move a muscle for the next two hours. Until everyone was awake but Peter. 

 

Tony leaned over the couch. “Uh, hey?” The man murmured softly. “I really can’t tell if you’re awake or not.” He muttered. “Jackson?” 

 

Percy caught Tony’s outstretched finger an inch away from his face. “I’ve been up for hours. If you wake Peter, it will be the last thing you ever do.” 

 

“Fair.” 

 

Peter didn’t stir until an hour later. Even then, he refused to detach himself from Percy’s side. “How are you so warm?” The mutant muttered, mystified. Percy just shrugged. “I can’t get cold.” He said flatly. 

 

This had Tony leaning around to look at him. “Really?” 

 

“I mean. I swim in the Artic in my spare time, so, yeah.” 

 

Ned rubbed a tired hand through his hair. “Demigods are so weird.” 

 

Percy stuck his tongue out at him. Mrs. O’Leary copied the motion as she hopped up on one of the seats at the counter. “Hey, buddy. We were here first. As far as I’m concerned, you guys are the weird ones.” 

 

MJ paused. “Huh. Wait, if the whole Prometheus thing is real, does that mean evolution is fake?” 

 

In an instant, six heads turned towards him. He just shrugged. “Listen, I stopped asking questions around the time I found out Santa’s sleigh came from Artemis.” 

 

What ?”

 

“What?” 

 


 

(Peter stuck to Percy’s back all day. When May offered to try and pull him off, Percy met her eyes as best as he could. “I benched the sky,” He said. “Peter can stay.” 

 

“...alright.”)

Notes:

yeah reyna piper and jason are dating, and i will fight somebody on that

also emma's back :)

where does this fit in the timeline, you ask? nowhere. absolutely nowhere.

Chapter 14: defense budget who???

Summary:

Father of Five: you got stabbed.

 

crack dealer: uh oh got to skedaddle

Notes:

(See the end of the chapter for notes.)

Chapter Text

 SSEA

 

gitc: @ ( ̿ ̿▀‿▀)▬▬ι═══════ﺤ @Tony Stank do you guys know any good exorcists

 

Tony Stank: excuse me?

 

gitc: please

 

mindiana jones: [Video Attachment]

[Video Description: MJ is sitting on Peter’s bunk bed, pointing the camera down at the carpet. Slowly, she moves down, until the camera is level with the floor. Under the bed, you see one (1) Peter Parker, under the bunk. Ned tries to poke him, and Peter hisses at him. End of video description]

 

Tony Stank: what the actual fuck

 

Tony Stank: there is not enough room under that bed for him

 

Tony Stank: kid are you okay

 

gitc: hjkdhgjkhfuewh he reached an arm out and hes going for my r[phgrijne

 

gitc: hi mr. stark. this is peter. i am fine :)

 

Tony Stank: did you dislocate literally all of your joints??????

 

gitc: no

 

gitc: my bones are just stretchy

 

Tony Stank: 

 

Tony Stank: please tell me i’ve suddenly lost the ability to comprehend english because im pretty sure you just said your BONES ARE STRETCHY

 

Tony Stank: THATS NOT SOMETHING THAT CAN HAPPEN

 

Tony Stank: you’re killing me here, underoos

 

mindiana jones: explain, peter

 

gitc: spiders have no bones. i had some bones. got bit by magic spider. I now have Some Bones Sometimes

 

mindiana jones: i…

 

mindiana jones: im getting ned his phone back. 

 

Tony Stank: good. I… i need some time to think

 


 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: peter, as someone who has extensive bone-stretching experience, i support you fully

 

baby avenger: thank you, percy

 

baby avenger: glad someone appreciates me

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: :)

 


 

[Daniel Wén-Campbell has added Lee Van Keppel, Aspen Anev, Bridgette Lehey, Ross Bunmi, Mal Tanuk, and PJ to the chat]

 

[Daniel Wén-Campbell has changed the chat name to ‘hey robloxers’]

 

Lee Van Keppel: dan i have never respected you less

 

Daniel Wén-Campbell: thats fair

 

Daniel Wén-Campbell: but if im going down, im going down all the way

 

[Daniel Wén-Campbell has changed their name to ‘roblox hacker’]

 

Bridgette Lehey: jesus christ it got worse

 

Aspen Anev: roblox?? Really?

 

Bridgette Lehey: aspen!!!!!!!! <3 <3 <3 <3 <3

 

Aspen Anev: hi

 

Bridgette Lehey: :)

 

roblox hacker: simp

 

Bridgette Lehey: i’ll kill you.

 

roblox hacker: o-o

 

Mal Tanuk: f

 

Lee Van Keppel: @PJ @Ross Bunmi 

 

Lee Van Keppel: answer, cowards

 

Ross Bunmi: hewwo

 

Mal Tanuk: blocked

 

PJ: what do you people want

 

Ross Bunmi: you, always <3

 

roblox hacker: oh??????

 

Ross Bunmi: i mean i have the love of my life but like

 

Ross Bunmi: damn if i wouldnt tap that. Anyways

 

Ross Bunmi: line up, fuckers

 

[Ross Bunmi has changed their name to ‘jason derulo’]

[Ross Bunmi has changed Lee Van Keppel’s name to ‘unique and unhinged’]

[Ross Bunmi has changed Mal Tanuk’s name to ‘egg’]

[Ross Bunmi has changed Bridgette Lehey’s name to ‘local MILF’]

 

egg: wh

 

local MILF: excuse me

 

egg: how come aspen was safe????

 

jason derulo: aspen <3

 

egg: ok thats fair

 

local MILF: 1) i have No children and 2) the commander escaped too???

 

jason derulo: aspen’s was out of love. commander jackson’s was out of vague fear

 

egg: what happened to being horny for death???

 

egg: fake smh

 

jason derulo: ok but i want to die in a sexy fun way

 

jason derulo: not murdered in a basement by my boss

 

unique and unhinged: i am very ok with this name

 

roblox hacker: you would be

 

unique and unhinged: >:(

 

PJ: guys. we are supposed to be looking into a missing persons case. 

 

PJ: please. 

 

egg: oh fuck right

 


 

Our family tree is a wreath

 

has a buzzfeed unsolved episode: leo you owe piper 5 bucks

 

mcshizzle: FUCK

 

pied piper: your vague but menacing secret agency???

 

has a buzzfeed unsolved episode: made the group chat today, just like you predicted

 

pied piper: fuck yeah pay up loser

 

mcshizzle: percy you really couldnt have kept it quiet for one more week

 

has a buzzfeed unsolved episode: and miss the chance of seeing you lose money? I think not

 

pied piper: hah ‘seeing’

 

has a buzzfeed unsolved episode: lmao

 

horse girl: piper dont be mean

 

pied piper: he thinks its funny!!!!!!!

 

framk: percy also thinks making ‘run through by the giant king and holding my organs in’ jokes is funny

 

has a buzzfeed unsolved episode: ok first off they are VERY funny and second

 

has a buzzfeed unsolved episode: do you know how specific the circumstances have to be to make those jokes??? It's harder than you think

 

sparky: so perce are you gonna do it

 

RARA: Do what?

 

my chemical ron weasley: hazel and i bet him he couldnt act like a Responsible Boss for a couple months

 

my chemical ron weasley: hes a good actor for sure, but we think he’s simply to chaotic and that will override it

 

RARA: That is one of the dumbest things I’ve ever heard, and I used to listen to Octavian talk. 

 

pied piper: d a m n

 

has a buzzfeed unsolved episode: im giving my all

 

has a buzzfeed unsolved episode: i work regular hours. I remind them to finish deadlines. I hold conference calls. Ten minutes ago i assigned campbell extra paperwork for trying to revive flappy bird instead of writing his report. 

 

pied piper: holy fucking shit

 

framk: who are you and what have you done with percy

 

has a buzzfeed unsolved episode: i am going to win this bet, franklin. 

 

framk: for the last time you know thats not my full name

 

sparky: its funny every time though

 

mcshizzle: percy….my man….my welding bro……what has the wheel of bureaucracy and capitalism done to you.,.........,,,..

 

has a buzzfeed unsolved episode: oh dont worry last week rachel and i took sledge hammers and saws to some hostile architecture 

 

has a buzzfeed unsolved episode: some guy tried to arrest us but i just pulled my badge out and told him the metal spikes on the ground were part of a alien plot to take over new york

 

horse girl: whoever let you in charge made a mistake

 

sparky: no no, let the man speak

 

has a buzzfeed unsolved episode: since we’re technically our own division, we get a defense budget for guns n shit straight from the government. last week we spent it on cupcakes and then donated the rest

 

has a buzzfeed unsolved episode: in the official report i wrote, it was spent on tracking down rogue hydra agents. It was really all mrs. o’leary and i sniffing them out. 

 

has a buzzfeed unsolved episode: never in a million years will i be telling the WSC chairwoman that my team is simply too cool for guns, not when lee and ross made a separate budget for ‘funky outfits’

 

has a buzzfeed unsolved episode: i can only assume they mean supersuits and will soon become vigilantes. They think i don't know. I have no plans to stop them. 

 

RARA: Jesus Christ. 

 


 

we had a bonding moment! I cradled you in my arms!

 

Father of Five: percy why the fuck did i see you and your team unloading 16 crates of berry blue jell-o into your headquarters

 

Father of Five: i literally just came to drop your prescription off. Why

 

crack dealer: it was my turn to pick the snack

 

crack dealer: also thank you i havent had time to go pick it up

 

Father of Five: yeah i know thats why i got it

 

Father of Five: thats so much jell-o where did you get it

 

Father of Five: i swear to god percy where did you get that money

 

crack dealer: hanover gave us another grant for medical supplies and hospital bills cause i got stabbed but i just hopped in the ocean for a bit so we used the money for snack

 

Father of Five: you got stabbed.

 

crack dealer: uh oh got to skedaddle


Father of Five: PERCY JACKSON

Notes:

percy making SWORD think he's responsible? top tier comedy

they're gonna think hes all stoic and serious but really he spends his time taking his baby sister for ice cream and comiting misdemeanors with his cousins

also!! ideas!!! headcannons! love hearing them :)

percy and blue jell-o = saiki k and coffee jelly if you get my vibe

Chapter 15: too many froggy

Summary:

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: but dont worry i got this

 

Tony Stank: NO

 

gitc: oh god oh fuck

Notes:

(See the end of the chapter for notes.)

Chapter Text

 

SSEA

 

Tony Stank: do you ever have someone come up to you and say something and you’re just like. 

 

Tony Stank: w h a t

 

baby avenger: ye s all the time

 

baby avenger: like. please i do not understand you

 

gitc: me whenever someone talks about anything related to football in the slightest

 

mindiana jones: literally anything about crochet. I tried to learn once. it went horribly. 

 

baby avenger: me with any literary reference 😔 ✊

 

baby avenger: like ma’am. I do not read unless its the instructions on my hot pocket

 

mindiana jones: really think you would have memorized them by now

 

baby avenger: im a biochemist not a chef

 

Tony Stank: first off, peter, i really hope you aren’t eating that many hot pockets. you need more nutrients than that, especially with your mutation

 


 

we had a bonding moment! I cradled you in my arms!

 

crack dealer: oh my god 

 

crack dealer: and you still have the audacity to deny that child is your son

 

Father of Five: SH U T

 


 

SSEA

 

Tony Stank: second, this came from me trying to talk to a guy with a weird midwest accent

 

Tony Stank: he was an investor and pep wanted me to have a conference with him but i could not understand a single word coming out of his mouth it was horrible

 

Tony Stank: he already left and pepper is asking me how it went

 

Tony Stank: how do i tell her i don’t know

 

baby avenger: the mighty iron man,,,,,brought down by some fucker from ohio,,,,

 

mindiana jones: bold words, hot pocket man

 

baby avenger: we all have our weaknesses ok

 

baby avenger: football, people from kansas, crochet,,,,,

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: sign language

 

baby avenger: JGIAPRBSFFUI—

 


 

nick fury @12yearoldterrorist

the dinosaurs are still alive i just hid them in my trench coat

 

nick fury @12yearoldterrorist

[Photo Attachment: A blurry photo of a radish in low lighting]

 

merp @lowla

please marry me mr fury

 

weenie @cissiesmith

this is literally the first time he’s posted in months. what the fuck

 


 

Mr harrington please stop sending memes challenge

 

peterman: guys i think i fucked up

 

peterman: [Photo Attachment: Peter is sitting on the floor of a bathroom, completely surrounded by frogs. They are in his hair, on his clothes, covering the floor. Some are perched on the sink and the toilet seat.]

 

avril lavigne: far too many froggy. evacuate this instant

 

peterman: i cant

 

peterman: if i open the door they might get out

 

peterman: and the frogs are kinda,,,,,,secret

 

Murphy’s law: how the fuck did you get so many frogs

 

peterman: mr stark let me use his credit card,,,,,,......,.,.,,it was just supposed to be one

 

peterman: i got excited

 

moonmoon: you fucking dumbass

 

peterman: seriously what the heck do i do

 


 

bonmk @widget

Guys i just had the best idea

 


 

bonmk @widget → nick fury @12yearoldterrorist

 

bonmk: hey mr fury rate my meme

 

nick fury: hm. twist on a classic, but lacking a certain something. bonus points for making fun of the cap psas, though. 7/10

 

bonmk: thank you for your sage wisdom mr fury sir

 


 

hey robloxxers

 

jason derulo: @PJ

 

jason derulo: @PJ

 

jason derulo: @PJ

 

jason derulo: @PJ

 

PJ: what do you need, ross?

 

jason derulo: plant

 

jason derulo: i want to get an office plant

 

PJ: as long as you take care of it, i don’t see why not. 

 

jason derulo: FUCK YEAH

 

jason derulo: @unique and unhinged WERE GETTING THE CHIA PET

 

unique and unhinged: wait oh my god really

 

egg: we’re getting a chia pet??????

 

roblox hacker: mal has begun to vibrate at a frequency only animals can hear

 

aspen: doggie chia pet?

 

local MILF: im down w doggie

 

unique and unhinged: seconded! Love doggie

 

jason derulo: i, too, approve of doggie

 

egg: we are getting that doggie

 

roblox hacker: fifth vote for the doggie :)

 

Egg: @PJ

 

jason derulo: @PJ

 

local MILF: @PJ

 

aspen: @PJ

 

unique and unhinged: @PJ

 

roblox hacker: @PJ

 

aspen: just heard him sigh all the way across the office lmao

 

PJ: yes, you can get the doggie. 

 

egg: IM RUNNING



egg: GOING TO STORE RIGHT NOW

 

PJ: mal, we are in the middle of a case, and you don’t get off work for another hour. Nice try, though. 

 

egg: f u c k

 


 

our family tree is a wreath

 

has a buzzfeed unsolved episode: man this boss thing is so fun

 


 

Mr harrington please stop sending memes challenge

 

nedleedle: *staring out the window like a depressed victorian lady* when will my husband peter parker return from the war

 

peterman: as soon as he takes care of all these fookin froggs

 

Scary Captain: you are an idiot, parker

 

peterman: i know

 

peterman: i just. I didnt think it would work

 

moonmoon: you didnt think going online and buying things with a rich man’s credit card would work?????

 

peterman:

 

peterman: no 😔

 

[president lincoln has changed peterman’s name to ‘dumb little boy’]

 

dumb little boy: hEY

 

Scary Captain: it’s deserved.

 

dumb little boy: this screams transphobia. I cast my scorn upon you, abraham

 

moonmoon: wooooow abe

 

The News(™): smh you think you know a guy

 

Murphy’s Law: i cant believe you, abe

 

President lincoln: what????? Mj literally agreed with me?????

 

Avril lavigne: yeah, but its mj

 

moomoon: yeah

 

nedleedle: dont try to distract us from your prejudice, abe

 

dumb little boy: yeah ABE i cant believe you’d do this

 

Abraham lincoln: jesus christ fine im sorry

 

dumb little boy: :)

 

dumb little boy: i got all the frogg out safely though

 

dumb little boy: pj’s dog helped me. she’s surprisingly gentle w frogg

 

nedleedle: can confirm. I would trust that dog with my life. 

 

Scary Captain: we all would, ned. 

 

moonmoon: rt

 


 

SSEA

 

baby avenger: ya’ll ever watch keeping up with the kardashians

 

Tony Stank: if i wanted to see a trashy rich person id go look in a mirror

 

baby avenger: mr stark youre not trash :(

 

Tony Stank: 

 

Tony Stank: thanks, kid

 

baby avenger: :)

 

gitc: yes i love that show

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i havent watched it but every time i hang out with my cousins piper and leo do a two man retelling of it and its timing is accurate down to the millisecond so id say im pretty well versed in the lore

 

baby avenge r: perfect. 

 

baby avenger: im making a keeping up with the avengers version

 

Tony Stank: for who???

 

baby avenger: me :)

 

baby avenger: also the my school friends

 

baby avenger: i have everything worked out. They already know i just Am in the tower sometimes so there’s no questions there. If spider-man makes a cameo ill have karen change my voice

 

mindiana jones: this is a stupid idea. Ill help

 

baby avenger: i love you so much

 

nedleedle: what about percy?

 

baby avenger: eh the gc is kind of used to him just being himself, i doubt they'll ask any questions

 

nedleedle: fair

 

Tony Stank: if you’re sure, kid, i guess i dont really care

 

Tony Stank: just be careful. percy’s identity as Sentinel is an international secret, im pretty sure

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: all of SWORD’s info is

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: but dont worry i got this

 

Tony Stank: NO

 

gitc: oh god oh fuck

 


 

Mr harrington please stop sending memes challenge

 

spicy: hi im tony starks illegitimate bastard half brother

 

moonmoon: W H A T

Notes:

tony really said 'im illterate like the rest of you gays'

also. ideas for an avengers reality show? if you have them id love to hear em

PSSST i got nominated for the irondad creator awards
there’s more info on their tumblr - @irondad-creator-awards
your fav's emotional wellbeing is going to be used as leverage for nominations and votes uwu

Chapter 16: robert <3

Summary:

Tony Stank: percy. I hate you

 

Tony Stank: why did you do this

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: cause

Notes:

(See the end of the chapter for notes.)

Chapter Text

SSEA

 

baby avenger: percy jackson what the fuck have you done

 

Tony Stank: WHAT DID HE DO

Tony Stank: PETER

 

baby avenger: [Attached Screenshot]

 

Tony Stank: PERSEUS JACKSON

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: uwu?

 

Tony Stank: IM GOING TO FUCKING KILL YOU

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i mean people have been trying since i was 12 but you’re welcome to give it a shot

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: who knows

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: maybe you’ll be lucky number 7243624

 

Tony Stank:

 

Tony Stank: im not going to touch that statement right now but rest assured we will be talking about that later

 

Tony Stank: peter what are the children saying

 

baby avenger: um

 

 


 

Mr harrington please stop sending memes challenge

 

Avril lavigne: AYO???????

 

President Lincoln: EX FUCKING SCUSE ME

 

The News(™): what did you just say

 

Murphy's Law: 👁️ 👄 👁️

 

moonmoon: asdagfdh??? SDHFREHG????

 


 

SSEA

 

baby avenger: [Attached Screenshot]

 

Tony Stank: percy. I hate you

 

Tony Stank: why did you do this

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: cause

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: it makes the most sense. its too late to pass me off as someone who works in the labs like peter. while it’s true they already know i’m your bodyguard, it dosen’t really explain why i do things like hang out in the tower, where you are at your most safest. 

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: and if i was just your bodyguard, why would i be interacting with peter so much? they’re reasonably smart kids, they’d notice something was going on eventually. 

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: and bastard half brother is a much better conclusion to get to than secret agent/ex-merc. It’s a classic technique—give them something that’s scandalous enough, and they’ll think they’ve gotten to the bottom of it. 

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: also i was bored

 

Tony Stank: 

 

baby avenger: 

 

mindiana jones: huh. 

 

mindiana jones: did not see that coming from you. no offense. 

 

Tony Stank: ok that’s. actually fucking smart but Pepper is still going to kill us. 

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: nah, pepper loves me

 

Tony Stank: ok so. she’ll kill m e

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: casualties of war. 

 

Tony Stank: i feel like as my ex-bodyguard you should care more about this

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: ex???? bold of you to assume i ever stopped looking out for your wellbeing, regardless of being paid to do so xoxo

 

baby avenger: he’s crying

 

Tony Stank: I AM NOT

baby avenger: [Video Attachment: It’s a short clip. Tony is sitting in the lab, looking down at his phone. He is, indeed, crying a little.]

 

baby avenger: @percy you can hear his sniffles

 

Tony Stank: i no longer have a son. 

 

baby avenger: hey that sounds familiar

 

baby avenger: sure hope i dont wake up in the orphanage again

 

gitc: PETER

 

mindiana jones: oh my god

 

gitc: WHAT THE FUCK

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: update: tony is crying more now

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: peter has been engulfed in Dad Hug(™)

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: he won’t be active for a while. 

 

mindiana jones: so are we just going to ignore that they both acknowledged their father-son relationship?

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: for the sake of both of their varying emotional states? yes. 

 

gitc: you got it boss

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: now that the party pooper is gone, you guys wanna help me fuck with your classmates? 

 

mindiana jones: do you even have to ask?

 

 


 

Mr harrington please stop sending memes challenge

 

moonmoon: PETER BENJAMIN PARKER DID YOU KNOW ABOUT THIS

 

The News(™): oh my god

 

Murphy’s law: how could you hide this from us,,,,,,i thought we were friends

 

Scary Captain: listen up, assholes

 

Scary Captain: for obvious reasons, this isn’t public knowledge. pj’s relation to tony wasn’t peter’s secret to tell, even if he’d had permission. 

 

Scary Captain: and now that you do know about this, we all expect you to keep it quiet. very, very quiet. NDAs will be involved if necessary. Understood?

 

moonmoon: yes ma'am

 

The News(™): yep

 

Murphy’s law: yeah

 

Avril lavigne: sure thing

 

President lincoln: you don’t have to worry about us

 

moonmoon: flash, on the other hand though

 

The News(™): oh fuck i forgot about him

 

nedleedle: oh, dont worry about flash :)

 

Avril lavigne: oh??????

 

The News(™): n…ned????

 

nedleedle: yes, sally? :)

 

Avril lavigne: i love you

 

dumb little boy: hey step OFF of my mans

 

Murphy’s law: thats really what it took to revive peter????????

 

mindiana jones: clearly you don't know peter and ned that well. 

 


 

hey robloxxers:

 

egg: MR COMMANDER JACKSON SIR

egg: I FINISHED MY REPORTS LIKE A GOOD LITTLE LAD CAN I GO GET CHIA PET

 

PJ: yes, mal. you can go get the chia pet. 

 

egg: AJHJDSAAAAAAAAAA IM GOING

 

unique and unhinged: the lord’s work

 

roblox hacker: WAIT IM COMING TOO

 

PJ: no, you are not. mal has been responsible and finished her work early. you, however, have not. 

 

roblox hacker: YOURE NOT MY REAL DAD

 

PJ: daniel. 

 

PJ: i will take away all your unsolved cybercrime files. 

 

roblox hacker: wait no im sorry please dont

 

roblox hacker: i love them

 

PJ: we’ll see. 

 

egg: rip dan but IM IN MY CAR

 

aspen: Y E S

 

local milf: i despise this name. 

 

local milf: but also we got a new mission so. Gather round fuckers, aspen, and our surpeme overlord jackson

 

[jason derulo has changed PJ’s name to ‘supreme overlord jackson’]

 

supreme overlord jackson:

 

supreme overlord jackson: i’ll allow it. 

 

jason derulo: AHFJDKSHAHFDJBURAOJKK

 

supreme overlord jackson: everyone, sans mal, come to the conference room. 

 


 

egg: IM BACK AND I GOT THE CHIA PET

 

egg: I WAS FORCIBLY REMOVED FROM WALMART BUT THATS OK BC I GOT THE DOGG

 

local milf: what the fuck did you do?????

 

aspen: WHO CARES

 

aspen: BRING FORTH THE DOGGIE

 

jason derulo: we’re still in the conference room!!!

 

roblox hacker: what do we name doggie

 

unique and unhinged: something…mighty. Something to strike fear in the hearts of our enemies. 

 

roblox hacker: robert?

 

unique and unhinged: you understand me <3

 

egg: everyone good with robert?

 

unique and unhinged: if you aren’t, come see me after work :)

 

jason derulo: y,,,,yeah,,,,,robert good

 

local milf: i agree with robert under severe duress

 

unique and unhinged: robert <3

 

[roblox hacker has changed the chat name to ‘robert <3’]

 

supreme overlord jackson: now that you have all come to an agreement, please focus on the debrief. we’re going to uruguay in two days. 

 

egg: when your job lets you travel 😩

 

local milf: mal…

 

local milf: we are literally going to investigate an assasination. 

 

egg: but we are doing so on a private jet, are we not?

 

jason derulo: shes got a point

 

aspen: im going to seize control of the jet. 

 

supreme overlord jackson: no, you will not. the pilot will not tolerate nor fall for any of your schemes. i’d recommend not trying anything. 

 

jason derulo: >:)

 

egg: >:)

 

unique and unhinged: >:)

 

supreme overlord jackson: expect no kind words at your funerals. 

 

roblox hacker: woah????????

 

local milf: ayo?

 

supreme overlord jackson: phones away. now. 

 

egg: jesus ok

 


 

feral boys

 

blonde superman: this is going to be so funny

 

blonde superman: ive never been happier to have gone through flight school

 

blonde superman: but how the fuck did you convince your boss to hire me to fly your top secret ops team’s jet

 

felon aquaman: oh, you know

 

blonde superman: i do not know but ok

 

blonde superman: should i be worried about your team?

 

felon aquaman: they will most definitely try something when they think i wont notice.

 

blonde superman: but you always notice

 

felon aquaman: yep

 

felon aquaman: they’ll learn that one day

 

blonde superman: ominous. I like it. 

 

blonde superman: i won’t hold back

 

felon aquaman: i have zero (0) problems with you barking at and/or biting any of the team members

 

blonde superman: perfect

Notes:

yeah jason's a pilot lmao

just thought it would be very funny for our fav feral roman boy to exist within the vicinity of a plane's controls

jason 100% bites and i will die on this hill

SWORD team really dosen't know whats coming

*ahem* pov jason piloting a plane for the first time
hazel nico and percy, in the back: DO A FLIP

he became a pilot literally because it was so easy for him. jason just wanted money with little effort. king shit.

Chapter 17: he bite

Summary:

Honeybear: besides, they’re still only on the plane. 

 

Honeybear: how much trouble can they get into? it’s just the team and percy

Notes:

you guys wanted feral jason the pilot content. here it is.

(See the end of the chapter for more notes.)

Chapter Text

robert <3

 

unique and unhinged: pilot? spotted

 

egg: it’s time, boys

 

jason derulo: >:)

 

local milf: commander????? 

 

local milf: aren’t you going to do anything about this????

 

supreme overlord jackson: i warned them. 

 

supreme overlord jackson: whatever comes next is their own fault

 

 


 

 

Tony for fucks sake go to sleep

 

Honeybear: your conference is tonight, right?

 

dumbest genius: yeah

 

dumbest genius: you sure you’re good to stay in the tower?

 

Honeybear: of course

 

Honeybear: i just dont see why peter needs watching

 

dumbest genius: well, i promised him he could use the labs today

 

dumbest genius: but that child is the secondary incarnation of chaos and should never be left unsupervised

 

dumbest genius: i just thank every greater power that percy isn’t here

 

Honeybear: where is he?

 

dumbest genius: some mission with SWORD

 

dumbest genius: im sure they’ll be fine

 

 


 

 

robert <3

 

egg: THE PILOT ATE MY KNIFE

 

local milf: what the fuck?

 

 


 

Tony for fucks sake go to sleep

 

dumbest genius: i know pepper gave you a copy, but heres another just in case

 

     Rules For Keeping Peter Parker

 

  • Don’t let him make another skittle omelet. Please.

 

  • Under no circumstances should ned leeds enter the property. not only will he do literally anything for any form of star wars merchandise, the last time they were released into the R&D labs, we had to pay reparations

 

  • seriously. ned filmed and whispered ‘so, is it any wonder people are afraid of technology?’ and peter, who decided he belonged in the vents in the ceiling, dropped down and screamed ‘TECHNOLOGY’

 

  • Dr. Raan almost had a heart attack. Please, Peter. She’s so old. 

 

  • He likes to be in dark corners. Sometimes he naps. This is ok. Don’t fear. 

 

  • If he hisses, just nod. It’s easier for all of us. 

 

  • NO SPIDER-MANNING AFTER 1

 

  • If he starts sobbing uncontrollably, call may. He probably just misses her. 

 

  • Don’t let him out of your sight. Seriously, peter once broke an arm in middle school trying to return a library book. 

 

  • He can be easily pacified with those calming videos meant for dogs. just ask FRIDAY, and she’ll pull up his favorite CGI meadow. 

 

  • Do not, i repeat, DO NOT, let him have access to the emergency PA system. A week ago, he announced ‘congratulations to ms. suarez for being the first to escape the simulation’ and the interns haven’t stopped twitching since

 

  • Don’t let him play subway surfer. I don't know why he plays subway surfer so aggressively, but last time he almost ended up in prison. How? I don't know. I don't want to know. But percy isn't here to break him out, so it’s banned. 

 

Honeybear: there is something severely wrong with this child

 

Honeybear: i’d die for him

 

Honeybear: but, yes. It’s probably best percy is on a strict, organized mission. 

 


 

robert <3

 

unique and unhinged: BEEZUS BUCKING CHRIST

 

roblox hacker: HE BIT ME

 

roblox hacker: HE FUCKING BIT ME

 

egg: OH GOD I THINK WE LOST ASPEN

 


 

do you normally try to stab people who are blowing their nose?

 

sneezy: hey i just got a really weird vague prophecy moment

 

sneezy: i sense like. a great assault on your allies?????

 

sneezy: are you guys ok?

 

stabby: thanks for the concern, rachel, but we’re good

 

stabby: jason just started biting people though

 

sneezy: oh

 

sneezy: good luck

 

stabby: oh, trust me. I dont need it

 

stabby: my team on the other hand

 


 

robert <3

 

local milf: HES BARKING

 

local milf: THE PILOT BARKED AT ME

 

local milf: WHERE ASPEN??????

 


 

Tony for fucks sake go to sleep

 

Honeybear: are you worried?

 

dumbest genius: about peter or percy?

 

Honeybear: yes

 

dumbest genius: i’m worried peter will burn down the building. 

 

dumbest genius: percy’s going into a foreign country to investigate an assassination. im a bit more worried about that

 

Honeybear: i’ve seen percy get hit directly in the head with a cinderblock and keep walking like nothing happened

 

Honeybear: i think he and the team will be fine

 

Honeybear: besides, they’re still only on the plane. 

 

Honeybear: how much trouble can they get into? it’s just the team and percy

 


 

As soon as that text was sent, both Rhodey and Tony, in completely different locations, stared up from their phones, eyes wide. 

 

“Fuck,” They whsipered. “It’s just Percy.” 

 

They ran.

 


 

They both made it to Tony’s main lab at the same time. 

 

“Fri,” Tony yelled, out of breath. “Connect a call to the SWORD jet, please!”

 

“One sec, boss.” She replied, chipper. Completely unaware of the impending disaster. Oh, the innocence. The blissful, blissful, innocence. 

 

They waited, breath caught in their throats, as she projected the call onto the wall. It rang for a few seconds before Percy picked up. 

 

Nobody said anything at first. Rhodey and Tony just stared at the hologram. 

 

Percy was sitting calmly in one of the seats, a mug of tea in his hands. He was in comfortable clothes; sweats and a tee, plus a cream colored sweater. Not a hair out of place. He smiled at them. 

 

Tony squinted. “Fri, turn up the volume, please.” 

 

She obliged. And there it was. 

 

Screaming, in the background. 

 

There was a noise directly from under where the phone was on Percy’s end. Rhodey cleared his throat. Eventually, Percy huffed and picked up the phone, turning it so it faced down. 

 

Dan laid face down on the jet floor, making a low groaning noise. There was a bite mark on his shoulder, exposed through torn fabric. He mumbled something, then tilted his head to the side so he could be heard. 

 

“The consequences of my actions have already seeped into my bones and claimed them as their own.”

 

The screams in the background continued. Percy took a long sip of his tea. 

 

Tony hung up the call. 

 

Silently, he and Rhodey parted ways. 

 

A few minutes later, Tony’s phone buzzed. 

 

 


 

 

Tony for fucks sake go to sleep

 

Honeybear: mutual agreement we aren’t going to deal with that?

 

 


 

 

Tony sighed, and rubbed his temple. 

 

 


 

 

dumbest genius: he’s uruguay’s problem now

 

 


 

 

Judas!!! no!!!!!

 

One hit KO : update: i will be left unsupervised in the tower

 

Loser 2: isn’t colonel rhodes going to be with you?

 

one hit KO: he’s woefully unprepared :)

 

not a loser: oh lord

 

one hit KO: what should i do today?

 

Loser 2: i vote the jetpack idea

 

not a loser: i hate the jetpack idea

 

one hit KO: ms. pepper said it would be a fun idea, hypothetically

 

not a loser: i love the jetpack idea

 

one hit KO: jetpack idea it is :)

 

 


 

 

robert <3

 

local milf: ASPEN

 

local milf: WHERES MY ASPEN



local milf: SERIOUSLY NONE OF YOU BUT DAN HAVE EMERGED FROM THE COCKPIT

 

local milf: I HEAR SOBBING

 

local milf: DAN PASSED OUT

 

unique and unhinged: he

 

local milf: he?

 

unique and unhinged: bite

 

local milf: ????

 

egg: i now believe in god. 

 

local milf: excuse me

 

jason derulo: i am a changed man

 

jason derulo: what happened in that cockpit will forever haunt me

 

local milf: the commander just took a big sip of his tea and went ‘as predicted’

 

jason derulo: that’s terrifying

 

jason derulo: where the FUCK did this pilot come from

 

aspen: 

 

local milf: ASPEN!!!

 

aspen: .,;kf

 

[aspen has added local milf, egg, jason derulo, unique and unhinged, roblox hacker, and JG to a chat]

 

[aspen has changed JG’s name to ‘potential rabies risk’]

 

local milf: what the fuck

 

potential rabies risk: hi :)

 

local milf: whomst

 

potential rabies risk: pilöt

 

egg: is your presence punishment for past sins

 

potential rabies risk: not yet

 

egg: …..,,,,oh?

 

aspen: tell them what you told me

 

potential rabies risk: i know commander jackson?

 

roblox hacker: wow that weird so do i

 

unique and unhinged: hey me too wtf

 

local milf: both of you istfg

 

aspen: elaborate my guy

 

potential rabies risk: oh!

 

potential rabies risk: i’ve know your guys' team lead since we were teenagers

 

jason derulo: !!!!!!!!!!!

 

unique and unhinged: 🔫  embarrassing stories

 

egg: oh my god yes

 

potential rabies risk: well

 

potential rabies risk: uh

 

potential rabies risk: there aren't any

 

roblox hacker: what do you mean?

 

potential rabies risk: i mean i’ve known him for over a decade. for a long portion of that time, we were in close quarters every day. after that, we talked weekly. and not once has he revealed any personal information or even smiled.

 

potential rabies risk: he once told us he was exactly six feet tall. but that’s it. that’s all we have. 

 

egg: oh my god

 

egg: what the fuck

 

roblox hacker: is he secretly a robot????

 

potential rabies risk: i wouldn't be surprised

 

potentia l rabies risk: I saw him suplex a guy three times his size and there was nothing but a huge fissure in the ground left behind. 

 

potential rabies risk: once he and my sister dueled to the death and nobody is sure who won because the battlefield was completely obliterated. 

 

potential rabies risk: we fought once, in this random field in kansas when we were 17, and my girlfriend had to knock him about because he was about to legitimately murder me

 

aspen: i think i speak for all of us when i say i’m fucking shaking

 

potential rabies risk: shrug

 

[potential rabies risk has left the group chat]

 

 


 

 

feral boys

 

blonde superman: you’re right this is SO MUCH FUN

 

 


 

 

aspen, local milf, egg, jason derulo, unique and unhinged, roblox hacker

 

local milf: DI D Y OUGUYS SEE THAT

 

egg: WHAT

 

unique and unhinged: after the plane landed the pilot and commander went off to the side to speak and ????

 

unique and unhinged: i swear to god they were just barking

 

roblox hacker: McScuse me

 

unique and unhinged: i know im a professional gaslighter but i swear to god they’re barking

 

unique and unhinged: i thought it was mrs. o’leary at first

 

egg: wait oh my god

 

egg: they ARE barking

 

egg: the shit????

 

aspen: so i guess they DO know each other

 

roblox hacker: pilot boy was telling the truth????

 

local milf: i suppose?

 

unique and unhinged: ok wait im gonna go after the commander

 

unique and unhinged: he’s getting off the plane

 

unique and unhinged: 

 

unique and unhinged:

 

unique and unhinged:

 

aspen: bro?

 

jason derulo: shawty???

 

unique and unhinged: me: hey do you know the pilot?

jackson: jason? yes. we were trained by the same person. 

me: and the barking?

jackson: what barking? lee, are you alright?

 

roblox hacker: im.

 

roblox hacker: im too tired for this

 

roblox hacker: good night

 

local milf: its 2pm

 

roblox hacker: i said good night

Notes:

thanks to snufflesthepig and InsomniacForevermore for some of these ideas :)

peter is the second chaos incarnate. percy is the first.

percy and rachel's chat is something i think is very cute-

jason: bark
percy: bark bark
SWORD: ayo?

just feral lads

Chapter 18: tungsten dioxide whats this

Summary:

Keeping up with the avengers begins

Notes:

(See the end of the chapter for notes.)

Chapter Text

our family tree is a wreath

 

horse girl: hey percy

 

horse girl: can you come over and bake cookies with me?

 

has a buzzfeed unsolved episode: camnt

 

has a buzzfeed unsolved episode: hyidia suerpholsdier threww m e tho=rough a buildging

 

horse girl: oh

 


 

SSEA

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ:  fuck

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: you motherfucking bitch come at me you little shit

 

Tony Stank: excuse me

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ:  i fucking hate uruguay what the shit why no don’t do that mal i swear to the gods

 

mindiana jones: …did he leave speech to text on?

 

gitc: oh my god

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ:  mal stop that right now do not

 

baby avenger: huh

 

baby avenger: wild

 


 

robert <3

 

unique and unhinged: i consider that mission a wild success

 

local milf: ?????

 

local milf: your wrist is in a brace??? mal got shot??? jackson’s body literally got used as a wrecking ball???

 

unique and unhinged: but did we die

 

jason derulo: he’s gotta point

 

unique and unhinged: <3

 

jason derulo: <3

 

roblox hacker: ew

 

unique and unhinged: stfu and let us be gay

 

local milf: actually though

 

local milf: where is everyone

 

unique and unhinged: got checked out by the paramedics

 

unique and unhinged: cleared :)

 

jason derulo: and i await for my lover to be returned to me

 

unique and unhinged: omw !!

 

aspen <3 wendy’s

 

local milf: what

 

aspen <3: wanted frosty

 

local milf: ?????? what the fuck aspen

 

roblox hacker: oooh oooh get me one

 

aspen <3: chocolate?

 

roblox hacker: ofc

 

roblox hacker: i’m in the van btw

 

local milf: ill come join you

 

local milf: commander? Mal?

 

jason derulo: boy? Retrieved

 

jason derulo: [Image Attachment: Ross is sitting on the edge of a hospital bed, Lee’s head in her lap. They’re both smiling. Lee is holding up a peace sign, wrist in a thick brace.]

 

aspen <3: ha gay

 

aspen <3: mal’s still in surgery. she’s def gonna make it tho

 

aspen <3: no clue about jackson. probably being wrestled into the ICU or something

 

roblox hacker: wait seriously?

 

roblox hacker: how bad is it?

 

jason derulo: well i mean

 

jason derulo: im pretty sure there’s a jackson shaped hole in like. at least three concrete walls

 

roblox hacker: fuck

 

supreme overlord jackson: don’t worry about it.

 

jason derulo: lee’s on concussion watch so. no more screens

 

jason derulo: i will be typing for the both of us

 

jason derulo: “ AYO?” -lee

 

supreme overlord jackson: i drank some water. I’m fine now.

 

local milf: i’m fairly sure your ribs snapped

 

supreme overlord jackson: i drank some water. 

 

roblox hacker: hydration do be like that i guess

 

local milf: that sounds fake but i dont know enough about drinking water to dispute it

 

aspen <3: closing in on your location with dan’s frosty and a bottle of water which you will be drinking

 

supreme overlord jackson: mal is fine. bullet wound to the thigh, just a graze. didn’t clip any major arteries. she’ll be on desk duty for a while, but she’ll make a full recovery.

 

local milf: can we see her?

 

supreme overlord jackson: soon. they’re just getting her room set up. 

 


 

our family tree is a wreath

 

mcshizzle: so that’s my opinion on sea cucumbers

 

sparky: huh

 

sparky: interesting

 

pied piper: speaking of sea cucumbers

 

pied piper: @hasabuzzfeedunsolvedepisode you good

 

has a buzzfeed unsolved episode: if i had a nickel for every time my ribs stuck clean out of my body, i’d have two nickels. which isn’t a lot, but it’s weird that it happened twice

 

my chemical ron weasley: what the fuck

 

my chemical ron weasley: where are you

 

has a buzzfeed unsolved episode: hospital in uruguay

 

has a buzzfeed unsolved episode: i’m my teammates medical proxy so

 

horse girl: is everyone alright?

 

has a buzzfeed unsolved episode: yeah

 

has a buzzfeed unsolved episode: lee’s wrist is sprained pretty badly, and mal got shot

 

has a buzzfeed unsolved episode: but i didn’t raise no little bitches so

 

has a buzzfeed unsolved episode: mal is already awake and loudly demanding plastic dinosaurs as a reward

 

mcshizzle: i love these people

 

sparky: is mal the first one i bit? 

 

has a buzzfeed unsolved episode: no, that was dan

 

has a buzzfeed unsolved episode: but close enough

 


 

SSEA

 

Tony Stank: just got off the phone with lee and ross

 

Tony Stank: SWORD’s fine. They’re just going to have to stay in uruguay for a few more days

 

gitc: nobody got hurt?

 

Tony Stank: uh

 

Tony Stank: well

 

Tony Stank: according to them, lee’s got a sprain, mal got a very small bullet wound thats already stitched up, and percy

 

Tony Stank: ‘did some freelance demolition with his own body, but gaslight gatekeep girlbossed the hospital into clearing him’

 

Tony Stank: so take that as you will

 

baby avenger: i want to be percy when i grow up

 

Tony Stank: im literally begging you do not

 

Tony Stank: besides, nobody can match his aura of pure destruction and chaos

 

baby avenger: 

 

Tony Stank: WAIT



Tony Stank: NO

 

Tony Stank: PETER THATS NOT A CHALLENGE

 

Tony Stank: KID IM BEGGING YOU PLEASE

 

baby avenger: uwu

 


 

mr harrington please stop sending memes challenge

 

dumb little boy: i have Content

 

President lincoln

:

 

moonmoon: jesus christ abe

 

moonmoon: how did you respond that fast

 

President lincoln:  ; )

 

The News(™): feed us the content, father

 

avril lavigne: yes, father. feed your children

 

murphy’s law: noticeable lack of content :/

 

murphy’s law: father is…cruel? father is….unloving?

 

moonmoon: father wishes us to starve? 

 

moonmoon: oh, the humanity!

 

dumb little boy: [Video Attatchment: The video opens with someone holding up a title card in front of the screen. In crayon, it says ‘keeping up with the avengers’. A little theme song plays on what sounds like the oboe. 

 

The next shot moves to Peter, sitting in a sole chair under a bright light. 

 

Ned: Alright, we’re rolling.

 

Peter: Ok! Cool. Hi, I’m Peter, and welcome to my sexy new reality show, Keeping Up With The Avengers. Because y’all respect them a little too much. 

 

Ned giggles behind the camera. 

 

Peter: Alright, let’s meet our stars.

 

The video transitions like a bad powerpoint. Now, Tony Stark is sitting in the chair. He’s visibly cringing under the bright light. At the corner of the screen, it says Tony Stark; Billionaire, Playboy, Philanthropist, Gives Good Hugs. 

 

Tony: Christ, kid. The things I do for you…

 

He clears his throat. 

 

Tony: Hello, my name is Tony Stark. Also known as Iron Man, in case that’s news. 

 

Peter, now also behind the camera: Tell us some fun facts about yourself!

 

Tony, sighing: Alright, uh…

 

He holds up three fingers. 

 

Tony: Number One; I’ve been awake for three days. Number Two; I’m allergic to asparagus but I eat it anyways. Number Three; I’m fully aware both these things could kill me, and I hope they do.

 

Peter, quietly: Mr. Stark, no. 

 

The video transitions again. Now, Colonel James Rhodes is sitting in front of the camera. The corner of the screen says Colonel James Rhodes; Air Force Pilot, Original Tony Stark Stan, Holder Of The Best Banana Bread Recipe In The Galaxy.

 

Rhodes: Hey. I’m James Rhodes. People call me Rhodey. I once saw Tony try to consume an entire fistfull of bolts, I can lick my elbow, and my favorite animal is the stegosaurus.

 

Peter: Fantastic choice. 

 

Rhodes: Thank you. 

 

Peter: …Did he actually eat the bolts?

 

Rhodes: He most certainly tried.

 

Now, Pepper Potts, looking radiant as always, sits in the chair. The corner reads Pepper Potts; Glowing Goddess, Girlboss CEO, Literally Queen.

 

Peter: Hi Ms. Potts :)

 

Pepper: Hi, Peter.  

 

She smiles at them. MJ swoons behind the camera. 

 

Pepper: I’m Pepper Potts, Tony’s friend and CEO. I’m allergic to strawberries, have a cat named Nutella, and my favorite color is buttercup yellow. 

 

Peter: Everything you do amazes me. 

 

Pepper laughs. 

 

Now, the camera switches again. Peter, MJ, and Ned are squished together in one chair. Words on the screen, in comic sans, say meet the crew!

 

MJ, in a monotone: Hi, I’m MJ, and these two losers are Ned and Peter.They came up with this idea. I’m just here to bask in Pepper Potts’ presence. 

 

Ned: Pepper Pott’s presence. Try saying that five times fast. 

 

Peter tries. It does not go well. 

 

Peter: Anyways. Hi! This is just a Pilot episode. Everyone’s here but PJ and Lea, but we’ll introduce them soon. 

 

Again, we cut to Tony.

 

Peter: Before we go, Mr. Stark, is there anything you’d like to say?

 

Tony sighs for a second, considering. Then,

 

Tony: Wait, who’s gonna see this again?

 

Peter: Just my AcDec friends. 

 

Tony: Oh, alright. Then yeah, I have a few things to say.

 

Peter: Tea?

 

Tony: First off, PJ, you bastard, I know you’ll see this eventually. Stop with the fucking Moses impression. The interns already have a thing about you. Please. 

 

Tony: Second of all, whoever told him to wink every time he lifts some heavy equipment for said interns down in the labs, you’re dead. Dead, you hear me?

 

Tony: Uhm, what else… Oh! AcDec kids, you aren’t allowed to meet PJ. Ever. 

 

Tony: That’s it. I think. Wait!

 

He smiles widely at the camera. 

 

Tony: Pep, Platypus, I love you. 

 

As the video cuts off, you can hear Peter and Ned awww ing. 

 

End of Video]

 

dumb little boy: jesus christ guys i was just waiting for the video to send

 

moonmoon: we are fed

 

The News(™): that was some cute shit eye—

 

President Lincoln: pepper potts has a cat???

 

gitc: she does and she’s amazing

 

avril lavigne: tony stark eats scrap metal confirmed

 

avril lavigne: god i love it here

 

moonmoon: send a video of rhodes licking his elbow

 

moonmoon: for science

 

Murphy’s law: please tell us there will be more of this

 

dumb little boy: only if you change my screen name

 

moonmoon: you drive a hard bargain, parker

 

[moonmoon has changed dumb little boy’s name to ‘tungsten dioxide whats this’]

 

tungsten dioxide whats this: this is so much worse

 

The News(™): too late you gave us your word

 

tungsten dioxide whats this: dammit

 

President Lincoln: also why arent we allowed to meet pj in person?????

 

moonmoon: and what was with all the stuff stark said??? moses impression?? lab interns??

 

tungsten dioxide whats this: oh uh

 

gitc: hes hot

 

tungsten dioxide whats this: n e d

 

gitc: why are you booing me?? Im right

 

gitc: whenever he goes down to the r&d labs for whatever reasons the interns all lose their minds

 

moonmoon: its now occurring to me we actually havent seen his whole face

 

tungsten dioxide whats this: yeah…

 

tungsten dioxide whats this: i heard from mr. stark once he wore a crop top and

 

tungsten dioxide whats this: many very expensive things were dropped that day

 

Avril lavigne:

 

Avril lavigne: ok i want to meet him

 

Murphy’s law: yeah me too

 

moonmoon: I Will Find Him

 

tungsten dioxide whats this: god please no

 

tungsten dioxide whats this: im begging you dont

 

gitc: you shouldve listened to mr. stark

 

tungsten dioxide whats this: 😔 

Notes:

nobody:
percy: hydrate or diedrate

percy is def the gaslight portion of gaslight gatekeep girlboss

also. he's hot. we know it. they know it. the interns know it. the only one who does not know it is percy.

 

poor hazel just wanted to bake cookies :/

and in case you missed it, i made a playlist for my version of percy :)
plumbing baby. goodbye.
https://open.spotify.com/playlist/5sKSwyVzRWA718FPuswNcS?si=38e7a74ef2654b84

Chapter 19: oh no. hes hot

Notes:

(See the end of the chapter for notes.)

Chapter Text

robert <3

 

local milf: mal 

 

local milf: mal where are you

 

egg: ;)

 

local milf: mal please

 

unique and unhinged: mal this is serious

 

local milf: there is a HOLE in your LEG

 

local milf: dont be playing these games

 

egg: you'll never take me alive

 

unique and unhinged: so be it.

 

unique and unhinged: you will severely regret your words in about three minutes.

 

local milf: wait what

 

local milf: you are literally at walmart with me what are you going to do

 

unique and unhinged: oh, nothing

 

unique and unhinged: it's not me they need to be worried about.

 

roblox hacker: o.O

 

egg: your threats mean nothing to me

 

egg: i refuse to rest

 

unique and unhinged: wait for it

 

egg: HOLYY FYUCK PERCYU JACOSON IS STANDINH BEHIND ME REMEMBER MEFHUHGVREJKQJABHOVWIBEVDHIASBGRWO

 

jason derulo: what the everloving fuck

 

jason derulo: why am i suddenly scared

 

local milf: lee is currently picking out a squash but said

 

local milf: “i don't know, have you been resting like you are supposed to?”

 

local milf: you did get banged up a bit, you should take a break.

 

jason derulo: says YOU i’m working on these reports until i drop dead

 

jason derulo: fuck

 

jason derulo: oh my god why did it get so quiet

 

jason derulo: guys i think our boss is coming to kill me

 

jason derulo: i can hear him comingbgehraiuwefbhAGWH

 

roblox hacker: 0-0

 

local milf: aspen?

 

local milf: are you still working?

 

roblox hacker: they are!!!!!! 

 

roblox hacker: i saw them at their desk while i was leaving!!!

 

aspen <3: you fucking SNITCH

 

aspen <3: betrayal cuts deeper than any mortal blade. it draws blood like never seen, causes pain like never before felt, beyond compare. its agony lingers; a dark shade upon a once shining soul.

 

aspen <3: i shall never be the same again. this day, the actions of a man i thought honorable, one i considered a dearest comradeghreoafijwehr4ut35gtrgfbt

 

supreme overlord jackson: mal, aspen, and ross have all lost phone privileges for the time being. they have also all been put to bed like the children they are.

 

supreme overlord jackson: attempts to liberate them will be met with severe consequences. 

 

roblox hacker: can i work???? im Not Injured

 

roblox hacker: and why did lee escape???? he got his wrist McFucked

 

supreme overlord jackson: lee is at walmart picking out produce. he isn’t even carrying any bags. they got a cart. 

 

local milf: wait how the fuck did you know that last part

 

supreme overlord jackson: i take my employee’s safety and recovery very seriously. 

 

local milf: …ok

 

supreme overlord jackson: and yes, dan. you can get some work done as long as you leave at a reasonable hour.

 

roblox hacker: FUCK yes

 

roblox hacker: im about to cybercrime my way to internet glory on a 2005 barbie laptop

 

local milf: …have fun with that

 

roblox hacker: i most certainly will

 

 


 

 

our family tree is a wreath

 

has a buzzfeed unsolved episode: the kid im babysitting has asked me to participate in a reality show

 

pied piper: you’re babysitting?????? aren’t you like. living in stark tower?

 

has a buzzfeed unsolved episode: well yes

 

has a buzzfeed unsolved episode: but im babysitting his child

 

sparky: he has a kid?

 

has a buzzfeed unsolved episode: legally? maybe. biologically? jury’s out. emotionally? yes.

 

has a buzzfeed unsolved episode: his name is peter and he is very small

 

mcshizzle: ah

 

horse girl: how are your ribs?

 

has a buzzfeed unsolved episode: pretty much healed. my team on the other hand

 

has a buzzfeed unsolved episode: three of them have been forcefully put to nap time

 

framk: oh gods

 

horse girl: not the imposed rest

 

my chemical ron weasley: i still have nightmares

 

my chemical ron weasley: not even will is as bad as you

 

has a buzzfeed unsolved episode: well, someone had to keep you alive <3

 

my chemical ron weasley:

 

my chemical ron weasley: <3

 

horse girl: aw

 

my chemical ron weasley: hazel if you were anyone else i would stick an army of the undead upon you

 

horse girl: i know :)

 

 


 

 

nick fury @12yearoldterrorist

hydra was responsible for america’s got talent but the president just didn't want you to know

 

UN @UnitedNationsOffical

mr fury?????

 

WSC @WorldSecurityCouncilOffical

sir please respond to our dms

 

 


 

 

mr harrington please stop sending memes challenge

 

tungsten dioxide whats this: for you, lil uzi, a rob zombie poster

 

moonmoon: RREEEEEEEEEE

 

president lincoln: RYEEAHHHHHH?????



The News(™): what do you have for us

 

tungsten dioxide whats this: :]

 

tungsten dioxide whats this: [Video Attachment}

 

[Video Description: We once again get the Keeping Up With The Avengers title card and theme song. We then move to a shitty plastic chair sitting in the middle of an empty room.

 

Peter, from behind the camera: PJ’s home now, but I don’t trust you guys to know what he looks like.

 

The camera moves closer. There is a cellphone on the seat. It rings. Peter reaches out and accepts the call.

 

Peter: Hey, PJ. 

 

PJ: Hi, Peter. 

 

Peter: Thanks for agreeing to this. 

 

PJ: With how vague and suspicious you were? How could I not?

 

Peter: Fair. Introduce yourself, please. 

 

PJ: Hey. I’m PJ, and I threw a printer at my teacher in the fifth grade. 

 

Peter: Ouch. Was it deserved?

 

PJ: Undoubtedly. 

 

Peter: Sick. Before you go, do you have any advice for my friends?

 

PJ: Hm.

 

PJ: If a hot older guy asks you to go into the woods with him, say no. Don’t get into elevators with chihuahuas. Uh, don’t go to Alaska. 

 

PJ: Lastly, friends murder each other all the time. 

 

PJ: That’s it. 

 

Peter: 

 

Peter: That was unsettling. Thank you.

 

PJ: Anytime. 

 

The line goes dead. 

 

End of video description.]

 

moonmoon: im

 

moonmoon: WHY WONT YOU LET US SEE HIS FACE

 

tungsten dioxide whats this: YOU KNOW WHY

 

murphy’s law: his voice 😩

 

tungsten dioxide whats this: SEE THIS??? YOU SEE THIS BEHAVIOR???

 

avril lavigne: HE SOUNDS HOT

 

nedleedle: its better in person

 

president lincoln: REAL SHIT???

 

tungsten dioxide whats this:

 

tungsten dioxide whats this: yall have issues. 

 

moonmoon: your opinion is invalid here

 

moonmoon: obviously you don’t find your surrogate father’s illegitimate brother hot

 

tungsten dioxide whats this: thats a lot of words

 

tungsten dioxide whats this: too bad im not reading them

 

 


 

 

Judas!!! No!!!

 

one hit KO: I FORGOT ABOUT THE BROTHER THING JFREBVFUIBQIEWAU

 

Loser 2: oh my god me too

 

Loser 2: WAIT

 

Loser 2: OH MY GOD PERCY IS IN THIS CHAT

 

one hit KO:

 

 


 

 

mr harrington please stop sending memes challenge

 

murphy’s law: peter you can’t deny it

 

murphy’s law: from an objective standpoint

 

tungsten dioxide whats this: you 👏   havent 👏  seen 👏   his 👏   face

 

moonmoon: ned says hes hot!!

 

tungsten dioxide whats this: NED IS A WHORE

 

president lincoln: yikes

 

nedleedle: no hes right

 

avril lavigne: we need a tie breaker

 

avril lavigne: mj?

 

mindiana jones: hm?

 

mindiana jones: oh

 

tungsten dioxide whats this: mj please

 

mindiana jones: that man is a masterpiece of a human. absolute 15/10. 

 

tungsten dioxide whats this: NO

 

 


 

 

Judas!!! No!!!

 

not a loser: why are you guys using the private chat?

 

not a loser:

 

not a loser:

 

not a loser:

 

not a loser:

 

not a loser:

 

Loser 2: oh god shes buffering

 

one hit KO: mj,,,,,,,,

 

not a loser: parker.

 

not a loser: fix this. 

 

not a loser: p l e a s e

 

one hit KO: i swear ill do my best

 

Loser 2: godspeed

 

 


 

 

Rowdy Boys

 

Small™: hey percy

 

Small™: do you ever check the acdec chat???

 

jalapeno eating king: no

 

jalapeno eating king: i say this as nice as possible

 

jalapeno eating king: if i wanted to hear the equivalent of eight wombats screaming at each other i’d visit my family

 

jalapeno eating king: i dont even know why im in that

 

jalapeno eating king: i only show up when summoned

 

jalapeno eating king: why? 

 

jalapeno eating king: should i check it?

 

Small™: NO

 

Small™: nope. everything is fine

 

Small™: I was just wondering

 

Notes:

i genuinely dont know what this is. i was listening to the backstreet boys the entire time and my hands have gone numb

uhhh two new playlists!!! one for peter and one for tony.

peter: https://open.spotify.com/playlist/2qPXxv8bh8PdsOYOKppDU7?si=29e7a13b5eb748b4
tony: https://open.spotify.com/playlist/2GD4dxL3LpXD7304WURPTl?si=56148907c2094df9

you can also find these ones, plus percy's, on spotify @denimbeans

i am also still taking song recs!!! drop em if you have em :)

plumbing baby. goodbye

Chapter 20: cube earth

Notes:

(See the end of the chapter for notes.)

Chapter Text

The Boys

 

none pizza left beef: has mj recovered

 

strawbebby: i dont think he checked the chat. but. 

 

strawbebby: its bad, ned

 

strawbebby: [Video Description: Peter is sitting on his bed, filming MJ, who is standing in his bathroom. “I…I think you’re blowing this out of proportion.”

 

“Am not,” MJ’s muffled voice replies. 

 

“There’s not even enough water for you to drown in. You’re just getting your face damp.” 

 

The video cut off as MJ reached for the tap.] 

 

none pizza left beef: oh god

 

 


 

 

robert <3

 

egg: i return

 

jason derulo: we have been freed

 

aspen <3: can’t believe dan helped jackson euthanize me

 

jason derulo: fuckin narc

 

[jason derulo has changed roblox hacker’s name to ‘class traitor’]

 

[jason derulo has changed their name to ‘certified monster fucker’]

 

local milf:

 

egg: was venom on the news again

 

certified monster fucker: you know it

 

class traitor: i despise this name change but i'll ignore it for now

 

class traitor: cause like

 

class traitor: that tongue

 

certified monster fucker: RIGHT?????

 

certified monster fucker: dear god the things i’d let that man(?) do to me

 

aspen <3: friendly, gentle, and loving reminder that this is a group chat and i possess the ability to kill someone and not get caught

 

certified monster fucker: teacher!!!! teacher, they’re threatening me!!!

 

certified monster fucker: this is harassment! I have the right to free speech >:(

 

class traitor: @supremeoverlordjackson

 

supreme overlord jackson: and yet, you choose to say this. 

 

supreme overlord jackson: unfortunately, i have suddenly lost the ability to read. i will be looking into this immediately. in the meantime, it seems i will be of no assistance. 

 

certified monster fucker: HEY MAN WHAT THE FUCK

 

egg: he really just said ‘fuck horny rights’ and dipped

 

egg: king

 

certified monster fucker: i will claw my way out of this mortal prison and one day assume my place as it’s rightfull ruler. 

 

egg: what

 


 

Coolest Intern @peterparkour

I got my lab privileges revoked for telling my friends tony stark is secretly bald



Coolest Intern @peterparkour

“eat the rich” you all say. but where were you when i needed you

 

merp @lowla

I?????? Hello????

 

Frogsareneat @littlegreenboy

HES BALD?????

 

Coolest Intern @peterparkour

no but imagine if he was lmao

 

merp @lowla

EYE—

 

mossboy @localfungi

did. did THE tony stark G R O U N D you???

 

Coolest Intern @peterparkour

yes he did the BASTARD

 

mossboy @localfungi

…does he ground all his interns or????

 

Coolest Intern @peterparkour

NO

 

Coolest Intern @peterparkour

JUST ME

 

You Know Who I Am @TonyStark

that’s because none of the other interns randomly look at the security cameras and go ‘this is it, viewers. this is my villain origin story’ whenever something slightly inconvenient happens. you’re not on a reality TV show, and you’re scaring the other interns

 

Coolest Intern @peterparkour

not my fault they’re little weenie punk bitches

 

weenie @cissiesmith

im sorry this entire thread is fantastic but TONY STARK SHOWED UP TO TELL OFF HIS KID??????

 

mossboy @localfungi

dr stark is this your illegitimate child im begging you

 

mossboy @localfungi

@peterparkour is this man your father

 

Coolest Intern @peterparkour

bro i have so little parents right now

 

weenie @cissiesmith

??????

 

You Know Who I Am @TonyStark

he is an orphan. 

 

mossboy @localfungi

OH

 

Coolest Intern @peterparkour

yeah no one day i came home and tony stark was just sitting in my apartment flirting with my aunt. he told me i had an internship and now he has brunch with my aunt and my friend’s moms :/

 

ferris wheel fighter @uhov4hiorei

im sobbing

 


 

 

Rowdy Boys

 

Small(™): at this rate im going to post that video of mr. stark sobbing while watching coco

 

jalapeno eating king: i’ll forge your name back on his will after you are inevitably removed

 

Small(™): IM IN THE WILL????

 

 


 

 

mr harrington please stop sending memes challenge

 

president lincoln: peter if you give us more Hot Man content i’ll do your english assignment

 

tungsten dioxide what's this:

 

 


 

 

Judas!!! No!!

 

Loser 2: you know he’s still in this chat

 

one hit KO: i do

 

one hit KO: but he never checks it

 

one hit KO: and honestly?

 

one hit KO: i think percy ‘get that bag’ jackson, the same man who kept a straight face while tony gave me fifty dollars to, and i quote, go get a bag of chips or something, would respect me for doing this

 

Loser 2: if you say so

 

 


 

 

tungsten dioxide what’s this: [Video Description: It’s an audio recording with a timestamp. While they vary as the video goes on, they are all marked somewhere around 2:00 AM. 

 

PJ, sounding tired: I’m awake, right?

FRIDAY: Correct

PJ: …And snakes don’t have legs?

FRIDAY: Right again

PJ: Oh thank fuck



PJ: What do people think really happened at the Hoover Dam in 2006?

FRIDAY: A series of technical malfunctions. According to reports, two large statues were also stolen. 

PJ laughs. 



PJ: Hey, FRI?

FRIDAY: Yes?

PJ: Hypothetically, if I admitted to Tony I only had half my genes, do you think he’d be concerned?

FRIDAY: …Yes. As would I. Do you only have half of them?

PJ: …No?

 

PJ, mumbling: Gods, who does Dr. Phil think he’s kidding?

FRIDAY: What?

PJ: What?

 

End of video description.]

 

tungsten dioxide whats this: he likes to talk to FRIDAY when he can’t sleep

 

moonmoon: 

 

murphy’s law: 

 

president lincoln:

 

tungsten dioxide whats this: WAIT

 

tungsten dioxide whats this: NO NO NO NO FUCK

 

moonmoon: HIS VOICE IS ALL LOW

 

president lincoln: ITS SO RASPY

 

avril lavigne: what?

 

avril lavigne: oh

 

avril lavigne: 

 

avril lavigne: h ol y fu c kk

 

tungsten dioxide whats this: SHIT



tungsten dioxide whats this: I DIDNT THINK THIS THROUGH

 

tungsten dioxide whats this: NED I GAVE THEM MORE AMMO

 

nedleedle: f

 


 

 

nick fury @12yearoldterrorist

the earth is not flat. it’s actually a cube. the mountains are the corners. 

 

nick fury @12yearoldterrorist

there is satellite footage to confirm this.

 

 


 

Trending: 

#WHERESTHEFUCKINGFOOTAGE

#nickfuryaccount

#giveusthefootage

#realearthshape

#suckthisflatearthers

 

 


 

 

Tony for fucks sake go to sleep

 

Honeybear: why did one of my coworkers just ask me to ask you to build a space ship

 

Dumbest genius: probably the same reason i keep getting tweets asking me to go to space and see what shape the earth is

 

Honeybear: that fury parody account???

 

Dumbest genius: THE FURY PARODY ACCOUNT THAT JUST POSTED A SELFIE???

 

Honeybear: what

 

Dumbest genius: ITS FURY

 

Dumbest genius: HOLY FUCK ITS HIM

 

Dumbest genius: THERES NO EVIDENCE OF PHOTOSHOP

 

Honeybear: are you fucking kidding me

 

Dumbest genius: I DONT KNOW

 

Dumbest genius: rhodey im about to lose my shit

 

Dumbest genius: im at my wits end

 

Dumbest genius: im in the labs with peter and im trying to figure out how to tell him that all the storms we’ve had this week aren’t because the earth is mourning with MJ’s dignity (????) but because percy’s cousin has been in a losing streak in minecraft bedwars and keeps getting his ass kicked by middle schoolers

 

Dumbest genius: i cant deal with this right now

 

Dumbest genius: i need a nap

 

Dumbest genius: just an hour. that’s all i ask for

 

 


 

 

we had a bonding moment!!! I cradled you in my arms!!!

 

crack dealer: and so i arrived like a group of feral hogs at the retirement home picnic

 

 


 

 

Dumbest genius: scratch that

 

Dumbest genius: i need to sleep for at least a few weeks

 

Honeybear: thats a coma

 

Dumbest genius: so be it

Notes:

i dont know if any of you caught this but the 'we had a bonding moment!! i cradled you in my arms!!' chat between percy and tony is a reference to the first book when tony held percy after he got shot at the gala---

ALSO WHO THE FUCK COMMENTED THE IDEA OF PERCY AND FRIDAYS CONVERSATIONS BECAUSE FOR THE LIFE OF ME I CANT FIND THEM AND IM GOING INSANE
UPDATE snuffles the pig has taken credit for this. mystery solved. it was a cold case for two years but we did it, boys

yall: fury account reveal???
me: : )

plumbing baby. goodbye.

Chapter 21: it's either coding, or crack

Notes:

(See the end of the chapter for notes.)

Chapter Text

SSEA

 

Tony Stank: big announcement

 

baby avenger: omg

 

baby avenger: are you coming out of the closet

 

Tony Stank: 

 

Tony Stank:

 

Tony Stank: i think i came out when a photo of me making out with the prince of england made the front cover like 20 years ago

 

baby avenger: oh right lmao

 

Tony Stank: i worry about you, kid

 

Tony Stank: anyways. I got barnes a phone

 

gitc: sergeant barnes?????

 

Tony Stank: yep

 

[Tony Stank has added James Barnes to the chat]

 

Tony Stank: im sure i’ll regret this later

 

gitc: now why on earth would you regret  t h i s

 

gitc: also!! hi sergeant barnes!! im ned!!

 

James Barnes: hi

 

gitc: you

 

gitc: you turned his autocaps off?

 

Tony Stank: i felt a vibe

 

[baby avenger has changed James Barnes’s name to ‘skrunkly raccoon’]

 

skrunkly raccoon: ok

 

skrunkly raccoon: its very nice thank you peter

 

baby avenger: :D

 

gitc: the other two people are our friend MJ, and percy

 

gitc: @mindianajones @ ( ̿ ̿▀‿▀)▬▬ι═══════ﺤ

 

mindiana jones: im busy what you want bitch

 

mindiana jones: oh

 

mindiana jones: hello, sergeant barnes

 

Tony Stank: hey percy isnt answering his phone

 

Tony Stank: do you know where he is?

 

mindiana jones: hm

 

mindiana jones: percy. rise.

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: Hello

 

Tony Stank: 

 

Tony Stank: ok

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: hi, james

 

skrunkly raccoon: hi, percy

 

gitc: hows the phone working out for you?

 

skrunkly raccoon: confusing

 

skrunkly raccoon: downloaded facebook

 

skrunkly raccoon: messaged the president

 

Tony Stank: excuse me what

 

skrunkly raccoon: i dont like him

 

Tony Stank: what the fuck did you say

 

skrunkly raccoon: the truth

 

Tony Stank: b a r n e s

 

skrunkly raccoon: hey wait

 

skrunkly raccoon: i just learned to take a screenshot

 

skrunkly raccoon: [Photo description: A screenshot of a DM to the official POTUS account. Bucky texted only one thing: “I will see you hanged.” ]

 

gitc: EYE-

 

gitc: IM FUCKING SHAKING

 

mindiana jones: barnes i have never respected a white man more

 

skrunkly raccoon: thank you

 

Tony Stank: oh god

 

Tony Stank: pepper is going to kill me

 

skrunkly raccoon: oh

 

skrunkly raccoon:

 

 

gitc: you

 

gitc: you're getting used to this 21st century thing really well

 

Tony Stank: its true

 

Tony Stank: you're doing better than percy, who i had to help publish the only tweet he’s ever made

 

Tony Stank: the man is technologically illiterate

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: :(

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i learned to text!!!

 

Tony Stank: and we’re very proud of you

 

Tony Stank: but we cant even complain about the nick fury conspiracy account because you dont know how to access his tweets

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: :/

 

skrunkly raccoon: im sorry the what

 

mindiana jones: just scroll up

 

mindiana jones: you’ll find it eventually

 

baby avenger: uhh wait

 

baby avenger: dont scroll up–

 

gitc: too late he’s doing it

 

 


 

 

James Barnes and PJ

 

James Barnes: youre not a very well put together person are you

 

PJ: 😔 ✊  no

 

PJ: how far did you get

 

James Barnes: tony stark’s illegitimate brother???

 

PJ: heh

 

PJ: yeah

 

James Barnes:

 

James Barnes: keeping up with the avengers??

 

PJ: peter got bored

 

James Barnes: you threw a printer at your teacher when you were 10?

 

PJ: it was therapeutic 

 

James Barnes: alright then

 

James Barnes: hey have you like. actually seen tony today??

 

James Barnes: i know he’s texting but i dont think he’s been out of his lab

 

PJ: no. i have not seen tony today

 

James Barnes: oh ok

 

PJ: or ever

 

James Barnes: FUCK

 

James Barnes:

 

James Barnes: i forgot my bad

 

James Barnes: friday describes the pictures for you right

 

PJ: vividly

 

[PJ has changed James Barnes’s nickname to ‘court jester’]

 

PJ: :)

 

court jester: you are a very strange person

 

PJ: thanks i think it’s because my cousin wont stop trying to murder me

 

court jester: which one?

 

PJ: not one i talk about

 

PJ: hes a dickhead whos started shit with me when i was literally twelve 

 

PJ: sometimes he just shows up in the middle of the day to try and kick my ass

 

PJ: i find it soothing to blame all my problems on him

 

court jester: thats fun

 

PJ: i think so

 

PJ: but to answer your question

 

PJ: tony’s just on a coding binge

 

court jester: should i be worried?

 

PJ: i mean you should always be a little worried when tony’s in his lab

 

PJ: but he just watched Wall-E and he codes when he’s sad. I’d tell him to stop, but i think at this point it’s either coding or crack

 

court jester: ugh

 

court jester: back in my day doing crack was an average part of your morning routine but people are so stingy about it now

 

court jester: re-normalize doing hard drugs when you have the slightest cough

 

PJ: 

 

PJ: you know

 

PJ: i think we’re going to be great friends

 


 

We had a bonding moment! I cradled you in my arms!!

 

Father of Five: why did i just get a chill down my spine

 

crack dealer: don’t worry about it

 


 

robert <3

 

local milf: i. hate family reunions

 

class traitor: awww poor little meow meow <3 <3 little skrungly blorbo <3 :,(

 

local milf: excuse me

 

aspen <3: bridgette just took psychic damage

 

local milf: no because this is an actual problem

 

local milf: my aunts are asking me what i do for work

 

local milf: and i can't tell them that i work for a super secret international agency alongside the avengers????

 

local milf: so i just fucking 

 

local milf: evade the question

 

egg: but you’re horrible at deflection!!

 

local milf: a fact i am very aware of right now

 

certified monster fucker: rip lmao

 

local milf: you know. I think you would really get along with one of my cousins

 

local milf: theres a snack table, and she took the entire tray of little sandwiches and is eating them outside

 

local milf: just. grabbed it and just exited the building

 

certified monster fucker: oof drop her number

 

local milf: thats 100% not what i meant

 

class traitor: elise, right?

 

local milf: yeah

 

certified monster fucker: e l is e ? ( ͡°👅 ͡°)

 

local milf: no.

 

class traitor: elise is happily married and has a stable job as a librarian at a local elementary school

 

class traitor: but yeah maybe she’d be interested in a 24 year old mental patient with a haircut that looks like sonic the hedgehog

 

certified monster fucker: sonic????

 

certified monster fucker: MENTAL PATIENT???

 

aspen <3:

 

certified monster fucker: aspen???? defend me???

 

aspen <3: you want me to lie?

 

certified monster fucker: 

 

certified monster fucker: ok he’s not wrong but its still rude

 

aspen <3: wait a sec

 

aspen <3: dan why did you know all that???

 

aspen <3: did you cyberstalk bridgette’s cousin????

 

class traitor: no!!

 

class traitor: lee told me about her

 

aspen <3: oh yeah??

 

aspen <3: when

 

class traitor: just now!!!!

 

aspen <3 lee isn’t active right now

 

class traitor: not in this chat :)

 

certified monster fucker: LEE

 

certified monster fucker: are you texting dan while ignoring the rest of us????

 

 


 

 

team rocket

 

james: you need to learn when to shut your mouth

 

jesse: yeah fuck you too

 

 


 

 

robert <3

 

unique and unhinged: yes

 

Aspen <3: rude ass

 

egg: hurtful :(

 

egg: even then, why does LEE know about bridgette’s cousin??

 

local milf: probably cause he’s the one who convinced elise to steal the sandwiches for the both of them

 

certified monster fucker: wait

 

certified monster fucker: is lee at the family reunion with you????

 

local milf: yeth

 

certified monster fucker: and you didnt invite the rest of us???

 

unique and unhinged:

 

 

local milf: i invited lee to help me get through this. 

 

local milf: to keep me CALM

 

local milf: with that goal in mind why would i invite any of you

 

egg: WOW

 

class traitor: words hurt :,(

 

Aspen <3: o u c h

 

unique and unhinged: hah

 

egg: you know what

 

[egg has changed unique and unhinged’s nickname to ‘thor understudy’]

 

thor understudy: :/

 

thor understudy: if anything he’s the fake

 

thor understudy: he’s not even actually norse

 

egg: cry about it

 

thor understudy: no

 

egg: oh

 

egg: well i dont know what to say here now

 

thor understudy: i do :)

 

thor understud y: tía olivia just showed up and she has polvorosas 

 

certified monster fucker: you lucky bitch

 

thor understudy: later, fuckos

 

thor understudy: im going to go flirt with bridgette’s aunt B)

Notes:

bucky barnes, leftist icon and legend

friendly reminder this fic is currently set in 2017 :) and the president of the US is horrible :) and that it's not based on any loudmouth cheeto :) at all ;)

am i aware that bucky doesn't know about peter at ALL in the main fic? yes. do i also know that this chatifc threw canon in a blender? also yes

...i just. i feel like you people need to know the fact that when i was picking heights for the SWORD members i made lee 6'9 cause i thought it was funny. well im an idiot and didn't realize how tall that was cause inches are confusing, and now he's just built like lebron james

also! i made an insta account. story updates and art will all go on there! you can find me @beansofdenim

to anyone who can't find my art there, here's a image link: https://ibb.co/7R6CXn9

plumbing baby. goodbye

Chapter 22: Toxic Traits

Notes:

(See the end of the chapter for notes.)

Chapter Text

SSEA

 

skrunkly raccoon: tony

 

skrunkly raccoon: tony

 

skrunkly raccoon: i want a twitter, tony

 

Tony Stank: hell no

 

Tony Stank: after what you did on facebook?

 

skrunkly raccoon: >:(

 

baby avenger: let him have a twitter mr. stark

 

gitc: give the man what he wants

 

Tony Stank: this is peer pressure

 

mindiana jones: indeed it is

 

mindiana jones: give him a twitter

 

Tony Stank: i will not be swayed

 

gitc: twitter! twitter!

 

baby avenger: twitter! twitter!

 

mindiana jones: twitter! twitter!

 

skrunkly raccoon: twitter! twitter!

 

Tony Stank: percy back me up here

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: twitter! twitter!

 

Tony Stank: you dont even USE twitter why do you care

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i side with the underprivileged masses

 

Tony Stank: :/

 

Tony Stank: goddamnit 

 

Tony Stank: FINE

 

skrunkly raccoon: :D

 

 


 

 

scientists hate this local new yorker @jbarnes

 

1 Follower | 0 Following






mooshroom @pianoman

TONY STARK JUST FOLLOWED A NEW ACCOUNT

 

mooshroom @pianoman

JAMES BARNES????????

 

lola @merp

AYO???

 

toby starch @TSarkStan

omg hi @jbarnes

 

scientists hate this local new yorker @jbarnes

hello :)






You Know Who I Am @TonyStark

sergeant barnes got a twitter. @jbarnes

 

You Know Who I Am @TonyStark

please be nice to him. he’s old. 

 

scientists hate this local new yorker @jbarnes

a hundred years old and still looking better than you

 

You Know Who I Am @TonyStark

bitch






paperclip dealer @behindyou

love the fact that stan twitter noticed james barnes had joined before stark himself even got to make the announcement

 

Iron Man Was Right @loppol

god works hard but we work harder

 

 


 

 

Iron man please marry me @starklover

Bucky barnes twitter era!!!

 

Iron man <3 @starkswife

fuck yeah!!! welcome to twitter you funky funky man!!!

 

Captain America Hate Blog @teamironman

you know what? Im done being hateful

 

Bucky Barnes Stan @teamironman

new day new me B)

 

tony stark stan account @ilovehim

hi sergeant barnes!! :D :D :D






scientists hate this local new yorker @jbarnes

stan twitter found me but they’re really nice so it’s okay




 

robert <3

 

egg: hey

 

egg: commander jackson

 

egg: can we get a twitter too??

 

aspen <3: really, mal?

 

class traitor: i mean

 

class traitor: the CIA has one

 

local milf: ugh

 

local milf: don't compare us to the CIA

 

certified monster fucker: but we could make sure our twitter is infinitely funnier and sexier than theirs

 

local milf: mmm fair point

 

egg: commander jackson?

 

egg:  👉 👈 

 

supreme overlord jackson: the day i give you a twitter is the day i abandon humanity. 

 

certified monster fucker: your toxic trait is not letting us run wild like the feral pack of hogs we are

 

egg: wait what’s mine

 

certified monster fucker: dressing like a frat bro who lives off his daddy’s money

 

egg: you take that back

 

certified monster fucker: you own three tanktops that say ‘suns out guns out’

 

egg: 

 

egg: i concede. 

 

certified monster fucker: my toxic trait is that i make sims out of all of you and have them make awful life choices when im mad at you

 

local milf: wait what

 

certified monster fucker: your toxic trait is the sheer amount of cakes you’ve stress baked and snuck into my house

 

egg: into all of our houses, actually

 

class traitor: i once found a banana bread loaf right next to me when i woke up

 

class traitor: it was terrifying

 

class traitor: anyways my toxic trait is going on competitive learning games for children and absolutely DECIMATING random first graders

 

aspen <3: you never fail to amaze me

 

aspen <3: mine is that i religiously play candy crush. I’ve finished the game and now i anonymously write emails to the game developers pressuring them to make more

 

egg: you

 

egg: you finished the game?

 

aspen <3: yes

 

aspen <3: all 9,673 levels that are currently out

 

class traitor: holy fuckin shit dude

 

class traitor: you have problems

 

aspen <3: never say words at me again

 

egg: what’s lee’s?

 

certified monster fucker: oh

 

certified monster fucker: uh

 

certified monster fucker: i’d say his height is toxic but he uses it for the common good

 

aspen <3: its true

 

aspen <3: he drops everything when i ask him to get something off the top shelf for me

 

aspen <3: he literally once drove to my house to grab me a tupperware from the top of my fridge

 

egg: its how he shows affection

 

certified monster fucker: wait so what IS his toxic trait???

 

aspen <3: shit man

 

aspen <3: does he have one????

 

local milf: yes. 

 

local milf: lee van keppel falls asleep on roller coasters and the world deserves to know

 

egg: IM SORRY WHAT

 

class traitor: excuse me

 

local milf: we went to an amusement park in anchorage

 

local milf: waited twenty minutes to go on the biggest attraction in the park

 

local milf: finally get on the ride, we’re literally going upside down half the time, at ungodly speeds

 

local milf: i look over to my left

 

local milf: and this motherfucker is dead asleep next to me. 

 

class traitor: l e e

 

class traitor: what the everloving hell

 

 


 

 

SSEA

 

baby avenger: i hate it here

 

gitc: you’re literally sitting next to me :(

 

baby avenger: wait no

 

baby avenger: not you ned you’re doing amazing

 

gitc: :)

 

baby avenger: i mean i hate american lit

 

baby avenger: why did i take this

 

gitc: cause MJ told you to

 

baby avenger: oh right

 

baby avenger: mj how could you do this to me

 

mindiana jones: im confident you’ll get over it

 

baby avenger: i will not

 

baby avenger: i hate reading

 

Tony Stank: god me too

 

midiana jones: as expected

 

Tony Stank: excuse me

 

skrunkly raccoon: i like reading

 

Tony Stank: nerd

 

skrunkly raccoon:

 

skrunkly raccoon: im not even going to address that, coming from you

 

baby avenger: the english majors are rising up against us

 

mindiana jones: :/

 

mindiana jones: ned whats your stance on basic reading skills

 

gitc: yeah im not getting involved in this

 

skrunkly raccoon: damnit

 

skrunkly raccoon: @( ̿ ̿▀‿▀)▬▬ι═══════ﺤ

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: what

 

skrunkly raccoon: reading; yes or no

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: oh

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: uhhh

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: book good reading bad

 

baby avenger: elaborate?

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: book make brain go brr

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: but brain also put the sexy in dyslexia

 

skrunkly raccoon: 

 

Tony Stank: 

 

gitc: 

 

baby avenger: 

 

mindiana jones: 

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: wait

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: fuck

 

skrunkly raccoon: is it bad that im laughing

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: :/ yeah, laugh at the disabled guy

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: ableist scum

 

skrunkly raccoon: i

 

skrunkly raccoon: i literally have one arm

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: and yet you still bully the blind guy smh

 

gitc: hey wait

 

gtic: you read braille, right?

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: no i read via aura and smoke signals

 

Tony Stank: ffs just say yes like a normal person

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: yes

 

gitc: so does your dyslexia still bother you???

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: yeah dyslexia still works on braille lmao

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: reading kinda sucks

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: also finding braille books hard :(

 

mindiana jones: wait thats actually kinda awful

 

baby avenger: i guess i never really thought about that

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: not a lot of people do, its alright

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: but honestly? being blind is fucking expensive

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: braille displays are thousands of dollars, books are more expensive, even canes can cost a lot of money

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: and not everyone has radar senses and a Mrs. O’Leary to help them get by

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: books are typically the least of my worries, y’know? and i don't have a lot of time to read, anyways. just never seemed worth putting in all the effort, to me

 

Tony Stank: oh

 

 


 

 

Judas!!! No!!

 

One Hit KO: guys

 

Loser 2: ?

 

One Hit KO: so im walking to the lab

 

One HIt KO: and

 

One Hit KO: [Image Description: Percy and Bucky are sitting in the common room. Percy is stretched across most of the couch, his head next to Bucky’s legs. In his hands, Bucky is holding a book, and he appears to be reading aloud. Percy is smiling slightly, eyes crinkled in the corners]

 

Loser 2: awwwww

 

 


 

 

CNN @CNN

Stark Industries to release a groundbreaking new braille display—for free. “Everyone deserves to be able to afford what they need,” Stark quoted. 

 

 


 

 

we had a bonding moment! I cradled you in my arms!

 

crack dealer: thank you

 

Father Of Five: i have no idea what you could possibly be talking about

 

crack dealer: of course not

 

crack dealer: you’re a good person, tony

Notes:

ok so i'd like to start out by saying: obviously, blind people do not need people to read to them. audiobooks and braille books. percy just has issues with braille (which dyslexia DOES affect) and isn't really an audiobook guy---he just doesn't care enough to really get into them. bucky reading to him was just a cute little thing

i'd also like to bring some awareness to the costs of being blind, or really having any sort of disability. like, seriously, look up how much a braille display costs. shits wild.

and yes, bridgette does stress bake and then break into peoples house to leave them whatever she made. this includes putting a tray of cupcakes in aspen's pantry, banana bread on dan's pillow, pastries on ross's dresser, and on top of mal's coat rack. nobody knows how or when she does this.

she did it to percy Once. only once, because when she was on her way out, he appeared behind her and gave her a container of blue cookies in return. he's the only person to have ever caught her.

peter's toxic trait is threatening to bite people and inject them with his venom
tony's toxic trait is doing giant things for the people he cares about and then pretending he has no idea what they are referring to
bucky's toxic trait is that he keeps breaking microwaves
percy's toxic trait is how much he enjoys being vague and cryptic about his family

plumbing baby. goodbye.

Chapter 23: senator weiner

Notes:

HAPPY EARLY BIRTHDAY TONY STARK!!!!

(See the end of the chapter for more notes.)

Chapter Text

SSEA

 

Tony Stank: who the fuck was it

 

skrunkly raccoon: whatever do you mean ٩(˘◡˘)۶

 

Tony Stank: it was you, you little bitch

 

skrunkly raccoon: i have an alibi for the entire morning :) :)

 

skrunkly raccoon: ask fri

 

Tony Stank: alright your story checks out

 

Tony Stank: peter? Was this you?

 

baby avenger: hey now

 

baby avenger: ive never done anything wrong in my life and id like that on record

 

Tony Stank: you are a vigilante

 

baby avenger: well its ok when i do it

 

Tony Stank: i already checked with pepper and rhodey

 

Tony Stank: and i know whoever this was couldn't have acted alone

 

Tony Stank: @( ̿ ̿▀‿▀)▬▬ι═══════ﺤ answer for your crimes

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: you'll never take me alive

 

Tony Stank:

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: sorry, reflex

 

Tony Stank: concerning

 

Tony Stank: but was this you, you little fucknugget

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i have no idea what you could possibly mean, dearest birthday boy

 

Tony Stank: do not. 

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: birthday boy. evicted from the womb anniversary.

 

Tony Stank: stop

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: on this day, your wrinkly, pudgy little baby face met this ugly, ugly world for the first time. 

 

Tony Stank: i hate you so much

 

baby avenger: wait

 

baby avenger: this isnt about the confetti cannons??? they havent gone off yet

 

baby avenger: i checked

 

Tony Stank: the what

 

baby avenger: uh

 

baby avenger: nothing

 

baby avenger: percy did something

 

baby avenger: lets focus on that again

 

skrunkly raccoon: wig?

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i gave him a little festive treat and nothing more

 

Tony Stank: YOU REPLACED MY PILLOW WITH A SHEET CAKE IN THE MIDDLE OF THE NIGHT

 

Tony Stank: I WOKE UP COVERED IN FROSTING

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i bak a cak for u

 

Tony Stank: you disgust me and i refuse to believe you acted alone

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: well

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i baked it at my cousin’s house

 

skrunkly raccoon: and while he was finagling the cake under your cranium

 

skrunkly raccoon: i stood to the side in case you woke up and needed to be nerve striked back into unconsciousness

 

Tony Stank: there is something deeply wrong with you two and also frosting in my nose

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: happy birthday :)

 

 


 

 

mr harrington please stop sending memes challenge

 

Scary Captain: alright, AcDec group retreat is coming up

 

Scary Captain: we will be brainstorming ideas and voting

 

moonmoon: cheese factory

 

Murphy’s law: im lactose intolerant

 

moonmoon: oh sorry

 

moonmoon: cheese factory without charles

 

Murphy’s law: you bitch

 

nedleedle: lets go catch subway rats and rehabilitate them like last year

 

President lincoln: that WAS fun

 

President lincoln: but sally did get that wacky mutated rabies case

 

nedleedle: and? she was arguably alright in the end

 

Avril lavigne: when i sneeze the power goes out

 

The News(™): we should go feral

 

The News(™): revisit our roots

 

The News(™): go live in a forest for a bit

 

tungsten dioxide whats this: we could prepare our survivalist skills for when society finally crumbles and people begin to eat each other and mitch mcconnell starts training the pigeons

 

The News(™): that too

 

moonmoon: hmmm

 

moonmoon: i like forest

 

moonmoon: can look at bùgs

 

nedleedle: valid point

 

murphy’s law: and i can finally go rematch that bear

 

Avril lavigne: and if flash gets wind of it we can always drown him in a creek and label it a tragic accident, then get together on the ten year anniversary and watch the dedicated new segment about it and laugh like old rich people talking about the economy

 

nedleedle: ok im down

 

tungsten dioxide whats this: and id follow ned to the ends of the earth so

 

moonmoon: time to be raccoon boys?

 

mr. harrington: i suppose, since you all agreed

 

moonmoon: 

 

moonmoon: sometimes i forget mj isn't the only authority figure in this chat

 

Scary Captain: you lot require two of us. 

 

mr. harrington: you can say that again, michelle.

 

Scary Captain: i will, probably within the hour, roger. 

 

Scary Captain: alright, we need an extra chaperone to sign up. legally, i dont count. 

 

 


 

 

Judas!!!! No!!!!

 

Loser 2: peter

 

One hit KO:

 

One hit KO: you have the WRINKLIEST brain

 

 


 

 

mr harrington please stop sending memes challenge

 

Scary Captain: alright, we have the chaperones and the campsite booked. everyone, please make a packing list. and abe?

 

Scary Captain: dont fill your suitcase with nothing but chex mix again.

 

president lincoln: i know my rights

 

 


 

 

mr harrington please stop sending memes challenge

 

The News(™): i do really feel bad for mr. harrington sometimes

 

avril lavigne: like that one time we built an elmo statue out of microscopes, gel pens, and abe’s shoes?  

 

The News(™): yeah exactly like that

 

moonmoon: or like that one time he had to tell me off for rapping the constitution on the school announcements?

 

nedleedle: or when charles said mr. harrington needed to give him an A or he’d start taking shots of sharpie ink

 

tungsten dioxide: or that one time sally brought in the ouija board because abe told her the boiler room was haunted and she wanted out find out if the ghosts were gay or not

 

Murphy’s law: or when betty tried to buy that ostrich online with a credit card number she found in the bathroom of a hobby lobby

 

Scary Captain: these are all prime examples of why none of you should reproduce. the trip is next weekend. clear your schedules. 

 

 


 

 

Rowdy Boys

 

Small(™): hey can i bring lea on a school trip to the forest so when the others eventually decide to recreate the hunger games i have a chance

 

jalapeno eating king: i dont see why not

 

 


 

 

SSEA

 

gitc: i am just a simple boy

 

gitc: taking a little jaunt through the tower to retrieve the terrarium i made out of a arizona tea bottle to keep my pet imaginary roach, senator weiner, in

 

gitc: when i walk past one of the labs

 

gitc: and hear tony stark, iron man himself, laughing like he's on his joker arc

 

gitc: god? anyone? explain? 

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i procured him some magic weapons to play with

 

gitc: you gave him weapons for his birthday?

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i give everyone weapons as gifts

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: my sister even helped me pick out a bow for it

 

mindiana jones: tony stark with magic weapons

 

mindiana jones: i see no way for this to go wrong

Notes:

acdec content acdec content

poor mr harrington lmao

throughout various field trips, something always happens to one of the acdec members that results in them getting minor superpowers, like sally's power outage sneezes. this happens to them all, even mj and ned. all of them, except peter.

naturally, they make it their mission for peter to make it to graduation without having some sort of Accident.

little do they know. he was the first. he kickstarted this whole trend.

nobody:
tony w a magic spear: >:)

also: loving reminder you can find me on insta @beansofdenim for art and lawn care tips

plumbing baby. goodbye.

Chapter 24: Spray Cheese

Notes:

username rundown:

mr harrington please stop sending memes challenge:
president lincoln: abe
murphy's law: charles
The News(TM): betty
moonmoon: cindy
avril lavigne: sally
tungsten dioxide whats this: peter
Scary Captain: mj
nedleedle: ned

Judas!!! no!!!
Not A Loser: mj
Loser 2: ned
One hit KO: peter

We had a bonding moment!! I cradled you in my arms!!!
Father of Five: tony
crack dealer: percy

tony stark's murder friends
court jester: bucky
45 grapes: percy

(See the end of the chapter for more notes.)

Chapter Text

mr harrington please stop sending memes challenge

 

president lincoln: my shit? Packed

 

murphy’s law: how much of it is chex mix

 

president lincoln: ;)

 

murphy’s law: ok.

 

Scary Captain: if everyone’s not on the bus at 9:00 sharp i will be in your closet when you come home

 

moonmoon: jesus christ ok

 

moonmoon: am now departing early

 

Scary Captain: good

 

Scary Captain: do we need to talk about seating assignments? 

 

nedleedle: DIBS ON SITTING NEXT TO PETER

 

tungsten dioxide whats this: DIBS ON SITTING WITH NED

 

nedleedle: omg

 

tungsten dioxide whats this: awwwww ned <3 <3 <3 <3

 

nedleedle: <3 <3 

 

The News(™): those two are scarily in sync

 

nedleedle: thanks its the undying love

 

tungsten dioxide whats this: :)

 

tungsten dioxide whats this: im already on the bus and ill save a seat for you

 

 


 

 

Judas!!! No!!!

 

Not A Loser: is he with you?

 

One hit KO: yep. So is lea, but she’s sitting with him

 

Not A Loser: percy was really alright with you taking her?

 

One hit KO: well i didnt dognap her if thats what you're asking

 

Not A Loser: : /

 

One hit KO: but yes he said i could take her as long as nobody fed her 35 marshmallows

 

One hit KO: 36 or more is fine, as is 34 or less

 

One hit KO: just not 35

 

Loser 2: what an interesting man

 

One hit KO: i know, right?

 

 


 

 

Mr harrington please stop sending memes challenge

 

Avril lavigne: WHY IS TONY STARK ON OUR BUS

 

Avril lavigne: PETER

 

tungsten dioxide whats this: owo?

 

Avril lavigne: DR TONY STARK??? IRON MAN??? SITTING ON OUR BUS WITH A DOG???

 

tungsten dioxide whats this: oh

 

Avril lavigne: yeah OH

 

tungsten dioxide whats this: thats my cousin ed

 

President lincoln: 

 

President lincoln: peter what

 

tungsten dioxide whats this: ed. my cousin. 

 

tungsten dioxide whats this: hes visiting and agreed to chaperone for us

 

tungsten dioxide whats this: very nice of him, wasn’t it?

 

Murphy’s law: peter that is clearly tony stark

 

nedleedle: uhm why would tony stark be sitting on a schoolbus?

 

The News(™): i dont know PETER why is he????

 

tungsten dioxide whats this: hes not

 

tungsten dioxide whats this: my cousin ed on the other hand

 

avril lavigne i am going to beat you to death

 

tungsten dioxide whats this: right in front of my cousin??? rude

 

President lincoln: you know what?

 

President lincoln: i cant deal with this

 

The News(™): what does ed do for work??

 

tungsten dioxide whats this: hes a mechanic :)

 

The News(™):

 

The News(™): a mechanic?

 

The News(™): does he perhaps

 

The News(™): build stuff

 

tungsten dioxide whats this: sometimes, i suppose

 

The News(™): like, maybe, a fancy metal suit?

 

tungsten dioxide whats this: hmmmm

 

tungsten dioxide whats this: no that doesn't sound right

 

moonmoon: FUCK FUCK FUCK FUCK

 

moonmoon: EVERYONE GET ON THE BUS

 

moonmoon: PETER GO SIT IN THE VERY BACK

 

Avril lavigne: what wrong????

 

moonmoon: IM PULLING UP TO THE SCHOOL AND FLASH IS IN THE CAR BEHIND ME

 

nedleedle: FUCK

 

Murphy’s law: how the hell did he find out about this????

 

mr harrington: he didn’t hear it from me.

 

The News(™): ok icon but

 

The News(™): peter go sit in the very back with ned

 

The News(™): everyone else but cindy is here and we’ll fill out the surrounding seats so he won’t be anywhere near you

 

tungsten dioxide whats this: you guys dont have to do that

 

tungsten dioxide whats this: ill be fine

 

nedleedle: if flash so even looks at you im going to paint the bus red with his blood

 

tungsten dioxide whats this: 0-0

 

Murphy’s law: damn

 

Murphy’s law: we stan a protective husband

 

President lincoln: ok charles and i have the seat in front of peter and ned

 

Avril lavigne: im across the aisle from them, saving a seat for cindy <3

 

moonmoon: <3

 

The News(™): im in front of charles and abe

 

Scary Captain: ill sit next to you, betty, if you don't mind

 

The News(™): not at all

 

moonmoon: ok!!! Im here

 

moonmoon: hey is that tony stark

 

tungsten dioxide whats this: nope

 

tungsten dioxide whats this: whos tony stark

 

moonmoon: ok

 

 


 

 

We had a bonding moment!! I cradled you in my arms!!!

 

Father of Five: hey that little shitheel transphobic kid just showed up on the bus

 

crack dealer: say the word and i’ll order a missile strike

 

Father of Five: you can do that???

 

crack dealer: unquestioned, yes

 

Father of Five: comforting

 

Father of Five: what are you doing while i’m out?

 

crack dealer: bucky and i are seeing how many grapes i can fit in my mouth

 

crack dealer: we’re at 24

 

Father of Five: have fun

 

Father of Five: please don’t destroy my company and or tower

 

crack dealer: i only promise to try

 

 


 

 

Mr harrington please stop sending memes challenge

 

moonmoon: hes here

 

nedleedle: god i forgot how ugly he was :/

 

The News(™): PFT–

 

Scary Captain: ok hes sitting across from me and betty

 

Scary Captain: he gets the entire seat to himself and he looks so smug about it

 

moonmoon: im right behind him. I could start kicking his seat

 

Avril lavigne: do it

 

mr harrington: i’d prefer if you didn’t, cindy.

 

President lincoln: MR HARRIGTON IS SITTING NEXT TO FLASH

 

Murphy’s law: HA

 

The News(™): flash is pushed up against the window—

 

Scary Captain: aw, he looks so miserable :)

 

President lincoln: peter’s cousin ed, who is a mechanic, is petting the giant wolf dog like a bond villain with a cat

 

tungsten dioxide whats this: hes like that dont worry

 

moonmoon: hey, wait

 

moonmoon: isnt that the dog from the girlboss, gaslight, gatekeep video you sent us?

 

tungsten dioxide whats this: yep!

 

tungsten dioxide whats this: that’s lea, she’s pj’s dog

 

Murphy’s law:

 

Murphy’s law: pj’s?

 

President lincoln: (͠≖ ͜ʖ͠≖)

 

tungsten dioxide whats this: stop

 

Avril lavigne: why does your cousin ed, who is a mechanic, have tony stark’s illegitimate brother’s dog?

 

The News(™): yeah why DOES he

 

tungsten dioxide whats this: oh, i just asked if i could take her

 

nedleedle: yeah, in case we have problems putting up tents

 

nedleedle: shes great at it

 

Scary Captain: its true. Ive seen it. 

 

moonmoon: i dont even know what to say anymore

 

Scary Captain: well, buckle up

 

Scary Captain: because we’ve got almost five hours of driving to go

 

moonmoon: oh god

 

 


 

 

tony stark's murder friends

 

court jester: hey where are you

 

45 grapes: saying hi to the SI people

 

45 grapes: the interns are fun

 

45 grapes: i get to judge their dance offs

 

court jester: ooh fun

 

court jester: do you think i could eat an entire raw onion?

 

court jester: and i found something in the pantry called easy cheese?

 

45 grapes: IM ON MY WAY

Notes:

flash is here. boooo!!!! hissss!!!!!

percy isn't the trip chaperone, sorry. 'twas tony

mr harrington is an icon

percy, commander of SWORD: i have the power of god (my mom) and anime (the government) on my side!!!

want to know what suit size the axeman of new orleans wore? follow me on insta @beansofdenim
(theres also character art too, but i mean. whatever.)

plumbing baby. goodbye.

Chapter 25: camping trip

Notes:

(See the end of the chapter for notes.)

Chapter Text

SSEA

 

Tony Stank: teenagers scare the living shit out of me

 

skrunkly raccoon: pack it up mcr stan 🙄

 

Tony Stank: excuse me

 

Tony Stank: listen man i dont have time for this peter and his little friends are going apeshit

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ:  oh worm?

 

Tony Stank: [Video Description: Tony is sitting in a foldable camping chair, wearing a pair of sunglasses and sipping from a Capri Sun. He flips the camera around to show a forest clearing, the AcDec kids standing, huddled shoulder to shoulder in a circle in the middle.]

 

Tony Stank: i dont know what the fuck they’re talking about and i dont want to know either

 

Tony Stank: ignorance is bliss and theres a five hour energy in this capri sun

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: oh wow

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: enjoy that i guess

 

skrunkly raccoon: yeah good luck

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: is lea enjoying herself?

 

Tony Stank: i think?

 

Tony Stank: she climbed a tree

 

Tony Stank: i didnt even know dogs could do that

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: they cant

 

Tony Stank: oh

 

 


 

 

robert <3

 

aspen <3: why is bts playing

 

Local milf: ?

 

aspen <3: why has all my music been replaced with bts, the cats soundtrack, and one episode of a podcast about mesopotamian farming practices

 

aspen <3: where are my fucking playlists

 

class traitor: lmao

 

aspen <3: YOU

 

egg: oh no

 

certified monster fucker: dan why would you do this

 

class traitor: did you guys know that aspen has ten hours of mcr songs downloaded

 

egg: i-

 

egg: aspen

 

aspen <3: WELL I MOST CERTAINLY DON'T ANY MORE

 

local milf: aspen is on the floor

 

aspen <3: DO YOU KNOW HOW LONG IT TOOK ME TO DOWNLOAD ALL OF THAT??

 

local milf: i think they’re crying

 

aspen <3: AND I HAD IT ALL ORGANIZED TOO

 

local milf: yep those are definitely tears

 

egg: dan my man

 

egg: why would you commit such a heinous crime

 

aspen <3: IVE DONE NOTHING TO YOU

 

class traitor: literally yesterday you invited me to your house for dinner and when i arrived you knocked me out with a kitchen aid and when i woke up i was covered in panko breadcrumbs and grated zucchini while mambo no.5 was playing on loop outside the closet you locked me in

 

aspen <3: oh right lmao

 

aspen <3: i did do that

 

local milf: aspen…

 

aspen <3: but this means war, daniel. 

 

class traitor: kiss my ass

 

class traitor: you probably can't reach that high, on second thought

 

aspen <3: lee?

 

thor understudy: what

 

aspen <3: you with dan?

 

thor understudy: yeah he asked to film me eating that raw potato i found that looks like elvis presley

 

aspen <3: tell him i will be searching for him. 

 

thor understudy: mk

 

egg: im suddenly terrified

 

aspen <3 good

 

aspen <3 im 5 feet tall and the idea of self control is foreign to me

 

supreme overlord jackson: if you damage the building, you’ll regret it

 

aspen <3: understood, i will find a way around property damage

 

 


 

 

Tony Stank: the children are gone

 

Tony Stank: i texted peter asking where he was but i heard the buzzing real close by so i looked to my left and turns out the kids left their phones in a pile with a note that says they’re abandoning modern technology to return to their monkey roots

 

skrunkly raccoon: interesting

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: oh thank the gods

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: teenagers all go through a go feral and run into the woods phase

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ:  we’ve all been there

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: honestly i was getting a little worried that peter hadn't yet

 

Tony Stank: your family needs to undergo some sort of case study

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: its best that we dont

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: for the psychiatrists sake

 

Tony Stank: one of the children just wandered by, covered head to toe and leaves and sticks

 

Tony Stank: i feel unsafe

 

Tony Stank: if i start videoing this and get murdered on film will you show it to the police

 

skrunkly raccoon: probably not

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: unlikely

 

Tony Stank: wow

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ:  we’ll buy and dedicate a applebees to you though

 

Tony Stank: acceptable

 

Tony Stank: [Video description: He’s still sitting in a lawn chair, drinking a capri sun. This one is different, though, as shown by the small pile of empty juice pouches under his feet. Something moves in the background, and he slowly swivels around. 

 

Cindy, covered head to toe in various plant matter, is crouched a few feet away from him. 

 

“What are you doing?” Tony whispers. 

 

The girl stares at him for a long time. “Why do you have an arc reactor in your chest, Peter’s cousin Ed, who is a mechanic?”

 

It’s silent for a long moment. Finally, Tony says, “I’m a big Iron Man fan.” 

 

The girl nods. 

 

“Now you answer my question.” Tony prods. 

 

“Hunting for food.” 

 

Tony slowly points to the cooler five feet away from him. “There’s tin foil wrapped sandwiches right there.” 

 

She shakes her head. “We crave a fresh kill.” 

 

“Alright, kiddo.”]

 

skrunkly raccoon: aw, they’re learning to provide for themselves

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: reminds me of my camp counselor days

 

Tony Stank: who on earth let you be a camp counselor

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: my sixth grade latin teacher who armed me to kill my math teacher

 

Tony Stank: one day im going to learn to stop asking questions

 

Tony Stank: oh my god

 

Tony Stank: they’re building a fire

 

Tony Stank: its huge

 

 


 

 

robert <3

 

class traitor: really, aspen?

 

Local milf: what?

 

class traitor: you put a fake spider in my lunch

 

class traitor: how more basic can you get

 

class traitor: you talk a big game for someone who gets their pranks from a fucking wikipedia article

 

egg: damn

 

class traitor: SHIT

 

certified monster fucker: not a fake spider?

 

aspen <3: not a fake spider :)

 

class traitor: what the FUCK

 

class traitor: this thing is HUGE???

 

certified monster fucker: thats what she said lmao

 

thor understudy: no, it really wasnt

 

egg: PFFT–

 

certified monster fucker: hey man what the fuck

 

thor understudy: i heard spider. where is it. 

 

class traitor: ITS MENACING ME FROM THE BREAK ROOM

 

thor understudy: omw

 

 


 

 

SSEA

 

Tony Stank: [Video description: The kids are back in the clearing, standing in a circle around the bonfire, which is upwards of six feet tall. Mrs. O’Leary is there, too, sitting regally in the grass. 

 

“Peter,” Tony says cautiously, “You good, bud?”

 

After a beat, Peter turns away from the fire to look at Tony. There’s smudges of paint on his face. “Peachy.”

 

“What’s with the fire, Underoos? And the face paint?”

 

“To show my allegiance,” Peter gestures to his face. He then turns back to the fire. “This? This is for advancement as a society.”]

 

Tony Stank: alright peter gave up the opportunity to say the bonfire was just his hot mixtape and/or burning desire for optimus prime something is really wrong

 

skrunkly raccoon: he looks fine to me

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: me too

 

Tony Stank: you’re a little bitch, percy

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: :)

 

 


 

 

We had a bonding moment!!! I cradled you in my arms!!

 

Father of Five: fri did describe the videos for you though right

 

crack dealer: 👍

 

 


 

 

SSEA

 

Tony Stank: [Video description: Once again, the camera is pointed at the kids huddled around the fire.

 

“Peter, you sure you’re alright? You’re acting a bit off.” 

 

He waves off Tony. “It’s just the starvation getting to me. Once Cindy and Charles return with that bear he was having a rematch with, we will be fed.” 

 

“Pete, kiddo, you literally ate seven packages of sliced deli ham with your bare hands on the bus, not even an hour ago.” 

 

“Oh.” Peter squints. “Must be the blood loss, then.” He nods, accepting his own explanation. 

 

“The WHAT–” ]

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i stand by the fact that they’ll be fine

 

skrunkly racoon: me as well

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i spent three months eating raw deer in a forest with a wolf pack and it bettered me as a person

 

Tony Stank: no, it just made you bark at passing cars

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: :/ youre joking but i have a cousin who actually does that

 

Tony Stank: of course you do. 

 

 


 

 

robert <3

 

class traitor: LEE JUST FUCKING CAME INGTO THE BREAK ROONM AND SCOOPED UP THE SPDUER EWITH HTEIR BARE HANDS

 

Local milf: oh god not again

 

Local milf: lee you need to stop with the spiders

 

thor understudy: i will not.

 

class traitor: STOP HOLDING THE SPIDER UP CLOSE TO YOUR FACE 

 

thor understudy: oh relax you big baby

 

thor understudy: its a brazilian wandering spider. they bite without venom sometimes

 

thor understudy: this is a really cute one, too. they’re rare to find out of south and central america. where on earth did you get her, aspen?

 

aspen <3: i know a guy

 

thor understudy: amazing. 

 

thor understudy: oh, wow! she’s pregnant!

 

class traitor: WHAT

 

Local milf: NO

 

egg: ive never been more scared

 

thor understudy: luckily, i have a spare terrarium that will be perfect for her! commander, do you mind if i take my lunch break early to go take her somewhere safe?

 

Supreme overlord jackson: go ahead

 

thor understudy: ill be back soon!

 

certified monster fucker:

 

egg:

 

local milf: ok that was horrifying

 

certified monster fucker: but thats also the most we’ve ever seen lee smile?

 

local milf: mhm

 

 


 

 

SSEA

 

Tony Stank: i shouldve stayed home

 

Tony Stank: charles got a scratch fighting the bear(???????????) and now they tied him to a tree with their sweaters in case he goes rabid

 

skrunkly raccoon: hes a man now

 

skrunkly raccoon: yknow i fought a bear once in the siberian wilderness

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: oh, really? how’d it go?

 

skrunkly racoon: bit it

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: sick

 

Tony Stank: 

 

Tony Stank: 

 

Tony Stank: oh my god i just remembered there are, in fact, nine kids and not eight. 

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: is the thompson kid really a human being though

 

Tony Stank: hm. Fair.

 

Tony Stank: either way they just pulled out a rope they made of pipe cleaners and tree bark and have tied him up and are dangling him over the fire as a sacrifice to mrs. o’leary

 

Tony Stank: percy you have experience with children

 

Tony Stank: should i do something?

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: nah 

 

( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: let the bitch burn

 

Tony Stank: not about that, about the fact that they abandoned their humanity so easily

 

Tony Stank: percy they’re chanting now

 

Tony Stank: percy

 

Tony Stank: percy please

 

Tony Stank: theyre dancing around the fire

 

Tony Stank: percy

Notes:

YES tony's long silence is him thinking 'damn these bitches perfect for eachother, huh'

aspen <3 mcr
lee <3 spiders

lee and peter should probably never meet

charles did defeat the bear btw

want to know the secrets of the printing press? follow me @beansofdenim on insta

plumbing baby. goodbye.

Chapter 26: improved furby

Notes:

(See the end of the chapter for notes.)

Chapter Text

 

SSEA

 

[skrunkly raccoon has changed ( ̿ ̿▀‿▀)▬▬ι═══════ﺤ’s nickname to ‘percenary’]

 


 

Tony Stank: barnes what the fuck

 

Tony Stank: i get you might be up late but TWO IN THE FUCKING MORNING and this is what you do??

 

skrunkly raccoon: i thought it was funny

 

baby avenger: and you were right lmao

 

percenary: hhgrdwha

 

gitc: hello??

 

Tony Stank: give him a minute

 

percenary: h3eowd

 

percenary: mmmok

 

percenary: good morninf

 

baby avenger: its like almost noon

 

percenary: i said what i said

 

skrunkly raccoon: let the man have his rest

 

percenary: thank you JAMES

 

percenary: <3

 

skrunkly raccoon:

 

skrunkly raccoon: <3

 

baby avenger: aw

 

baby avenger: but why were you in bed so late??

 

percenary: sleeby

 

percenary: was up late

 

baby avenger: ah

 

Tony Stank: doing what?????

 

percenary: my cousins were roleplaying founding fathers again

 

gitc: AGAIN???

 

percenary: again

 

percenary: and they always make me be there to rate their performance

 

Tony Stank: jesus

 

percenary: no hes not invited just me

 

percenary: also james did you Get Sufficient Rest?

 

skrunkly raccoon: oh yeah i woke up in a cold sweat, changed your nickname, then went right back to sleep

 

mindiana jones: inch resting

 

gitc: hey, wait

 

gitc: why is sergeant barnes the admin?

 

Tony Stank: well

 

Tony Stank: peter can’t be trusted with naming abilities

 

baby avenger: :(

 

Tony Stank: michelle would probably just kick everyone out

 

mindiana jones: shrug

 

Tony Stank: i know myself. i’d do on a power trip and be a ruthless dictator

 

Tony Stank: and percy is too technologically illiterate that even Fri couldn’t help him run a chat

 

percenary: too many buttons

 

Tony Stank: so. barnes

 

skrunkly raccoon: good to know i only received my throne via process of elimination

 


 

mr harrington please stop sending memes challenge

 

moonmoon: FUCK FUCK FUCK

 

moonmoon: I FORGOT TO DO MY MATH ASSIGNMENT

 

president lincoln: lmao charles is doing mine

 

murphy’s law: charles is NOT fuck you

 

president lincoln: consider: please?

 

murphy’s law: 

 

murphy’s law: 

 

murphy’s law: 

 

murphy’s law: ᶠᶦⁿᵉ

 

The News(™): charles you are pathetic

 

moonmoon: not the time!! i am in distress!!

 

moonmoon: this assignment is worth so many points

 

avril lavigne: why don’t you just get charles to do it lmao

 

murphy’s law: why don't you go get some bitches????

 

avril lavigne:

 

 

The News(™): oh sis really went off huh

 

nedleedle: snapped

 

Scary Captain: sally has absolutely NO hoes

 

avril lavigne: MJ?????

 

tungsten dioxide whats this: maybe cindy can calculate you some bitches while she’s doing that assignment

 

avril lavigne: P E T E R ? ? ? ? ? ? 

 


 

mj and the dumbass

 

mj: fantastic coordination

 

the dumbass: :D

 


 

SSEA

 

Tony Stank: whoever left a puddle on the kitchen floor needs to fess up

 

gitc: oh worm?

 

percenary: he slipped and ate shit on the way to the fridge lmao

 

Tony Stank: you little bitch YOU KNEW THE WATER WAS THERE

 

percenary: mhm

 

Tony Stank: i hate you so much

 

Tony Stank: im going to eat the jello you left in the pantry

 

percenary: IF YOU SO MUCH AS LAY A SINGLE FINGER ON MY JELLO STASH I WILL EXECUTE YOU

 

mindiana jones: o-o

 

percenary: I PUT UP WITH A LOT OF SHIT

 

percenary: THIS IS WHERE I DRAW THE FUCKING LINE

 

baby avenger: 0.0

 

percenary: I HEAR YOU OPENING THE WRAPPER

 

percenary: YOU'RE A DEAD MAN STARK

 

skrunkly raccoon: rip anthony edward stark, avenger, inventor, and father

 

skrunkly raccoon: he will be missed but not forgotten

 

baby avenger: mother FUCKER

 

baby avenger: THIRD TIME

 

gitc: what?

 

baby avenger: loss of father figure number strike three

 

baby avenger: does this mean im out??

 

gitc: HJDFBDJKSF PETER

 


 

our family tree is a wreath

 

pied piper: so, completely hypothetically

 

pied piper: how would someone hire an assassin?

 

pied piper: specifically me

 

has a buzzfeed unsolved episode: you tell me who you want dead and why and if it’s a good enough reason i do it for free

 

pied piper: oh worm

 

pied piper: sometimes i forget my silly goofy friend is an assassin

 

has a buzzfeed unsolved episode: first off, im a mercenary, not an assassin

 

has a buzzfeed unsolved episode: assassins typically do stuff for political reasons, and mercenaries are military or ex-military

 

mcshizzle: you served in the military?????

 

has a buzzfeed unsolved episode: three months in the argentine navy under a fake name

 

has a buzzfeed unsolved episode: i also like to think the legion most definitely counts

 

mcshizzle: oh right

 

has a buzzfeed unsolved episode: and second, EX mercenary, thank you very much

 

horse girl: why do you want someone dead, piper?

 

pied piper: thank you for asking hazel

 

pied piper: so im in court right

 

framk: oh gods for a second i forgot you were a lawyer and i was about to start asking how much bail is

 

pied piper: thank you frank but even if i do get arrested, dont worry about bail, percy and his big three dream team will break me out <3

 

has a buzzfeed unsolved episode: <3

 

pied piper: anyways im doing my thing, defending a child

 

pied piper: and this other lawyer is being a little BITCH

 

pied piper: not even in a lawyer way. just being a right piece of shit. 

 

pied piper: he was arguing that putting the kid through conversion therapy isn’t abuse???

 

sparky: he w h a t

 

has a buzzfeed unsolved episode: i can have his body hanging in front of the courthouse in an hour

 

pied piper: <3 thank you friendly murder man

 

mcshizzle: since we’re doing hypotheticals

 

mcshizzle: i hypothetically have made something i call Improved Furby

 

my chemical ron weasley: NO NO NO NO NO

 

sparky: LEO WHY

 

mcshizzle: I WAS BORED

 

horse girl: wait how is this hypothetical? 

 

mcshizzle: here comes the hypothetical part

 

mcshizzle: hypothetically, lets say, i, oh, i dont know, wanted to improve its stealth and now it’s invisible and also on the run

 

horse girl: n o 

 

framk: leo where are you

 

mcshizzle: bunker nine

 

framk: oh im in california thank god

 

framk: good luck to the rest of you though

 

pied piper: INVISIBLE STEALTH FURBY???

 

pied piper: leo that better be it

 

mcshizzle: 

 

mcshizzle: it…may….have….AI

 

sparky: WHAT

 

my chemical ron weasley: leo do you want us all dead

 

mcshizzle: no just frank

 

framk: <3

 

pied piper: and he’s the only one who’s out of state

 

pied piper: congrats you dumb bitch

 

mcshizzle: i recruited the ares and hermes cabins to try and help me catch it

 

sparky: ill help too. the sooner we get that thing out of camp the better

 

mcshizzle: gods bless you jason

 


 

sparky: ITS SO FUCKING FAST

 

sparky: I WAS SO SURE I HAD IT

 

mcshizzle: yeah hes a zoomy little guy

 

mcshizzle: and i cant deactivate its camouflage mode

 

my chemical ron weasley: i hate you so much

 

mcshizzle: im sorry!!

 

mcshizzle: on the bright side everyone is running around grabbing at air and its very funny looking

 

sparky: HOW AM I SUPPOSED TO CATCH IT

 

sparky: I CANT FUCKING SEE IT

 

has a buzzfeed unsolved episode: wow jason that must be so hard for you i cant imagine :( sending thoughts and prayers

 

sparky: NOT the time percy

 

sparky: 

 

mcshizzle: 

 

RARA: you guys are all idiots

 

RARA: except hazel and percy

 

horse girl: :)

 

has a buzzfeed unsolved episode: :)

 

mcshizzle: perce

 

mcshizzle: my man

 

sparky: my bro

 

sparky: light of my life

 

sparky: will you please come to camp and geT THIS FUCKING INVISIBLE FURBY

 

has a buzzfeed unsolved episode: took you long enough

 

has a buzzfeed unsolved episode: ill be there in ten

 


 

mcshizzle: [Video Attachment: Percy is standing in the middle of the cabins, perfectly still. He doesn’t even look like he’s breathing. Then, suddenly, he lunges forward and hits the ground, arms wrapped around something invisible. He tightens his grip against the struggling creature, holding until movement ceases. ]

 

mcshizzle: gods bless

 

sparky: our lord and savior

 

[my chemical ron weasley has changed has a buzzfeed unsolved episode’s nickname to ‘furby slayer’]

 

furby slayer: you guys would all be taken out by a mildly dark room

 

furby slayer: except hazel obviously

 

mcshizzle: hey man not everyone can be a fucking bat

 

mcshizzle: dolphin sonar having ass

 

sparky: meh

 

sparky: you’d save me anyways right bro <3

 

furby slayer: ofc bro <3

 

RARA: nasty

 

RARA: gwen asked who i was texting and i had to tell her i was in a chat with my girlfriend piper and my boyfriend jason and jason’s husband percy and percy’s little siblings nico and hazel, and hazel’s boyfriend frank and frank’s boyfriend leo

 

furby slayer: :)

 

pied piper: you love us

 

RARA: correction: i love hazel, tolerate you and jason, respect percy, and think nico is a case study at best

 

furby slayer: the two of you literally went to chuck e cheese last week

 

RARA: and i was taking notes the entire time

 

my chemical ron weasley: percy how the fuck did you know that

 

furby slayer: oh nico

 

furby slayer: you know better than to be asking questions

 

my chemical ron weasley: 

 

Notes:

happy gay wrath month everyone

also: june 22 marked my one year anniversary on ao3!! ive gotten so much support and grown so much in this past year, and i love all you stinky bitches <3 have an extra long chapter

shoutout to Tabaxi_Power for the amazing percenary pun. thank you for enlightening me with it.

plumbing baby. goodbye.

Chapter 27: fake dating trope time

Notes:

(See the end of the chapter for notes.)

Chapter Text

robert <3

 

class traitor: MAL?????????

 

egg: owo?

 

class traitor: WAS THAT YOU I JUST SAW????

 

egg: no

 

class traitor: oh

 

class traitor: sorry

 

class traitor: HEY WAIT

 

class traitor: I SEE THE KOOLAID MAN ASPEN DREW ON THE BACK OF YOUR ELBOW EARLIER

 

egg: the what

 

egg: ASPEN

 

aspen <3: :)

 

local milf: wait dan did you get sidetracked or?

 

class traitor: no!! im at the party city picking up the balloons for your cousin like you asked

 

class traitor: and mal is here

 

certified monster fucker: why is mal buying balloons

 

class traitor: shes not

 

class traitor: she’s standing behind the counter with a uniform and badge

 

class traitor: she gave me a discount on the streamers

 

aspen <3: mal did you beat up a party city employee and steal their clothes

 

egg: no

 

egg: i work here

 

egg: im the manager

 

certified monster fucker: wh

 

certified monster fucker: but

 

certified monster fucker: h?????

 

thor understudy: you broke ross

 

certified monster fucker: YOU HAVE A FULL TIME JOB AS A GOVERNMENT AGENT

 

certified monster fucker: WHY AND HOW DO YOU HAVE A JOB AT PARTY CITY

egg: hey man ive been managing this establishment for seven years

 

egg: just because i got a new job doesn't mean i was going to quit on my fellow party personnel

 

certified monster fucker: ????????????????????

 

certified monster fucker: is this where you go during all those bathroom breaks

 

egg: yeah

 

certified monster fucker: im gonna 

 

certified monster fucker: fucking

 

certified monster fucker: fjregbqrjkebgfkjagvhjrebgvhqu

 

aspen <3: why are we exposing mal

 

aspen <3: ross you literally have a list of senators to seduce

 

aspen <3: mal’s well-run party city does not even compare to that

 

certified monster fucker: ive made progress on that list, ill have you know

 

certified monster fucker: significant progress ;)

 

certified monster fucker: and at least im not DAN

 

class traitor: bruh???

 

certified monster fucker: ive seen your fucking tramp stamp

 

local milf: his WHAT

 

certified monster fucker: he has his ex’s name tattooed on his back 

 

local milf:

 

local milf: wow

 

class traitor: WHAT THE HELL MAN 

 

class traitor: I TOLD YOU THAT IN CONFIDENCE 

 

class traitor: and my tramp stamp is better than ASPENS FUCKING SLEEP COOKING

 

egg: sleep COOKING???

 

aspen <3: i make pasta in my sleep

 

class traitor: no, you BURN pasta in your sleep

 

class traitor: ive showed up at your house to put out fires like a dozen times

 

aspen <3: ¯\_(ツ)_/¯

 

aspen <3: and ill take my fucking burnt ass pasta over lee’s fucking LA CRIOXS 

 

egg: :o

 

certified monster fucker: la croixs????? L e e

 

thor understudy: will not apologize for liking the bubble

 

thor understudy: and bridgette once got pulled over for speeding and she beatboxed until the cop was so impressed he let her go

 

class traitor: she can beatbox??????

 

thor understudy: she can not. but he appreciated the tenacity. 

 

egg: i would say its time to expose jackson but we have nothing on that man

 

Supreme overlord jackson: in the name of team bonding, i will offer up a fact about myself

 

local milf: !!!!!!!

 

class traitor: oh god its happening

 

certified monster fucker: everyone get ready

 

Supreme overlord jackson: ive been to jail over fifteen times. they haven’t built a cell that can hold me yet, and i doubt they ever will. 

 

egg: 

 

aspen <3: 

 

class traitor: ʷʰᵃᵗ ᵗʰᵉ ᶠᵘᶜᵏ

 


 

mr harrington please stop sending memes challenge

 

moonmoon: spider-man hot

 

tungsten dioxide whats this: why would you start the day like this

 

president lincoln: why are you booing her??? Shes right

 

president lincoln: have you seen those ARMS????

 

murphy’s law: AMEN

 

nedleedle: you guys just like him for his arms?

 

The News(™): UM NO??

The News(™): boy have you seen those thighs???

 

avril lavigne: i’d let him choke me out with those

 


 

The Boys

 

strawbebby: fuck you you instigating little bitch

 

none pizza left beef: 🥰

 


 

mr harrington please stop sending memes challenge

 

nedleedle: idk. peters just not really a spider-man fan

 

tungsten dioxide whats this: ned leeds i am going to kill you

 

moonmoon: peter are you BLIND

 

moonmoon: he’s built as hell and he’s also so nice???? he saved our class like multiple times

 

The News(™): hey wait

 

The News(™): peter wasn’t actually there for any of those times

 

president lincoln: wait yeah

 

president lincoln: thats….really weird

 


 

 

The Boys

 

strawbebby: NED

 

none pizza left beef: f u c k

 

none pizza left beef: wait a sec

 

none pizza left beef: i got this

 

none pizza left beef: time to channel my inner percy jackson

 

strawbebby: FOR THE LOVE OF GOD NO

 


 

mr harrington please stop sending memes challenge

 

nedleedle: peter, didn’t you meet him???

 

nedleedle: at the internship

 

avril lavigne: GASP

 

avril lavigne: I TOTALLY FORGOT SPIDERMAN AND IRON MAN WERE BUDDIES

 

murphy’s law: PETER HAVE YOU MET HIM???????

 

tungsten dioxide whats this: uh

 

The News(™): THAT SILENCE MEANS YES

 

moonmonn: he’s met him and doesn’t like him? Cap.

 

president lincoln: why would peter lie???

 

president lincoln: oh my god

 

president lincoln: unless

 

The News(™): ABE I AM PICKING UP EXACTLY WHAT YOU ARE PUTTING DOWN

 

The News(™): PETER REALLY LIKES SPIDERMAN

 

The News(™): like….really likes him ( ͡°👅 ͡°)

 

tungsten dioxide whats this: NO

tungsten dioxide whats this: NO NO NO

 

moonmoon: if not true…why panic??

 

mindiana jones: peter has a crush on spider-man?

 

mindiana jones: makes sense

 

 nedleedle: !!!!!

 

nedleedle: you know peter has been disappearing a lot recently

 

nedleedle: and it matches up with every time spider-man’s been active near here 👀

 


 

Judas!!! No!!!

 

One Hit KO: WHAT ARE YOU PEOPLE DOING



One Hit KO: STOP

 


 

mr harrington please stop sending memes challenge

 

moonmoon: holy fuck

 

moonmoon: peter do you skip class to go watch spider-man

 

Murphy’s law: he does carry that camera around a lot 

 

mindiana jones: now that i think of it, he never does show me his photos

 


 

Judas!!! No!!!

 

One Hit KO: YOU FAKE BITCH I SHOW YOU THEM ALL THE TIME

 


 

Rowdy Boys

 

Small™: PERCY HELP

 

Small™: THE GROUP CHAT IS MAKING IT SEEM LIKE IM IN LOVE WITH SPIDERMAN AND MJ AND NED ARE HELPING THEM

 

jalapeno eating king: gods i love this generation

 


 

mr harrington please stop sending memes challenge

 

president lincoln: has he met him more than once at the internship???

 

nedleedle: now that i think about it

 

nedleedle: he gets real shifty about it sometimes when i ask what he does some days

 

avril lavigne: h o l y s h i t

 


 

Rowdy Boys: 

 

Small™: percy please

 

jalapeno eating king: alright kid

 

jalapeno eating king: im gonna level with you

 

jalapeno eating king: theres no getting out of this one

 

Small™: im sobbing

 

jalapeno eating king: that leaves only one option

 

Small™: ignore it until it goes away and they drop it?

 

jalapeno eating king: what?

 

jalapeno eating king: no

 

jalapeno eating king: lean into it. confirm you and spider-man are an item. make THEM regret this. turn the tables. 

 

Small™: are you telling me to invent a fake relationship between me and my alter ego

 

jalapeno eating king: absolutely. think of how funny it’ll be

 

Small™: you’re incredible. thank you. 

 


 

mr harrington please stop sending memes challenge

 

tungsten dioxide whats this: please stop guys

 

tungsten dioxide whats this: ill tell you the truth

 

tungsten dioxide whats this: just. Stop

 


 

Judas!!! No!!!

 

not a loser: peter?

 

Loser 2: dude what are you doing

 


 

mr harrington please stop sending memes challenge

 

tungsten dioxide whats this: im dating spider-man.

Notes:

i decided to expose every single sword member, just a little, as a treat

acdec kids got all the right numbers but came up with the wrong answer

percy being a chaotic nuetral influence on them is something that can be so personal-

not pictured: bucky frantically concered as to why percy is suddenly laughing so hard he can't breath

plumbing baby. goodbye.

Chapter 28: liquid soap

Notes:

warning!!! spoilers for up to chapter 39 of the lost soldiers!!

(See the end of the chapter for more notes.)

Chapter Text

mr harrington please stop sending memes challenge

 

The News(™): well

 

The News(™): we haven't used this in forever

 

President lincoln: yeah no shit

 

President lincoln: how are you guys?

 

murphy’s law: peachy.

 

moonmoon: still concussed 🤪

 

avril lavigne: yikes

 

moonmoon: yeah i definitely should not be on my phone but whatever

 

moonmoon: ive been playing papas freezeria for hours

 

The News(™): …are we really not going to talk about it?

 

Murphy’s law: well no

 

avril lavigne: wasn't planning on it

 

President lincoln: doesnt sound very fun

 

The News(™): 

 

The New(™): fuck this im sorry

 

The News(™): PETER I CANT FUCKING BELIEVE YOU

 

moonmoon: betty what the hell

 

moonmoon: none of what happened was his fault

 

Murphy’s law: yeah what the fuck betty

 

The News(™): what?

 

The News(™): oh my god no thats not what im talking about

 

The News(™): i MEAN

 

The News(™): I GRILLED HIM FOR HOURS ON WHAT DATING SPIDER-MAN WAS LIKE

 

The News(™): HE ANSWERED ALL MY QUESTIONS

 

The News(™): AND I MEAN A L L OF THEM

 

tungsten dioxide whats this: hey man, i just finished what you people started

 

murphy’s law: oh holy shit

 

murphy’s law: NED AND MJ

 

murphy’s law: THEY KNEW

 

Scary Captain: of course we did, peter is terrible at keeping stuff from us

 

moonmoon: YOU LET US BE SO INVESTED IN THEIR RELATIONSHIP

 

moonmoon: NED WAS TEXTING ME, SHADING SPIDERMAN WHEN HE WAS ON THE NEWS FIGHTING CRIME FOR “DITCHING PETER”

 

avril lavigne: I SPENT HOURS DRAWING SPIDEYPARKER FANART

 

avril lavigne: ARE YOU FUCKING KIDDING ME

 

President lincoln: all that fucking photoshop work

 

President lincoln: ALL THAT WORK TO MAKE FAN EDITS OF THEM

 

President lincoln: YOU'RE A PIECE OF SHIT, JONES

 

Scary Captain: not my fault you guys are weird

 

nedleedle: yeah im going to have to agree and say this is all on you guys

 

murphy’s law: oh mg fogrefd

 

murphy’s law: remember these?

 

murphy’s law:

avril lavigne: peter you couldn't lie to save your life

 

murphy’s law: 

murphy’s law: dude you cant keep anything a secret

 

murphy’s law: 

avril lavigne: even though you couldnt keep a secret if your life depended on it

 

The News(™): oh lord

 

The News(™): im going through the entire chat history

 

The News(™): so much makes sense now

 

The News(™): that time you skipped out on acdec practice because you said you forgot to walk your fish???

 

tungsten dioxide whats this: fighting lizard man in the streets

 

moonmoon: when you said you needed to leave because you left your oven on when we all KNOW you cant cook?

 

tungsten dioxide whats this: bänk røbbery

 

moonmoon: jesus

 

President lincoln: three weeks ago when you came to class late because you said you needed to prune your apple tree? 

 

tungsten dioxide whats this: was getting thrown through concrete walls by some guy with a mohawk and super strength

 

moonmoon: your excuses are absolute ass how did we not see this

 

tungsten dioxide whats this: stupid

 

moonmoon: >:0

 

Murphy’s law: last christmas??? You disappeared after lunch????

 

tungsten dioxide whats this: taking nap in vents

 

tungsten dioxide whats this: i get sleepy sometimes

 

avril lavigne: what about last spring when you supposedly caught the flu in the middle of may?

 

tungsten dioxide whats this: raiding a hydra base with the boys 💯💪 🙏🔥 the grind never stops

 

moonmoon: ive decided i hate this, actually

 

murphy’s law: the boys????

 

murphy’s law: BITCH DO YOU MEAN THE AVENGERS

 

tungsten dioxide whats this: mr. stark, colonel rhodes, vision, and pj yeah

 

The News(™): s

 

The News(™): speaki

 

The News(™): speaking of

 

[The News(™) has changed the chat name to ‘percy’s bimbos’]

 

moonmoon: RT RT

 

murphy’s law: on GOD

 

President lincoln: SAYING WHAT WE’RE ALL THINKIN 😩

 

Avril lavgine: FR

 

moonmoon: when he carried me i think i ascended

 

moonmoon: deadass no cap

 

moonmoon: im a new person now

 

The News(™): god i wish it were me

 

nedleedle: ive seen him in a tank top and lemme tell you

 

President lincoln: THE HOLY GRAIL

 

Avril lavigne: ned i have never been more jealous of a person in my entire life

 

nedleedle: good

 

tungsten dioxide whats this: if you guys can stop being WHORES for one second

 

tungsten dioxide whats this: i feel like we should talk about this in person

 

tungsten dioxide whats this: if you swear to not make thirst comments about my emotional support older brother figure you can all come over and we can have an actual conversation

 

moonmoon: …i suppose i can hold back for a bit

 

moonmoon: ill be over in ten

 

The News(™): me too

 

murphy’s law: x2

 

President lincoln: x3

 

avril lavigne: x4

 

Scary Captain: ned and i are already here. we’ll be waiting. 

 


 

 

robert <3

 

[aspen <3 has been removed from the chat]

 

 


 

SSEA

 

Tony Stank: hey pete and i are testing out the lightsabers he made if you guys wanna come up and watch

 

skrunkly raccoon: as cool as that sounds

 

skrunkly raccoon: percy and i have plans

 

Tony Stank: plans?

 

skrunkly raccoon: yeah!! we’re going to go listen to this podcast about the history or liquid soap he found

 

skrunkly raccoon: its over 12 hours!!!!!

 

Tony Stank: ok

 


 

The queen and her jesters

 

I dont have doe eyes shut the fuck up: guys oh my god this is bad

 

tony stark has been using his doe eyes to convince me to do terrible things since i was in MIT: whats wrong tony?

 

I dont have doe eyes shut the fuck up: ok first off

 

[I dont have doe eyes shut the fuck up has changed tony stark has been using his doe eyes to convince me to do terrible things since i was in MIT’s nickname to ‘rocky rhoad’]

 

I dont have doe eyes shut the fuck up: never again

 

I dont have doe eyes shut the fuck up: and second

 

I dont have doe eyes shut the fuck up: barnes just told me he couldnt go play with lightsabers with me and peter because he was going to listen to a PODCAST 

 

our lord and savior: let me guess

 

our lord and savior: with percy? 

 

I dont have doe eyes shut the fuck up: DING DING DING GOT IT IN ONE PEP

 

I dont have doe eyes shut the fuck up: GIVE THE LADY A PRIZE

 

rocky rhoad: a PODCAST?

 

I dont have doe eyes shut the fuck up: you heard me

 

I dont have doe eyes shut the fuck up: its about the history of liquid fucking soap

 

I dont have doe eyes shut the fuck up: and it gets worse

 

rocky rhoad: how can it get any worse???

 

I dont have doe eyes shut the fuck up: he used excalamation points

 

I dont have doe eyes shut the fuck up: i have literally never seen him do that

 

I dont have doe eyes shut the fuck up: he was genuinley excited about this

 

rocky rhoad: oh sweet jesus this is bad

 

I dont have doe eyes shut the fuck up: I KNOW

 

I dont have doe eyes shut the fuck up: theyre all EMOTION-Y

 

our lord and savior: tony…

 

I dont have doe eyes shut the fuck up: no pepper you dont get it

 

I dont have doe eyes shut the fuck up: they got FEELINGS all over my LAB

 

our lord and savior: :|

 

I dont have doe eyes shut the fuck up: i swear to god i see bucky reading to percy while laying on the couch together i WILL be using the eject button

 

our lord and savior: i think its sweet

 

I dont have doe eyes shut the fuck up: sweet?????

 

I dont have doe eyes shut the fuck up: you know what. sure. 

 

I dont have doe eyes shut the fuck up: lets encourage the world’s deadliest assasin to befriend the felon who is the power equivalent of a nuke. and it’s sweet. why not. 

 

rocky rhoad: percy’s a felon? 

 

I dont have doe eyes shut the fuck up: hes never been caught but there is not a single bone in my body that does not believe he’s commit at least fifteen

 

our lord and savior: im sorry??

 

our lord and savior: “befriend”?????

 

I dont have doe eyes shut the fuck up: what

 

our lord and savior: oh sweetie

Notes:

uhhhh when does this take place you ask????? uh....*checks notes* somewhere past chapter 39?? but also bucky is here??? so before he got Snatched??? but that happened before all this and--

yeah man i dont even know. just take your happy fun times and leave.

I HAD TO SLIP THE LITTLE BIT OF ANGST IN AND IM NOT SORRY

pepper rhodey and tony chat is something so underrated-

enjoy bucky being an absolute SIMP

it must be known that
-him reading to percy has become a regular thing, percy often falls alseep listening to his voice. even when he does, bucky keeps reading because he seems to have less nightmares
-they DO in fact snuggle while listening to the podcast
and also
-the acdec team was so fucking invested in spideyparker. fanart, edits, the whole nine yards. peter was having the time of his life, ned helped him make up fake relationship drama.

yeah uh. ill probably be going back to my regular posting schedule so. that means more of this though!! which will absolutely be ignoring my canon for the most part!

enjoy ig

plumbing baby. goodbye.

Chapter 29: husband shaped :)

Notes:

(See the end of the chapter for notes.)

Chapter Text

percy’s bimbos

 

moonmoon: EVERY TIME I THINK HE CANT GET HOTTER

 

president lincoln: I WAS LITERALLY ON THE G R O U N D

 

president lincoln: THERE'S ‘PRESIDENT’ IN MY USERNAME MR JACKSON SIR WILL YOU YELL AT ME NEXT

 

Murphy’s law: LIKE JESUS FUCKING CHRIST THE BIG DICK ENERGY

 

The News(™): every time he shut down landry i opened up a new tab for wedding venues

 

avril lavigne: RT RT

 

avril lavigne: SHE JUST LIKE ME FR

 

nedleedle: yeah it was pretty hot

 

mindiana jones: ive literally never been more attracted to somebody

 

tungsten dioxide whats this: can you guys shut the fuck up please

 

moonmoon: literally never

 

Murphy’s law: not even after death

 

tungsten dioxide whats this: you know what

 

tungsten dioxide whats this: i didn't want to do this

 

tungsten dioxide whats this: but you savages leave me with no choice

 

avril lavigne: oh ?

 

avril lavigne: will peter finally show up in a bloodstained cape and put us all out of our thirsty, thirsty misery?

 

tungsten dioxide whats this: @spicey

 

mindiana jones: NO

 

avril lavigne: oh god

 

avril lavigne: cant decide if this is better or worse

 

mindiana jones: percy dont read up 

 

mindiana jones: please

 

spicey: yeah ok

 

murphy’s law: HE SPEAKS

 

spicey: sometimes

 

tungsten dioxide whats this: percy.

 

spicey: peter?

 

tungsten dioxide whats this: would you be interested in marrying seven science nerds? 

 

tungsten dioxide whats this: be honest. 

 

spicey: im sorry?

 

tungsten dioxide whats this: just answer the question

 

spicey: i am interested in marrying one (1) science nerd

 

moonmoon: oh god oh fuck we have to fight now

 

moonmoon: abe im sorry youre my biggest competition im coming for you first

 

president lincoln: i will obliterate you

 

The News(™): sally,,,,

 

The News(™): forgive me for what has to happen

 

avril lavigne: oh no

 

avril lavigne: i accept the fact that my deadly peanut allergy would make me an insufficient partner and will therefore be my demise. at least make me go with a reese's cup?

 

The News(™): you got it babygirl

 

spicey: what are you people talking about

 

murphy’s law: dont worry your pretty little head about it <3

 

spicey: ??????????

 

tungsten dioxide whats this: more importantly what are YOU talking about???

 

tungsten dioxide whats this: you want to marry one??? YOU WERE SUPPOSED TO DIFFUSE THE SITUATION BY SAYING NO

 

spicey: WHAT SITUATION????

 

tungsten dioxide whats this: wait you dont

 

tungsten dioxide whats this: oh my god

 

tungsten dioxide whats this: WHO WERE YOU TALKING ABOUT

 

spicey: WHAT????

 

tungsten dioxide whats this: THIS

         spicey: i am interested in marrying one (1) science nerd

 

tungsten dioxide whats this: HOLY SHIT PLEASE DONT TELL ME YOU MEAN TONY

 

tungsten dioxide whats this: FUCKING SHIT PLEASE

 

tungsten dioxide whats this: I CANNOT HANDLE HAVING TWO FATHER FIGURES AT ONCE

 

spicey: of course i do not mean tony???

 

spicey: peter are you okay

 

tungsten dioxide whats this: NO

 

tungsten dioxide whats this: WHO WERE YOU TALKING ABOUT

 

spicey: my boyfriend???????

 

moonmoon: 

 

The News(™):

 

murphy’s law: 

 

avril lavigne: 

 

nedleedle:

 

mindiana jones:

 

president lincoln: ʸᵒᵘʳ ʷʰᵃᵗ

 

spicey: boyfriend

 

tungsten dioxide whats this: oh this worked out so much better than i could've hoped

 

murphy’s law: you

 

murphy’s law: you’re dating someone?

 

spicey: yeah!

 

spicey: :)

 

moonmoon: i want to be mad but i cant.,.,.,.he sounds so enthusiastic.,.,.,.

 

president lincoln: it was our mistake to assume a piece of ass like that would not have other suitors

 

avril lavigne: we were, devastatingly, too late

 

spicey: what?

 

tungsten dioxide whats this: forget that

 

tungsten dioxide whats this: who is this mysterious boyfriend??

 

spicey: here wait

 

spicey: hi peter

 

tungsten dioxide whats this: hewwo??

 

spicey: i have percy’s phone because he doesnt want to figure out how to do this

 

spicey: give me one second

 

[spicey has added James Barnes to the chat]

[spicey has changed James Barnes’s name to ‘terminator’]

 

nedleedle: DEADASS?

 

[spicey has left the chat]

 

The News(™): NOOOOOOO

 

terminator: he said you people were confusing

 

terminator: and scrolling upwards, i think i agree

 

murphy’s law: p l e a s e tell me that we havent been thirsting after the WINTER SOLDIERS BOYFRIEND

 

terminator: i hate to break it to but you most definitely have

 

moonmoon: oh lord he’s still scrolling

 

terminator: wow some of these are explicit

 

avril lavigne: tell my cats i love them

 

terminator: do you guys not have hobbies?

 

terminator: charles i dont even think the human body can move like that

 

murphy’s law: …..thinking back? I dont even know which message ive sent that got that response

 

murphy’s law: there are many options

 

nedleedle: hey cheer up

 

nedleedle: maybe we can get group tombstones

 

The News(™): all i ask of you sergeant barnes

 

The News(™): please dont get my blood on my moms new carpet

 

terminator: what?

 

terminator: jesus im not going to kill you guys

 

moonmoon: we literally have a groupchat dedicated to lusting over your boyfriend

 

tungsten dioxide whats this: remember the good old days when this was about ACDEC STUFF

 

mr president: ah, the dark ages

 

terminator: yeah and?

 

terminator: fr i would too

 

terminator: art is meant to be appreciated and all that

 

moonmoon: i-

 

avril lavigne: well hes not wrong but

 

avril lavigne: this just isnt how i expected this conversation to go

 

president lincoln: his JAWLINE looks like its carved from MARBLE

 

president lincoln: im so sorry i couldnt hold it in any longer

 

[terminator has changed their name to ‘terminator (percy simp)’]

 

terminator (percy simp): I KNOW RIGHT

 

moonmoon:

 

avril lavigne:

 

The News(™): WE GOT ANOTHER ONE BOYS

 

terminator (percy simp): hes so CUTE

 

terminator (percy simp): LOOK AT HIM

 

terminator (percy simp): [Image Attachment: The phone is pointed down at Bucky’s lap, where Percy is laying, eyes closed. He has headphones on, and is wearing one of Bucky’s sweatshirts. His hair is messy, and he looks content as he sleeps.]

 

murphy’s law: SCJQEGFEWJBFSJKFQREJH

 

moonmoon: JLKNLBLASAGDF

 

The News(™): FINALLY

 

The News(™): SOMEONE WHO ISNT STINGY WITH CONTENT

 

president lincoln: *cough*peter*cough*

 

tungsten dioxide whats this: really

 

president lincoln: yes REALLY

 

terminator (percy simp): to each their own i guess

 

terminator (percy simp): but this right here is most definitely my own

 

terminator (percy simp): hes husband shaped :)

 

tungsten dioxide whats this: WOAH WOAH W O A H

 

tungsten dioxide whats this: SLOW DOWN THERE BUSTER

 

tungsten dioxide: YOU'VE KNOWN HIM FOR LIKE A FEW MONTHS

 

terminator (percy simp): and? i have EYES peter

 

mindiana jones: oh my god you two are like u-hual lesbians

 

terminator (percy simp): 

 

terminator (percy simp): yeah pretty much

 

terminator (percy simp): we did skip the ‘asking out’ part and went straight for love confessions and almost dying for eachother

 

avril lavigne: i mean me too

 

moonmoon: yeah i’d do the same

 

tungsten dioxide whats this: i fucking hate it here

 

 


 

 

Unknown Number and TS

 

Unknown Number: This isn’t funny, Stark.

 

TS: wha

 

Unknown Number: Take down the fake account. 

 

TS: the FUCJK afe yoi talking about

 

Unknown Number: Are you drunk?

 

TS: no iys just THREEW IN THR GODDAMND MORNINF

 

Unknown Number: Ah, right. Just take it down.

 

TS: WHASR are yoh TALKIJNG ABOUT

 

Unknown Number: The Twitter account. 

 

TS:

 

TS: wait

 

TS: FURUY???

 

Unknown Number: Yes, Stark. I’m telling you to take it down.

 

TS: I DONT RUN IT

 

Unknown Number:

 

Unknown Number: Is this a joke?

 

TS: NO

 

TS: IVE BEEN TRYINF TO FIGHURE OUT WHOS BEHIND THAR FOR MONTHS

 

Unknown Number: Are you serious?

TS: YES

 

TS: I THOUGHT IT WAS YOU????

 

TS: THEY POSTED PICTURES OF YOU THAT I CANT FIND ANYWHERE ONLINE

 

Unknown Number: Hm.

 

Unknown Number: Go back to sleep, Stark.

Notes:

bucky is a fucking NERD okay???

the acdec kids gearing up to hold a hunger games even though they all have peanut allergies and asthma

bucky and percy are so head over heels in love with eachother its actually kinda gross

do i call the next installment of this fic after TLS 'the babygirlification of percy jackson' yes or no

more cryptid fury account content :)

ANYWAYS I NEED HELP MAKING A SHIP NAME FOR THEM
IVE BEEN USING WINTERSEA IN MY HEAD BUT IDK
IM TAKING SUBMISSIONS

plumbing baby. goodbye.

Chapter 30: yes chef

Notes:

(See the end of the chapter for notes.)

Chapter Text

SSEA

 

Tony Stank: so i was cleaning out an old storage closet and i found an old box of my dad’s stuff

 

baby avenger: >:(

 

Tony Stank: who wants to help me build a bonfire and toss it in

 

baby avenger: >:)

 

mindiana jones: disrespecting howard stark?

 

mindiana jones: ill be there in 10

 

Tony Stank: dont you live like 45 minutes away

 

mindiana jones: i said ill be there in ten

 

Tony Stank: yeah ok

 

skrunkly raccoon: i knew something was up with that asshole when i woke up decades later and there was no flying car

 

skurnkly raccoon: he promised me a flying car tony

 

Tony Stank: i am aware yes

 

Tony Stank: he was a piece of shit in many ways

 

skurnkly raccoon: percy and i are on our way

 

skrunkly raccoon: hey perce do you have anything of your dads i can burn too

 

percenary: what

 

percenary: no

 

gitc: your dad sucks too?

 

skrunkly raccoon: yes he does

 

percenary: hes a god they all suck a little

 

percenary: but no i will not be contributing to the burning pile

 

skrunkly raccoon: :|

 

perccenary: james, darling,

 

percenary: he is a GOD

 

percenary: he didnt exactly leave stuff behind or send gifts for dia de crianças

 

baby avenger: thats

 

baby avenger: thats actually pretty sad

 

percenary: hey focus on tony’s daddy issues not mine

 

Tony Stank: hey fuck you

 

percenary: bitch

 

baby avenger: OKAY

 

skrunky raccoon: im having ned do a crayon drawing of your dad and tossing it in

 

gitc: im honored to be involved

 

percenary: hes not that bad

 

percenary: once he lent me his trident so i could kill his grandma

 

baby avenger: paternal or maternal?

 

percenary: irrelevant, same lady

 

skrunky raccoon:

 

skrunky raccoon: you've got to stop saying stuff like that if you expect people to not be concerned 

 

skrunkly raccoon: anyways the only good thing percy’s dad has done was have a hot son

 

skrunkly raccoon: ned get the crayons

 

gitc: on it

 


 

robert <3

 

egg: guess what i just got my grimy little hands on :)

 

local milf: im scared

 

egg: good!

 

egg: [Photo Attachment: It’s a photo of Bridgette, looking around 12. She’s wearing a loose, flowy dress, and is sitting slumped over on a porch step, glaring at the camera, arms crossed in front of her chest. Behind her, someone is standing with a comb and a pair of scissors, trying to deal with the absolute mess of her hair. It’s frizzy and knotted, and she looks a combination of miserable and enraged.]

 

certified monster fucker: awwwwww little angry bridge <3

 

class traitor: i can feel the preteen rage

 

local milf: stop this madness

 

egg: but seriously what is going on here

 

local milf:

 

local milf: ᶦ ᵍᵒᵗ ᵍᵘᵐ ᶦⁿ ᵐʸ ʰᵃᶦʳ

 

certified monster fucker: im sorry what was that

 

local milf: I GOT GUM STUCK IN MY HAIR OKAY

 

egg: someone stuck it in your hair?

 

local milf: no 

 

local milf: it was a bubble gone wrong alright

 

certified monster fucker: i-

 

local milf: how did you even GET that

 

egg: oh you know

 

egg: my man on the inside

 

local milf: wait you mean

 

class traitor: 𝓂𝑒

 

local milf: Y O U

 

local milf: [Image Attachment: This time, it’s Dan. He’s about 14, spotted with acne and with neon green braces. His face looks to be in a permanent wince. He’s sitting on the floor of what looks like a dorm room, holding a video game controller in his hands.]

 

class traitor: NO

 

class traitor: I THOUGHT I ERASED ALL EVIDENCE OF MY CROSSBITE

 

thor understudy: ┬┴┬┴┤ ͜ʖ ͡°) ├┬┴┬┴

 

class traitor: LEE

 

certified monster fucker: i actually enjoy this

 

egg: [Image Attachment: Ross, age 11, hanging upside down from a thick tree branch. Theres a gap in his teeth, and he’s wearing a sweatshirt with a cartoon character on it. His smile is so wide his eyes are crinkling.]

 

egg: [Image Attachment: It’s the same photo, but Ross is now just a downwards heading blur.]

 

egg: [Image Attachment: Now, it’s just Ross facedown in the dirt.]

 

certified monster fucker: nvm

 

class traitor: well, in the interest of fairness

 

class traitor: [Image Attachment: Mal, age 13, covered head to toe in bright orange paint. They’re holding a single paintbrush in their hand, and are stunned still, eyes wide.]

 

egg: THIS ISNT FUNNY ANYMORE

 

certified monster fucker: oh yes it IS

 

egg: I DIDNT MEAN TO KNOCK OVER THE PAINT CANS OKAY I JUST WANTED TO MAKE A LITTLE PICTURE

 

local milf: oh you certainly made a picture alright

 

thor understudy: pfft

 

egg: DAN

 

egg: DAN GIVE US LEE BLACKMAIL

 

egg: I WILL NOT STAND FOR THIS INEQUALITY

 

class traitor: GOT IT

 

class traitor: [Image Attachment: Lee, bundled up in a parka, standing in what looks like an arctic wasteland. She’s standing on a dog sled, a team of malamutes, samoyeds, and, worryingly enough, what looks like a wolf, leashed up to the front. She’s wearing so many layers she can barely put her arms down.]

 

egg: I MEANT A CHILDHOOD PICTURE

 

class traitor: yeah she’s like 13 in that

 

egg: 

 

egg: lee how tall were you in the seventh grade

 

thor understudy: 6’3

 

egg: i hate you so much

 

certified monster fucker: forget lee’s slendermen genes, is that a DOG SLED?

 

thor understudy: yeah

 

thor understudy: i was going to school

 

certified monster fucker: cut the shit

 

thor understudy: im serious

 

class traitor: it fucked me up too, but that’s how she got around

 

class traitor: not a car nor gas station in that town

 

thor understudy: hey

 

thor understudy: one (1) truck that belonged to the police

 

certified monster fucker: the police had a truck. A truck. ONE truck. 

 

thor understudy: yeah, his name was oskar and he also gave the driving tests, officiated weddings, and occasionally delivered a baby

 

egg: what the fuck

 

thor understudy: he also helped run the polar bear defense league

 

thor understudy: they’d have eaten the elderly if not for oskar and his truck

 

class traitor: ok thats not the thing i wanted to bring up by sending this photo but

 

class traitor: lee, what were the names of your dogs

 

thor understudy: 

 

thor understudy: betong

 

egg: you named a dog betong

 

class traitor: correction, she named SIX dogs betong

 

certified monster fucker: all six???

 

class traitor: all six.

 

thor understudy: they knew who i was referring to when i called their names

 

thor understudy: they knew who i meant

 

egg: ok but betong is a cute name

 

class traitor: lee. 

 

thor understudy:

 

thor understudy: 😔 

 

thor understudy: it means concrete in norwegian

 

egg: oh my fucking god

 

supreme overlord jackson: a noble name.

 

thor understudy: :)

 

certified monster fucker: your favoritism disgusts me

 

local milf: hey commander do you have any fun childhood photos

 

supreme overlord jackson: hm

 

supreme overlord jackson: i suppose. of what age?

 

local milf: mmmm about 11-14

 

supreme overlord jackson: this is one of my mother’s favorites

 

supreme overlord jackson: [Image Attachment: It’s a 14 year old Percy, curled up on the floor with Mrs. O’Leary, taking a nap. One of her paws is thrown over his body, and his face is squished into her fur.]

 

local milf: awwwwwww

 

certified monster fucker: i KNEW you were a mamas boy

 

supreme overlord jackson: well, of course i am. my mother is fantastic. 

 

thor understudy: 15/10 mom

 

class traitor: fr fr, i was in her presence for like two seconds and it made me a better person

 

egg: awww what no fair i wanna meet her

 

supreme overlord jackson: no

 

egg: :(

 

supreme overlord jackson: you guys have work to do. Dan, you need to finish filing those reports from Kathmandu. Lee and Mal, you’re still on that investigation from last week. Bridgette, Ross, you’re cataloging evidence. 

 

local milf: yes, chef!

 

class traitor: yes chef!!

 

thor understudy: yes chef

 

egg: yes, chef

 

certified monster fucker: yes chef!!!!!!!

 

supreme overlord jackson: you people exhaust me.

Notes:

bucky hates poseidon so much asdfhkfs

also howard stark hate party ✨

in conclusion
lee, speeding across the snow of a desolate norwegian town with a population of like 8: FUCK YEAH, CONCRETE

plumbing baby. goodbye.

Chapter 31: chloe the spider and pepperkaker

Notes:

(See the end of the chapter for notes.)

Chapter Text

SSEA

 

baby avenger: mr stark

 

baby avenger: mr stark

 

baby avenger: M R  S T A R K

 

Tony Stank: jesus christ kid

 

Tony Stank: Is something wrong?

 

baby avenger: yes!!

 

Tony Stank: I'm on my way.

 

baby avenger: wait no

 

baby avenger: not like that

 

baby avenger: im fine i swear

 

skrunkly raccoon: he was already in the suit-

 

skrunkly raccoon: but whats wrong, kid?

 

baby avenger: SOMEBODY

 

baby avenger: never told me about antman >:(

 

Tony Stank: huh

 

baby avenger: mr. lang!!! ANTMAN!!!!

 

baby avenger: my bug bro!!! 

 

baby avenger: and you didnt tell me about him :(

 

Tony Stank: kid you FOUGHT him

 

percenary: ah, yes, the walmart parking lot fist fight

 

Tony Stank: percy shut up

 

baby avenger: i didnt know he was called ANTMAN

 

baby avenger: he was just some dude 

 

Tony Stank: …okay? well now you know

 

baby avenger: he can talk to ants mr. stark

 

baby avenger: thats so cool

 

baby avenger: i want to talk to ants

 

Tony Stank: literally why

 

baby avenger: they seem wise

 

percenary: ocean bugs know some shit

 

baby avenger: see!!! unexpected buggy wisdom

 

Tony Stank: god your so weird

 

Tony Stank: and why would you be able to talk to ants? shouldn't you talk to spiders?

 

baby avenger:

 

baby avenger: 

 

Tony Stank: you didn't consider that did you

 

baby avenger: nope

 

baby avenger: brb

 

percenary: are you proud of what you raised

 

Tony Stank: yes shut up

 

percenary: just checking

 

Tony Stank: and the ocean bugs?

 

percenary: helped me pass calc

 

baby avenger: i cannot find a spider to befriend :,(

 

baby avenger: time to go lay down in a puddle of soup face first

 

Tony Stank: jesus christ

 

percenary: hey wait

 

percenary: gimme a sec

 

 


 

 

drinking groundwater is good for the soul

 

pj masks: hey lee

 

teletubblees: yes

 

pj masks: want to help spider-man figure out if he can communicate with his brethren

 

pj masks: he needs some spiders

 

teletubblees: im already in the car

 

 


 

 

Bridgette Lehey has created a new chat

 

Bridgette Lehey: why did my lee just stop in the middle of his baking, grab a terrarium, and get in his car

 

Commander Jackson: i have no idea what you’re talking about, sorry

 

 


 

 

percy’s bimbos

 

tungsten dioxide whats this: guys

 

tungsten dioxide whats this: get ready

 

tungsten dioxide whats this: im about to meet a big fluffy tarantula to see if i can speak to it

 

tungsten dioxide whats this: and maybe get some new friends who have some SHAME :)

 

moonmoon: i said what i said about his thighs. 

 

tungsten dioxide whats this: god i hate you people

 

tungsten dioxide whats this: one of percy’s coworkers just showed up to my house with a terrarium

 

tungsten dioxide whats this: spiders name is chloe

 

president lincoln: i love her

 

tungsten dioxide whats this: oh my god shes so soft

 

murphy’s law: peter if you start hanging around spiders i will use raid on you i swear to god

 

murphy’s law: you are the only spider i can deal with

 

nedleedle: wow charles that's so speciesist

 

The News(™): so not cool, charles

 

avril lavigne: yeah man wtf

 

murphy’s law: ?????

 

murphy’s law: i'm ARACHNAPHOBIC?????

 

moonmoon: okay and? Im heterophobic but you don't see me kicking out straight people

 

murphy’s law: you’re the one that started a petition to get flash removed from the chat

 

murphy’s law: when he tries to talk to you, you just stare at an invisible camera like you’re on the office and never respond

 

moonmoon: 

 

moonmoon: oh fuck right lmao

 

tungsten dioxide whats this: the spider man is very nice

 

nedleedle: peter what have we said about referring to yourself in the third person

 

tungsten dioxide whats this: :| 

 

tungsten dioxide whats this: the spider man, not the spider-man, ned. god.

 

nedleedle: shit how could i forget about the hyphen

 

nedleedle: peter, love of my life, im so sorry

 

nedleedle: please forgive me

 

tungsten dioxide whats this: mmmm bring me some skittles and we’re even

 

nedleedle: done <3

 

tungsten dioxide whats this: <3

 

tungsten dioxide whats this: but yeah the man who brought me chloe is very nice

 

tungsten dioxide whats this: he left us to play and is now baking

 

Scary Captain: okay but

 

Scary Captain: peter can you or can you not speak to chloe

 

tungsten dioxide whats this: maybe???

 

tungsten dioxide whats this: she did a little chirp thing and i got the message

 

tungsten dioxide whats this: but it wasn't like. words? I just knew what she meant

 

The News(™): oh my god are you serious

 

The News(™): thats so cool

 

tungsten dioxide whats this: she likes fiddle music?????

 

tungsten dioxide whats this: why does this spider have a norwegian accent

 

The News(™): oh my god peter you can’t just ask people why they have a norwegian accent

 

Scary Captain: ask her, idiot

 

Scary Captain: thats a thing you can do, apparently

 

tungsten dioxide whats this: shit u right

 

Scary Captain: dumbass

 

tungsten dioxide whats this: shes an immigrant from norway!!

 

tungsten dioxide whats this: this spider has so much life experience and wisdom for me

 

tungsten dioxide whats this: !!!! aunt may’s home !!!!

 

avril lavigne: show her chloe!!

 

President lincoln: yes!

 

President lincoln: share the nordic arachnid wisdom

 

tungsten dioxide whats this: 

 

tungsten dioxide whats this: 

 

tungsten dioxide whats this: 

 

nedleedle: buddy?

 

nedleedle : you okay?

 

tungsten dioxide whats this: h

 

moonmoon: …peter?

 

tungsten dioxide whats this: he’s flirting with may

 

tungsten dioxide whats this: chloe's father is flirting with my aunt

 

tungsten dioxide whats this: he’s in my kitchen, baking cookies, and flirting with my aunt.

 

president lincoln: PFFFTTTTTT

 

The News(™): SFJDLBGFKJSBVJREBGVHRGVIRUEQJDFJK

 

tungsten dioxide whats this: dont LAUGH

 

moonmoon: mays a milf, idk what you want man

 

tungsten dioxide whats this: S T O P

 

nedleedle: you better start bonding with chloe, cause i think you’re about to get a new sister

 

tungsten dioxide whats this: MAY IS BLUSHING 

 

tungsten dioxide whats this: SEND HELP P L E A S E

 

tungsten dioxide whats this: oh my god this is terrible

 

murphy’s law: are his pickup lines bad or something?????

 

tungsten dioxide whats this: no they're TERRIFIC and they're WORKING

 

Scary Captain: there are worse things

 

Scary Captain: at least you know he will accept you for your spidery self

 

nedleedle: he will feed you bugs <3

 

tungsten dioxide whats this: I DON'T EAT BUGS

 

tungsten dioxide whats this: thank fuck another one showed up

 

moonmoon: please tell me its Him

 

tungsten dioxide whats this: don't capitalize that jesus christ

 

tungsten dioxide whats this: and no, its bridgette

 

tungsten dioxide whats this: she’s really nice! and shes here to reign lee in

 

tungsten dioxide whats this: she just watched him hand me a cookie and call me champ

 

The News(™): and how did that make you feel

 

tungsten dioxide whats this: very gender affirmed but also very conflicted

 

nedleedle: ask him to play catch with you

 

tungsten dioxide whats this: bridgette has inserted herself into the conversation, all is well

 

president lincoln: give us the transcript king

 

tungsten dioxide whats this: ok ok

 

tungsten dioxide whats this: bridgette: you stopped baking and left and i wanted cookies, so now i'm here

 

tungsten dioxide whats this: (they are really good cookies so) 

 

tungsten dioxide whats this: lee: had to bring chloe to a playdate. and this is may   (said in a way i do NOT like)

 

tungsten dioxide whats this: bridgette is looking at her

 

tungsten dioxide whats this: ma’am please. please take him away from here.

 

moonmoon: your lord and savior, bridgette

 

tungsten dioxide whats this: 

 

tungsten dioxide whats this: 

 

tungsten dioxide whats this: charles is that option for raid still open

 

The News(™): ?

 

tungsten dioxide whats this: i assumed bridgette was going to save me. to put a stop to this madness. 

 

tungsten dioxide whats this: but this FOUL WOMAN has JOINED IN

 

tungsten dioxide whats this: she is TAG TEAM FLIRTING WITH MY AUNT

 

tungsten dioxide whats this: IM TAKING CHLOE AND IM LEAVING

 

president lincoln: im fucking sobbing

 

avril lavigne: THIS is queer excellence oh my god

 

avril lavigne: the TEAMWORK

 

tungsten dioxide whats this: my aunt was tag team flirted by a nonbinary 6’9 norweigan spider dad and his pretty gf who can sniff out pepperkaker cookies like a bloodhound. 

 

tungsten dioxide whats this: this is my homophobic origin story.

Notes:

peter's really going through it huh

every time i write lee it physically pains be cause he is 6'9 for some godawful reason and i cant even imagine a human being that tall

and YES i am very proud of 'teletubblees'

lee fr stopped in his baking, grabbed chloe and his mixing bowl, drove to peter's, gave him chloe, and resumed his baking in their kitchen
anyways, teaming up with your partner to flirt with a milf IS queer excellence, i dont take criticism.

plumbing baby. goodbye.

Chapter 32: halloweenie

Notes:

(See the end of the chapter for notes.)

Chapter Text

Halloween was always a big deal at Stark Tower. 

 

The entire place, from the lobby to the penthouses, was opulently decorated with fake spiderwebs, jack o’ lanterns, and fake bats hanging from the ceiling. Animatronic witches and scarecrows lurked behind corners, jumping out and repeating recorded lines at unsuspecting employees. Peter was fairly sure that they were under FRIDAY’s control, and after a terrifying experience with the witch on the 32nd floor (in which his spidey-sense was of zero help), he did his best to keep the AI in a good mood. 

 

Rumor has it that one of the legal department heads who’d been unnecessarily critical to the interns, had been under constant bombardment. Sometimes, Peter worried about how vindictive Fri could be. But, then again, she had very good judgment, and, well, who was he to interfere? 

 

Even the elevator music had been replaced for the month—as he ascended to the top floors, Monster Mash was playing from the speakers. Peter rocked back and forth on the balls of his feet, watching the floor number tick up. He checked his watch as the doors opened. MJ and Ned were coming early so they had time to set everything up, but he wanted to get a head start, just in case. 

 

When he stepped out into the common room, he was greeted with the sight of Mr. Stark in one of Colonel Rhodes’s shirts and jackets. He was craning his neck up at the ceiling and debating something with FRIDAY, giving Peter a distracted wave as he spoke with his AI. 

 

Peter wandered into the kitchen, grabbing a juice box from the fridge and hopping up on the counter to sit. “Are you Colonel Rhodes?” He asked after taking a long sip. 

 

Mr. Stark looked over. “Yep. He’s Pepper, and she’s me. For some reason, she drew the line at getting part of her sternum carved out and replaced with an electromagnet, though.” He said with a shrug. 

 

“Weird.” Peter agreed. 

 

The engineer looked him up and down. “What’s going on here?” He asked after a second. Peter looked down at himself, then back up at Mr. Stark. “I’m Po.”

 

He wrinkled his nose. “What the shit is a Po?”

 

Peter’s eyes widened. “Oh, you are in for a treat, Mr. Stark,” He said, pulling out his phone and opening it. For the next ten minutes, he showed Mr. Stark photos of the teletubbies, outlining their various strengths and weaknesses.

 

“—and I’m the red one over there, Po. Personally, I think she’s the best one. She’s one of the shorter ones, sure, but she’s scrappy. She’s also bilingual! She speaks Cantonese, Mr. Stark, how cool is that? And she has a scooter, which is way better than the other things the rest of them have. She has the widest range of skills and abilities, and I want to be just like her.” 

 

Mr. Stark leaned slightly away from him. “Alright, then.” He said after a second. “I guess I’m getting you a scooter for your birthday.” 

 

Peter’s eyes widened. “I’m ready for my ankles to be obliterated, sir. I was born ready.” 

 

MJ and Ned showed up next. They, like Peter, were dressed in giant, monochromatic costumes. MJ was Tinky-Winky because he was the tallest of the four, and she enjoyed the controversy around him and his purse. Ned was Dipsy, because he had a cool hat. Ned also had a cool hat. So, Dipsy, 

 

None of them were Laa-Laa. 

 

They hated Laa-Laa. 

 

The three of them, with the help of Mr. Stark, set up the rest of the decorations and laid out the snacks on the coffee table. FRIDAY contributed with a playlist she lovingly cultivated, which started off strong with a Shakira song and moved onwards to a recording of Godzilla roars remixed into the Home Depot Beat. 

 

Peter had never felt more strongly about his love for this AI. 

 

By the time they were finished, spiderwebs covered the majority of the walls and ceilings. Unfortunately, Peter’s teletubby costume was quite thick, and he did have some difficulties sticking to the ceiling. He’d only fallen on his head three times, though, and the padding was probably enough to protect his cranium. 

 

Then, everyone else showed up, which is where the problem began. 

 

First, it was Cindy. After saying hello to everyone, she went to the bathroom to fix her makeup, her bag in her hands.

 

Charles showed up not a minute after her. MJ blinked, then slowly turned to Ned, who shrugged. “Hey, did I leave my hat here last week?” 

 

Peter nodded faintly. “It’s in the coat room.” He said, pointing down the hall. Charles gave him a thumbs up and wandered out of the room. 

 

After that, Abe. “Hey, can I get a glass of water?” He asked as he stepped out of the elevator. Ned choked on his juice as he caught sight of him. Peter pat him vigorously on the back as MJ nodded and directed Charles to the kitchen, lowering herself down onto the loveseat as she did so. “I need to sit down.” She whispered. 

 

Then, Sally, who walked into the living room, only to immediately drop her phone. “Shit,” She muttered, getting down onto the carpet to retrieve it from under the couch. 

 

It was then that Betty showed up. At this point, MJ was still on the couch, numb to the world, and Ned was wheezing. 

 

It fell apart all at once. Cindy returned from the bathroom. Charles walked in with his hat. Abe came in with a glass of water. Sally stood up from her stop behind the couch. Betty stepped out of the elevator. 

 

For a very long moment, it was deadly silent. Each of the standing AcDec members looked around the room, taking in the others. Abe’s cup slid out of his lax fingers and hit the carpet. 

 

“You’ve got to be fucking kidding me.” Cindy burst out. 

 

Charles whipped around to stare at her. “We’ve got to be joking? This was my idea first!” 

 

“Like hell it was!” Sally butt in. “I told you guys I was going to be doing this!” 

 

“You most certainly did not!” Abe said shrilly. “If you had, none of us would look like this!” 

 

MJ’s head was in her hands, shoulders shaking. Peter wasn’t sure if she was laughing or sobbing. Peter wasn’t sure if he was laughing or sobbing. Ned’s wheezing got louder. 

 

“This,” Betty said, eyes wide, “Is terrible.” 

 

“No shit, Sherlock.” Charles snapped.

“Fuck you, it’s King Bob to you, cretin.” She bit back. 

 

Cindy tugged at her hair. “We can’t refer to you as King Bob, Betty, we’re all King Bob.” 

 

Betty sniffed. “With that shade of yellow? I think the fuck not.” 

 

And just like that, Peter, Ned, and MJ watched as five teenagers dressed as minions devolved into fist fighting. 

 


 

Peter opened his mouth, closed it, then opened it again. “Are you dressed as Pitbull?” 

 

Ross, in a bald cap and suit, nodded from his spot leaning against the doorframe. “What about it?”

 

“Nothing.” Peter said quickly. “Just…can we come in?” 

 

Ross looked over his shoulder at the other two teletubbies and the disheveled minions behind him. He squinted, then shrugged, stepping back to let them in. “Sure.” 

 

They filed into the bullpen gawking shamelessly. Should they be in a top secret government facility? Probably not. But by God are they. 

 

Everything was decorated, too. Like Stark Tower, spiderwebs, pumpkins, and bats seemed to be the main themes. In the corner, there was a leafless tree in a large pot that had been decorated with what looked like violets with eyes stuck in the middle and a skull on top. On each of the desks, there was a carved pumpkin. The artistic skills ranged considerably; Bridgette’s had the neat outline of a ghoul, Lee’s had a perfectly symmetrical frowny face that was oddly reminiscent of him, Ross’s had a shaky rendition of Venom, Mal’s had what looked like Mothman, and Dan’s…looked like someone had taken a chainsaw to a poor pumpkin. 

 

There were jumbo bags of candy scattered around, and someone had set up a projector playing what looked like one of the Halloween episodes of Lab Rats. All in all, it looked like a pretty good Halloween party. 

 

Ross raised an eyebrow at them. “What happened to you guys?” 

 

The minions exchanged weary glances. “We don’t want to talk about it.” They all chorused. Then, Cindy, who’s yellow face paint had been rubbed off by the carpet Abe had ground her face into, hefted up a grocery bag. “We did bring bean dip though.” 

 

That seemed to seal the deal for Ross, who took the bag and placed it on one of the desks. Peter looked around, doing a mental headcount. “Where’s Percy?” At his name, the others behind him perked up. Disgusting. 

 

“We were walking to the tower to get ready when he got a call from one of his cousins. Apparently, somebody got their hands on a summoning how-to that was a bit too accurate, and now one of Percy’s half siblings is rampaging somewhere in the Gulf of Mexico.” Sergeant Barnes said, walking down the steps from Percy’s office. “He just called—he’ll be here in ten.” 

 

Though he was lacking the cowl, Sergeant Barnes’s Batman costume was scarily good. The plated armor fit him perfectly, and the dark lining around his eyes dramatized the steely blue. Behind him, Abe made a choking noise and Peter grit his teeth. Cindy wasn’t even trying to be subtle as she looked him up and down, eyes resting on the man’s thighs. Peter’s hand curled into a fist. 

 

Teletubbies do not use violence as a first resort. Teletubbies do not use violence as a first resort. Teletubbies do not use violence as a first resort. 

 

He stopped in front of Peter, brow raised. “What are you guys doing here?” 

 

“I’d like to know that as well, please!” Mr. Stark called from one of the couches. “I specifically left the tower so whatever you little shits did wouldn’t end up damaging my person.”

 

Peter winced. “Well…” He dragged out, scratching the back of his neck. Or, well, he tried. The Po suit was very large. Mr. Stark narrowed his eyes. He looked at Sally’s hair, which had been ruthlessly pulled out of one of its pigtails, the giant slap mark on Charles’s face, the rip in Betty’s sleeve. The man grit his teeth. “What did you do.” It wasn’t a question. 

 

“There was an altercation. We…thought it best to leave the scene of the crime.” Peter said diplomatically. 

 

“Crime?!”  Mr. Stark yelled. 

 

“Bad choice of words.” MJ amended for him. “We just thought leaving was a good idea.”

 

Mr. Stark put his head in his hands. Colonel Rhodes rubbed a soothing circle on his back. Sergeant Barnes just sighed. 

 

Cindy clapped her hands together. “Enough about our potential Geneva Conventions violations!” She chirped. “What are you guys dressed as?” 

 

The SWORD members all exchanged looks before shrugging in sync. Dan, who was wearing a crop top and platforms, raised a hand. He was wearing a bald cap and was bright blue. “Slutty Megamind.” He said easily. “This is fabric dye. I didn’t have skin paint. It won’t be coming off. But that’s okay, because I’m serious about my slutty Megamind lifestyle.”

 

Ned nodded. “Live your truth.” 

 

Then, Mal spoke up. “I’m a Furby.” She was in a fuzzy, bright pink sweater with white spots. A pair of blue plastic ears resting atop her head. She was also covered in what was most likely fake blood. Sally took a careful step back. 

 

Bridgette, whose hair had been dyed a rich orange-red color, smiled at them. “I’m Starfire.” She said. Then, she pointed at Lee, who was in dark cargo pants and red kevlar. “And he’s Robin.” 

 

Sally cooed quietly from behind MJ. Abe was still staring at Sergeant Barnes, who looked up. “Batman.” He said simply. “Little different than how I remember him, but that’s probably for the best.” Peter pulled up the mental image of the ‘40s version, then nodded. 

 

Mal passed them a bowl of candy, though it looked like all the Milk Duds had been picked out. Peter eyed the suspiciously full pouches on the sides of Lee’s pants. The pathologist met his gaze head on and raised a challenging eyebrow. Peter looked away and made a grab for some jelly beans. 

 

They heard the slam of the entrance door and his voice before they saw him. “Can somebody please tell me why there’s a fucking cacodaemon in the middle of the godsdammned tower?” Percy’s furious voice rang out. 

 

The entire AcDec group cringed, slowly turning around to face the man. 

 

This was…this was so much worse, actually. Peter didn’t even want to look at the rest of his friends, but, unfortunately, he was in the back of the group now. 

 

Percy was standing in front of them, arms crossed, an eyebrow cocked. His sword was strapped to his hip, next to a long coil of golden rope. The chest plate left his arms and shoulders bare, and there was a metal circlet resting on his forehead.

 

Behind them, Sergeant Barnes walked into a wall.  

 

“Wonder Woman.” Cindy got out, sounding slightly woozy. Percy blinked. “...yeah. But that’s not what I asked.” 

 

Mr. Stark, who was watching the drool leave a track in Abe’s yellow face paint with a slightly disgusted facination, made a noise in the back of his throat. “I’m sorry, did you say demon?”

 

Cacodaemon.“ Percy corrected with gritted teeth. “It was sitting in the living room. It totally wrecked the place.”

 

The AcDec group collectively cringed. 

 

Tony’s eyes widened. “Is it contained?”

 

Percy rubbed a hand over his face. “It’s not really something you can lock in the pantry, Tony.”

 

Bucky crossed his arms, tearing his eyes away from Percy. “My question is how it got there in the first place.” Slowly, he swiveled towards the assembled teenagers. “You wouldn’t happen to know anything about that, would you?”

 

The SWORD members exchanged looks, loosely congregating behind Tony. Percy tilted his head, expectant. Charles broke first. “We didn’t think it’d stay!” He blurted out. 

 

Sally buried her head in her hands. Bucky took in a deep, calming breath. “You…didn’t think it’d stay?” He repeated incredulously. 

 

“No,” Betty mumbled. “It said it would leave when it was finished.”

 

“The demon?” Ross asked dubiously. 

 

Sally mumbled something into her hands. Tony’s frown deepened. “What was that?” 

She let out a shaky exhale. “The WikiHow article.” She admitted. “It said that once the demon finished what we summoned it for, it’d go back home.”

 

Percy looked a second away from crushing the metal plating around his knuckles with his fist. “You summoned a cacodaemon from a fucking WikiHow article.” 

 

They nodded, heads hung low. Bucky stepped up to stand next to Percy, and gently unfurled his fist, intertwining their hands. The demigod did seem to calm down slightly at that, but was nowhere near done. “I don’t know what even possessed you to do something that stupid,” He said tiredly. “But you did it, you’re fixing it.” 

 

Abe winced. “Right. Uh, how?”

 

Percy fingered the hilt of his sword. “They can only be sent back to where they belong through a magical blade.” He gave them a strained smile. “Lucky you—-I’ll take care of that part. All you guys gotta do it catch it.”

 

Charles swallowed. 

 


 

“I miss Lab Rats.” Mal muttered as she flipped on her flashlight. Beside her, Bridgette snorted. “You agreed to this.” She said. 

 

The tower was dark when they spilled out of the elevator, the illuminated buttons providing the only light in the area. They’d floundered around the living room for an embarrassing moment before Percy had rolled his eyes and found flashlights in the nearby closet. Not enough for everyone, but one for every pair. 

 

“Isn’t splitting up, like, the worst thing to do?” Cindy asked nervously, staring down one of the dark hallways. 

 

“Keeping you urchins from one another is the best course of action, no matter what.” Tony said firmly. Peter was by his side, checking the batteries of their flashlight. After that, he began to nervously fiddle with his webshooters. 

 

Abe frowned slightly, but didn’t dispute that. Instead, he gave a shaky smile and a wave as Ross clapped him on the shoulder and began to drag him down one of the hallways. Dan followed suit, Charles dragging his feet alongside the cybersecurity specialist. 

 

The remaining teenagers gave each other wide-eyed looks before they were dragged off by their respective partners. Cindy and Mal took the elevator up to the very top with Betty and Bridgette, agreeing to split up and cover the private apartments and rooms on the 93rd floor, while Peter and Tony took Rhodey and Ned to the 92nd to scour through the labs. 

 

After a moment of discussion, Lee and Sally went through the service doors of the lab to begin looking through the stairwells and storage closets. That left MJ and Pepper, who decided to go down to the public floors and make sure all the employees were alive and whole. 

 

As everyone split up, Bucky turned to Percy. “Are you sure this is safe?”

 

Percy shrugged. “I mean, I was doing this stuff when I was twelve.” Bucky nodded acceptingly. “Alright then. Where are we going?” 

 

“Nowhere. I’ve been chasing my father’s demonic spawn across a Mexican beach for the past hour. I’m not doing shit until they find that thing.” He said flatly, leaning back into the couch. “Also, I missed you.” 

 

Bucky’s face turned soft. “Missed you too.” He said, joining Percy on the couch and wrapping an arm around his shoulders. His boyfriend leaned into him, cheek pressed against the chestplate of his black armor. “And I like your costume.” He said with a grin. 

 

Percy laughed. “Reyna and her sister thought it’d be funny.” 

 

Funny wasn’t the way Bucky would put it when he was staring at Percy’s bare thighs, but whatever. 

 


 

Cindy was regretting this so, so much. She knew they shouldn’t have started using WikiHow. That never got anybody good, ever. They should have just had a deathmatch in the kitchen and settled their issues like men. 

 

The Furby, Mal, her name was, walking in front of Cindy, pointing the flashlight around as she walked, humming a tune under her breath. Her hair was quite long, and was done in an elaborate braid that swung back and forth like a pendulum as she walked. 

 

“So,” Mal said, casting a glance over her shoulder. “What happened to your face?”

 

Cindy sighed. “Abe.” Was all she said. 

 

The woman made a vague noise and opened the door to the first empty apartment. There wasn’t much in there; just dusty furniture and drawn shades. As they stepped inside, Cindy coughed at the displaced dust from their footprints. 

 

The tables and chairs were all covered with sheets, sucking all the saturated colors from the room. Like the rest of the tower, the lights had gone out, FRIDAY unresponsive. The flashlight illuminated a tiny circle of the walls, reflecting off the dust particles in the air. Cindy peered around, suddenly very unsettled. Mal was halted in the entryway, a slightly creeped out look on her face. 

 

The door creaked shut behind them.

 

“Well then,” She muttered. 

 


 

Charles looked over at Dan. “So,” He said after a second. “You play CoolMathGames?”

 

Dan didn’t hesitate. “I designed it.” 

 

“Oh.”

 


 

Ned and Peter held hands the entire way to the labs. Ned was squeezing his hand like a stress ball, but Peter didn’t really mind. Ahead of them, Tony and Rhodey, a flashlight with each, scanned up and down the empty lab. 

 

“Right,” Tony said after a long moment, breaking the silence. “I’m going to try and get Fri back online. Pete, you’re with me. Honeybear, take the cybercriminal and make sure the demon isn’t possessing the Mark L, I’m quite fond of that one.”

 

Rhodey snorted and gave him a mock salute before he and Ned, shooting Peter a terrified look, walked off to the other end of the lab. Peter inched closer to Tony. “Do you really think it can do that?” He whispered urgently. 

 

Tony shrugged. “No clue.”

 

Peter swallowed and readjusted his web shooters. 

 


 

Down in the stairwells, Sally scampered after the man in front of her. “Why are we running?” She asked desperately as they descended another flight. His legs were long enough to be taking steps four at a time, but hers were most definitely not. The man, Lee, blinked. “Efficiency.” He said blandly. 

 

“Right.” Sally muttered as they barged into another storage closet. Lee took a quick look around before he gave the box stacks a light nudge. She opened a large plastic bin, only to find it full of various cords that looked like a nightmare to untangle. 

 

They closed and locked the door behind them. Percy’s words still echoed through her head. 

 

They’re not ghosts—lock doors, and it’ll keep them out. Unless, of course, someone lets them in. That last part was aimed at them, and Sally’s cheeks still burned with embarrassment. How were they supposed to know? WikiHow hadn’t really included that part. 

 

The point was that cacodaemons weren’t actually all that supernatural. Sure, they could be summoned, bargained with, and were inherently malevolent, but they couldn’t pick locks, apparently. Abe could pick locks, for fucks sake. They couldn’t walk through solid barriers, like walls, either. 

 

Unfortunately, Stark Tower didn’t keep all its doors locked, especially not when they were open, which was always, and especially not on the top three private floors. 

 

She and Lee checked another closet, and locked another door. “So…” Sally ventured. “Robin?”

 

The man sighed. “Bridgette’s idea.” He muttered. “I wanted to be a sunchoke.” He prodded at another box. 

 

Sally blinked. “A sunchoke?” 

 

Lee shrugged. “It’s my favorite root vegetable.” 

 


 

Abe did not like this. 

 

Ross seemed to be enjoying himself. Abe was not. 

 

They’d left the group first, and were now wandering through the gyms. Ross was overturning gym mats and throwing basketballs at the wall. There wasn’t really any rhyme or reason to how he went through things, but Abe stayed close anyways. They’d been through the adjourning locker rooms and had found nothing, leaving them to investigate the rest of the gym.

 

The man, still in his bald cap, had begun to start hitting random objects to see if it would call the cacodaemon’s attention. Abe winced with every noise that reverberated around the room.

 

“I’m going to try and seduce this thing.” Ross finally decided. 

 

Abe looked at him consideringly. 

 


 

Pepper leaned back at her desk. “At least nobody’s missing.” She offered. 

 

MJ sighed, slumping across the office chair opposite from the woman. “I kind of want that thing to bite Charles.” She mumbled. “I blame him.” 

 

Pepper gave her a consoling look. “I’m sure it’ll be fine.” She said, “We sealed off the entrances to all the upper floors, so the others will find it eventually. It won't get down here.” 

 

That got her a shrug. “I wanted to be scaring elementary schoolers with fake guts by now,” MJ commiserated. “Not looking for a WikiHow demon.” 

 

Pepper smiled. “A worthy goal.” She agreed. “In the meantime, would you like to help me with a proposal I was given? Some fresh eyes would be nice.” 

 

MJ sat up ramrod straight. “I would be honored.” She said seriously. Pepper gestured for her to roll her chair over. 

 


 

Betty liked Bridgette. Her hair was really pretty—not just the dye. The rich, warm red was beautiful, but she also admired the soft, shiny curls it fell down her shoulders in. It didn’t even look heat-treated. As they entered another empty apartment, Betty ran a hand through her flat blond strands. 

 

Bridgette seemed really nice, too. Most of the SWORD people did, but especially her. Her boyfriend seemed a little scary, but given the fact he was wearing a Robin costume that clearly wasn’t his idea, Betty figured he was alright.

 

This was oddly boring. While Betty was glad no creature had jumped out at them to, like, eat their faces or something, she was kind of hoping something exciting would happen. It seemed like she was out of luck. 

 

The woman in front of her looked over as she bolted the door to the empty bedroom door. “Nothing.” 

 

Betty, who was holding the flashlight for her, tried to smile. “Better than something, I guess.” 

 

Bridgette smiled. “I suppose so, yes.” As the two began to walk back to where they started, she looked over at Betty. “You know, your hair is the perfect type to do this really cute bun thing I saw.” 

 

Betty glanced up, eyes wide. “Really?”

 

A nod. “It doesn’t really work well with my curls, but your hair is so straight, it’s not even frizzy, wow, that it’d work perfectly.” She said conversationally. 

 

Staring at her with wonder, Betty touched the tips of her hair. “Show me?” 

 

Bridgette’s smile crinkled her eyes. 

 


 

 

Tony sighed, pushing himself out from under one of the holotables. “Nothing’s turning on.” He said, frustrated. “Every time I give it a jump, it just fizzles out. It’s like it just wont take a charge anymore.” 

 

Peter frowned. “That’s…really weird. And also impossible. Why?”

 

Tony threw his hands up. “Beats me. I stopped asking questions when it came to Percy’s weird supernatural shit a long time ago.” 

 

A loud crash sounded from across the labs, and a twinge went down Peter’s spine. He and Tony exchanged panicked looks before running in the direction of Rhodey and Ned. When they skidded into the room, they saw the two standing behind one of the workbenches. On the other side…Peter blinked, rubbing at his eyes. When he opened them again, he took an immediate step back.

 

It was on its hands and feet, all four limbs spindly and disproportionate. Its knees and elbows jutted out at odd angles, and the ridges of its spine were deformed and misshapen. It had hair, but it was in greasy clumps, bald patches spotted throughout its scalp. When it looked up, Peter could hear all four heartbeats pick up in a horrified synchronization. 

 

It looked like it may have had a face, at one point, but flesh was pulled tautly across its skull, leaving only a vague indentation where eye sockets and a mouth may have once been. Instead of a nose, two deep gouges were centered in the middle of its face, like it had clawed them open itself. 

 

Tony shifted, pushing Peter behind him. “This,” He hissed, “Is what you summoned?” 

 

Peter swallowed. “It…it didn’t look like that before?” He offered faintly. 

 

Ned made eye contact with him, breath coming in harsh pants. The cacodaemon tilted its head to the side, regarding them. Its neck twisted unnaturally as it moved back and forth between the two groups. 

 

Another jolt went down the back of Peter’s neck. “Ned, Colonel,” He said softly. “Run.”

 

As soon as the word left his mouth, the cacodaemon lunged. It moved unnaturally fast, pushing off with its back legs. It launched itself over the table separating it from Rhodes and Ned. Peter started forward, letting loose two webs. The first one hit it directly in the chest, knocking it out of the air. The second stuck right on its face, muffling the blood-curdling screech that followed not a second later. It writhed and struggled against the webs, and Peter hurriedly shot two more to anchor it to the ground. 

 

Stumbling in their haste, Ned and Rhodes following them to the exit, they piled into the elevator. Peter viciously jabbed the button to close the doors, eyes not leaving the creature as it began to tear at his webs. 

 

The doors slid shut just as it freed one of its limbs.

 


 

Cindy’s head snapped up at the sound. It was terrible, a bone-chilling scream that sounded grotesquely close to human. It echoed through the empty apartment they were in, coming from everywhere and nowhere. 

 

When the distant sound elevator doors dinged, Cindy jumped a foot in the air. She exchanged an uneasy look with Mal, who’s grip on the flashlight became white-knuckle tight. The agent took a deep breath before taking the plunge, stepping out of the apartment and into view of the lift. 

 

Cindy, after a moment to steel herself, went after her. 

 

Tony, Peter, Ned, and Rhodes spilled out of the elevator, shaky and horrified. “We need to find the others.” Tony said without preamble. “Now.” His tone left no room for argument, and Mal nodded. “Betty and Bridgette are around here somewhere. Come on.” She said quickly, not bothering to try and hide the distance she was trying to put between them and the elevator. 

 

Every corner they turned seemed darker and darker, the shadows cast by the covered furniture and their own bodies most twisted. 

 

The sound of two voices made Peter perk up, and Cindy watched as her friend tilted his head. She wasn’t sure if he was listening with his ears or that freaky sixth sense, but either way she was grateful of his ability to do so. 

 

When they stepped into the apartment the sound seemed to be coming from, they were met with the sight of Betty sitting on one of the dusty couches, Bridgette behind her, bobby pins in between her lips as she tucked in strands of Betty’s hair to an elaborate bun. 

 

“Sorry to interrupt,” Mal greeted. “But we’re getting the hell outta dodge.” 

 

Bridgette’s brows raised, but she placed the last bobby pin and nodded. “Is it just you guys?” She asked as Betty grabbed the flashlight. 

 

Rhodes nodded. “Everyone should be down below.” He said. 

 

As they stepped into the elevator, the four men tensed as they passed floor 92. Peter listened carefully, but he couldn’t hear a single thing from the lab as the car went down. He wasn’t sure if that was a good or bad thing. 

 

The common floor was empty. Mal swung the beam of her light back and forth, but the only sight that greeted them was empty couches. She took in a ragged breath before stepping out of the elevator. The second her foot touched the floor, a distant bang sounded. She flinched. 

 

Peter suddenly looked up, a look of dawning horror taking over his features. “Go, go, go!” He screamed, pushing everyone out of the elevator. They all tumbled out, and Peter slammed the button for the 93rd floor as he stepped out. The elevator doors closed, and a high pitched screech, like nails on a chalkboard, was sealed behind them. 

 

“Did…” Ned swallowed. “Did it get into the elevator shaft?”

 

Slowly, Tony’s lips parted. “One of the locks on the lab doors is broken.” He realized. Rhodey swore viciously. 

 

“I’m sorry,” Bridgette said, strained. “It?” 

 

Ned looked over at her. “We found the cacodaemon.” Was all he said, letting the expression on his face and the tremor in his voice explain the rest. 

 

Bridgette turned white and nodded quickly. “So, as long as nobody calls the elevator, it should be fine. Like Jackson said, those things can’t go through locked doors unless someone opens it for them.”

Nobody mentioned the fact that elevator doors being closed might not count as locked. 

 

“Okay,” Mal said after a second. Lee and Sally are somewhere in the stairwells. Charles, Dan, Abe, and Ross are all on this floor somewhere. Barnes and Jackson too. Ms. Potts and MJ are below, so they should be fine, since the elevator won’t go down there after they sealed it off.” 

 

Rhodey nodded. “We go for Jackson and Barnes first.” He said finally. “Jackson’s the one that can actually get rid of the damn thing. After that, we find the others. Good?”

 

He got a round of agreements, though none of them seemed to like it much. Betty shone her flashlight down one of the halls. “Let's do this, I guess.” She muttered. 

 

Not a single sound met them as they went down the corridor. Once again, Peter was unsure if that was better or not. They passed the living room, then the kitchen. It was at the gym they struck gold, almost running directly into Ross and Abe, who both seemed vaguely disgruntled. 

 

“Demon’s playing hard to get.” Ross said. “What are you guys doing here?”

 

“Demon’s trying to fucking kill us, Ross.” Bridgette said testily. “I get that the slutty spirit of Mr. Worldwide is coursing through your veins, but it’s not the time. We need to find the others and send that thing back to wherever the fuck it came from.” 

 

Mal looked taken aback at Bridgette’s language choice—she almost never swore. That seemed to get Ross on the same page, though, and he straightened up. “Right. Okay. Uh, Dan and Charles should be around here somewhere—”

 

It was almost like ripping tissue paper. The sound of shredding, effortless and pathetically easy, reverberated down the halls. Cindy, who was in the back of the group, turned around, the beam of light trembling in her hand. 

 

“It’s coming from the stairwell.” Peter whispered. Bridgette and Mal’s eyes widened. “Shit,” Mal hissed. “Lee and Sally are in there.” 

 

“Oh, Gods.” Tony whispered. A scream, this one decidedly human, erupted from the stairway. A door slammed open, so hard that it bounced off the wall. They didn’t even look at each other before breaking out into a sprint towards the stairwell entrance. 

 

Skidding to a stop around the corner, only to see Lee and Sally pressing their bodies up against the door, struggling against something on the other side. There was a thin stripe of blood across Sally’s arm. Another death-cry sounded from the stairwell. Peter lurched into action, sending a few webs to seal the door shut. 

 

Lee and Sally backed up from the door as it rattled from the force of the cacodaemon’s body. “Are you two okay?” Rhodey asked. Sally rubbed her arm. “If I get some weird Hell rabies from this, I’m going to be very upset.” She muttered in reply. When he looked to the other, Lee just shrugged, grip on his bo staff painfully tight. It was then that Peter noticed there was a gray sludge on it, almost like blood. 

 

The blonde man gave Bridgette a look. “And you said that bringing an actual weapon to Halloween would be weird.” 

 

She rubbed her temples. “In my defense, the reason you cited was a childhood staple of fending off wild animals.” 

 

Lee just shrugged. Then, “Hey, where’s Dan?” 

 

“With Charles.” Cindy supplied. 

 

“Where’s Charles?” 


“Oh, no idea.” 

 

Lee groaned, then looked around. “DAN!” He bellowed. 

 

Somewhere across the floor, a response. “WHAT?”

 

“COME HERE!”

 

“OKAY!”

 

Sally and Abe stared at him for a second. Lee just raised a brow. “What, you think I was gonna spend an hour looking for him? That fucker clearly knows we’re here, anyways,” He said, jabbing a thumb towards the webbed door. 

 

Dan and Charles came into view a second later. “Hey.” Charles paused and looked around at them. “What happened to you guys?”

 

Cindy sighed heavily.

 


 

Meanwhile, Percy and Bucky sat at the kitchen counter, silently going through the remains of the Halloween candy in the dark. Bucky unwrapped a Kit-Kat and shoved the entire thing in his cheek. “Hey,” He said, breaking the silence. “Do they still sell Coconut Groves?” 

 

Percy shook his head. Through a mouthful of M&M’s, he said, “Never heard of ‘em.” 

 

“Damn,” Bucky muttered as he unwrapped a Snickers.

 

A loud thud, followed by a guttural roar that raised the hair on the back of their necks. Bucky blinked. “That…doesn’t sound good.” He said. Percy shook his head. “Nope.” 

 

Another beat of silence. 

 

“We should probably go check up on that.” 

 

“Yep.”

 

They stood up, walking past the island counter that separated the kitchen from the dining room, when a stampede of footsteps grew closer and closer. Tony and Peter burst into the room first, followed by the SWORD agents and Peter’s friends. They were breathing heavily, and Percy could hear their hearts jackhammering in their chests, threatening to crack open their ribs. 

 

They stood in the doorway, catching their breath, before Ned spoke up. “That thing,” He said after a second, “Is not capturable.” 

 

“I almost pissed myself,” Sally said seriously. “I don’t know what kinda shit you think we’re capable of, but I’m calling my mom’s priest.” 

 

Percy raised a brow. “It’s, like, the size of a small dog.” He said flatly. 

 

The round of incredulous looks he got was tangible. “Do you know what a fucking dog is?” Tony burst out. “Christ, Jackson, that thing was bigger than me!” 

 

“That’s not hard, Tony.” Bucky inputted. Tony flipped him off. 

 

Percy frowned heavily. “Are you sure?”

 

“Yes,” Sally hissed. “Yes, I am sure.” She was holding the cut on her arm, and Percy took a step forward. “Is that blood?” He said, sniffing the air. Sally lifted her arm, and he ran his fingers over her skin with surprising gentleness.

“Something’s definitely wrong here.” He said after examining it. “What you guys described should have been basically harmless.” 

 

“Didn’t you see it?” Dan asked. 

 

Percy gave him a dry look. “No, no I didn’t. Summonings have a smell, though. I knew you guys called something, and what you guys said you did should’ve resulted in a demon that had the temperament and bite of a Yorkie.”

 

Bucky made a considerable noise. “Is there any chance you guys mixed up the summoning?” 

 

Cindy opened her mouth, then closed it. “No. We got it right. The first one was messed up, but we didn’t finish it. The second one worked perfectly, though. At least, according to WikiHow.” 

 

A beat. “The first one?” Rhodey repeated. 

 

Percy inhaled deeply. “You did a summoning and didn’t finish it?” 

 

“...Yes. But I’m getting the feeling the answer should be no.” Charles said. 

 

Percy leaned his face into Bucky’s shoulder and screamed. Tony winced.

 

“Alright,” Percy said after letting out his internal torment, Bucky rubbing a soothing hand on his shoulder. “I’m just going to tell you guys this now so you never do it again; when you summon something, the end is the most important part. The beginning forms the connection, but the end part of it is what specifies what you want.”  

 

Mal frowned. “What exactly does that mean?” 

 

Percy made a frustrated noise. “The first part opens the metaphorical gate, the where you're summoning from, and the last part is what directs what gets let through, the who you're summoning. So when you guys didn’t finish, it just…left a doorway open for anything to come through. Which, apparently, it did.” 

 

While that settled over them, Percy turned to Bucky. “Jamie, dear, how do you feel about fistfighting a demon?”

 

Bucky grinned widely. “Absolutely ecstatic.” 

 

“Woah, woah.” Tony said. “We don’t know what the fuck this thing is. I don’t think bare-knuckle bloody is the way to go here.” 

 

Percy waved him off. “Trust me, with my family, it’s always the way to go.”

 

“Family?” Mal repeated.

 

“Yeah, I’m definitely related to whatever’s trapped in that stairwell. Don’t know how, don’t really want to know how.” He turned to Bucky, holding a hand out. “Shall we?” 

 

Bucky laughed, surprising the rest of the group. Never had they imagined seeing the former Winter Soldier laugh, and especially not one as round and full as this one. He took Percy’s hand. “We shall.” 

 

Sally shifted slightly. “I hate to interrupt your guy’s romantic moment, but that thing is the thing of literal nightmares. Are you sure about this?”

 

Percy shrugged, pulling his sword out of its sheath. “Don’t worry about it.” Next to him, Bucky pulled out a long, curved blade to which Abe took a step back. “I didn’t just go as Batman to keep snacks in these pockets, you know.” 

 

The group easily parted for the duo, who walked down the darkened hallways. The group shared a few uneasy glances before grabbing their flashlights and following. As they trailed behind in the darkness, Cindy realized that while Percy obviously had no issues getting around, Bucky probably would. She shone the beam on the two of them, revealing how Bucky had an arm looped around Percy’s, letting the Enhanced guide him down the hallways. 

 

“Aw, that’s actually kinda cute—” An enraged roar cut her off. “Nope, nope, nope, not cute anymore.” She amended hurriedly, hiding behind the tall man with the staff—Lee? The door to the stairwell was still coated in Peter’s webs, but they were straining, some stands having fallen to the ground. 

 

The entire wall shook with the force the creature was using against the door, trying to break it down, to get at them. It let loose another high-pitched wail, and Percy stopped, his lips parting in recognition. 

 

“Perce?” Bucky asked softly. 

 

“Well, I know what you guys summoned.” He said quietly. “They’re creatures of the damned. Physical manifestations of tortured souls, of violence and pain and strife. These things aren’t supposed to be here.” 

 

“Christ,” Tony muttered.

 

“They’re so rare that they don’t even have names. There’s only one person who’s ever come into contact with one and survived.” He said. “And you guys trapped it in a stairwell.”

 

In unison, Sally and Lee shrugged unapologetically. 

 

Percy raised his sword—it was different than the one he usually carried. This one was a soft bronze color, and it glowed in the darkness, bathing his hands and face in a golden light. “This thing needs to go back, now.” 

 

Bucky nodded, and looked at the assembled people behind them. “It’s probably best if you guys step back.” Not having to be told twice, everyone stepped back. The SWORD members shifted in front of the AcDec kids, pushing them further towards the back wall. 

 

Satisfied with their distance, Bucky grabbed ahold of the webs with his vibranium hand and ripped them away in one, smooth motion. The door slammed open hard enough to rattle the walls, and the creature came spilling out. 

 

It was even worse looking, now. Its face was covered in its own imitation of blood, like it had been bashing its head against the door. Where there used to be nothing but smooth skin, thin, vertical slits ran up its maw. It swiveled around to regard them, then unhinged its jaw. As it did, the skin around it thinned out and ripped, splitting open to reveal a long row of teeth. The longer they looked, the worse it seemed to get. There were no gums or tongue, just solid, dark bone. 

 

It took one slow step towards the clustered against the wall. It didn’t have hands or feet, its limbs instead ending in sharp points. Then, Percy was there, his sword nothing but a glowing arc of bronze as he separated the offending limb from its body. 

 

The creature howled in agony, turning on him. The demigod grinned at it, lowering himself into a fighting stance. Behind it, Bucky flipped his knife in his hand, then ran at it, carving a long, deep line across its too-thin torso. Gray liquid rose up and spilled down, viscous and shiny. 

 

He came to stand next to Percy, both looking incredibly at ease in their proximity. Percy, sword and shield, Bucky, metal plated knuckles and a wicked blade. 

 

They watched in a mix of fascination and horror as they two battled the thing. The creature’s swings were wild and almost desperate, unhinged in a way that made Cindy shiver. It was strong and extraordinarily fast, with screams to raise the dead. 

 

Every time Percy brought his sword up, the creature shied away from the glow, like it knew what the blade could do to it. The demigod didn’t let up, pushing forward and downwards, not giving it a moment to rest. Bucky was beautifully brutal, decades of precision in each hit and jab. 

 

In a few minutes, there was nothing left but a disfigured corpse leaking gray. 

 

Percy leaned against the wall, taking a few steadying breaths. It was almost funny; he was still in his Wonder Woman costume, but now they all noticed how finely it was made, as if it was real armor. He wrinkled his nose at the viscera on his sword. 

 

Bucky, too, made a face at the mess. “I cannot believe you’re related to that.” He said with a frown. Percy ran a hand through his hair. “Trust me, it's really best to just not think about it.”

 

As the creature’s body cooled, the lights began to flicker on, illuminating the room in a way that, somehow, made the whole situation seem a little ridiculous. Abe and Betty stepped from around their human blockade to look at the body on the floor, disgusted curiosity written on their faces. 

 

Then, Percy tilted his head. “Hey, why did you guys summon this thing in the first place?”

 

“Oh,” Charles said easily. “We wanted it to judge who was the best minion. Only one of us could be King Bob, you know.”

Notes:

26 fucking pages of this bullshit

happy halloween, dipshits. im so tired.

so yeah all the other acdec kids showed up in a minion costume, had a fist fight, then decided summoning a demon judge was the only logical solution.
(they did summon a cacodaemon, the little weak sauce demon. it left while they were gone cause it got bored. they also summoned the Creature, though, and that stuck around.)

everyone fighting for their mf lives while percy and bucky snuggle and eat halloween candy is couples goals

lee is dressed more titans robin btw, not teen titans robin.
and percy is wonder woman. gal gadot wonder woman.
bucky is rob pattinson batman, minus the cowl

deleted scene:
the acdec kids, close to tears: are you mad at us
percy:
percy, sighing: no, no im not mad.

while all this is happening, pepper and mj are relaxing downstairs like the queens they are. they deserve it.

plumbing baby. goodbye.

Chapter 33: get a load of these losers

Notes:

yeah yeah i know i didn’t update this for a month, i was playing tetris ok

(See the end of the chapter for more notes.)

Chapter Text

spidey @spidey-official

life tip! If someone asks you what you’re doing, respond ‘orphan hijinks’, and they won't question you further!

 

You Know Who I Am @TonyStark

why are you like this

 

spidey @spidey-official

trauma 😜

 

mimi @wheresmybeans

in times like this i remember that not only do the avengers have twitter accounts, but so do i

 

james @jimmyjammy

mimi do not

 

mimi @wheresmybeans

@TonyStark do YOU have any life tips for us??

 

You Know Who I Am @TonyStark

don't do crack

 

mimi @wheresmybeans

alright then

 

mimi @wheresmybeans

@jbarnes tips tricks and hacks to share with the class?

 

scientists hate this local new yorker @jbarnes

beheading is generally frowned upon

 

scientists hate this local new yorker @jbarnes

also pokemon go SUCKS

 

meep @lowla

sergeant barnes has beef with nintendo??

 

You Know Who I Am @TonyStark

oh my god ignore him hes still mad

 

scientists hate this local new yorker @jbarnes

THE APP KEPT YELLING AT ME FOR PLAYING WHILE DRIVING

 

scientists hate this local new yorker @jbarnes

I WAS R U N N I N G

 

bearbi @bearbi3 

HFHFHJDSFKJDSBFKJDBV

 

scientists hate this local new yorker @jbarnes

DONT LAUGH AT ME IT WAS UPSETTING

 

scientists hate this local new yorker @jbarnes

IT KEPT HAPPENING

 

You Know Who I Am @TonyStark

jfc get off twitter and go do something

 

scientists hate this local new yorker @jbarnes

asshole

 

scientists hate this local new yorker @jbarnes

fine i guess ill just go find percy ;)

 

You Know Who I Am @TonyStark

stop. 

 


 

Ferris wheel fighter @ihatecarnivals

WHATS A PERCY

 

tony stark stan account @ilovehim

I HAVE NO IDEA

 

Bblimm @blooo

CODE RED PEOPLE CODE RED 

 

iron man <3 @starkswife

the WINKY FACE??

 

bearbi @bearbi3 

@spider-official please mr. man we need answers

 

spidey @spidey-official 

percy is mr. barnes boyfriend!

 

iron man <3 @starkswife

WHAT

 

You Know Who I Am @TonyStark

I’m sorry?

 

spidey @spidey-official 

??

 

You Know Who I Am @TonyStark

They're actually dating?

 

spidey @spidey-official 

yeah??? Theyre like super gross together how did you not know

 

You Know Who I Am @TonyStark

oh my god

 

You Know Who I Am @TonyStark

i thought they were just PINING LOSERS

 

spidey @spidey-official 

no they are

 

spidey @spidey-official 

oop

 

spidey @spidey-official 

[Video Attachment: The avengers common room is empty except for Bucky, who’s sitting on the couch reading a book, and Spider-Man, behind the camera.

Then, there’s a loud shriek coming from the distance. A moment later, Tony Stark enters the room, furious. 

“You SEDUCED my BODYGUARD?!?!” He yells. 

Bucky flips a page, looking incredibly smug.]

 

james @jimmyjammy

he looks so proud of himself–

 

spidey @spidey-official 

oh he is, he never shuts up about him

 

bearbi @bearbi3 

wait thats kinda cute though

 

james @jimmyjammy

could this be…couple goals?

 

james @jimmyjammy

whoever this boyfriend is, he's living his best wattpad life,,,bagged BUCKY MF BARNES, who's apparently whipped for him

 

bearbi @bearbi3 

you're right and you should say it

 

iron man <3 @starkswife

can we also appreciate TS’s  S C R E E C H

 

tony stark stan account @ilovehim

HE LOOKS PISSED LMAO

 


 

Trending

#BarnesBoyfriend????

#YouSEDUCEDMyBODYGUARD

#BuckyBarnes

#IronDad

#SpideyTwitter

#Avengers

 


 

Ferris wheel fighter @ihatecarnivals

Its been a couple hours

 

Ferris wheel fighter @ihatecarnivals

I feel like its safe

 

Ferris wheel fighter @ihatecarnivals

@JBarnes @TonyStark can we have some answers PLEASE

 

scientists hate this local new yorker @jbarnes

percy has a twitter but refuses to use it

 

scientists hate this local new yorker @jbarnes

but has agreed to answer a few questions on my account :)

 

bearbi @bearbi3 

!!!!! HI MISTER MYSTERY MAN !!!! whats is like dating a super soldier??

 

scientists hate this local new yorker @jbarnes

“terrible, he gets zoomies at two in the morning like my dog” rude as shit and also untrue. slander at its finest. 

 

spidey @spidey-official 

so you’re denying the fact that you and lea go on random runs in the middle of the night?

 

scientists hate this local new yorker @jbarnes

 

spidey @spidey-official 

yeah thats what i thought

 

Bblimm @blooo

SPIDEY TAKING NO PRISONERS

 

Ferris wheel fighter @ihatecarnivals

how did you guys meet?

 

scientists hate this local new yorker @jbarnes

“was there when he tried to murder my asshole boss” 

 

Bblimm @blooo

And thats what did it for you?

 

scientists hate this local new yorker @jbarnes

“yeah”

 


 

Bucky looked up from his phone. “Wait, what?”

 

Percy, curled up in between his legs, head on Bucky’s chest, hummed. “The whole mess on the highway when Hydra attacked Fury? I was standing on the sidewalk when it started, taking my sister out for ice cream. Fury’s SUV came careening down the street, blew up, and I grabbed her and got the hell outta there.” 

 

Slowly, it came to him. Bucky remembered that mission clearly; lining up the shot in time with his breathing, finger squeezing the trigger without hesitation. How he’d stalked to the car, ripped the door right off its hinges, a show of violent strength backed by a symphony of sirens and screaming. 

 

And, now that he’d thought about it, he remembered seeing a man, wide-eyed and face red from the cold. He’d cataloged dark hair, a thick sweater and jeans, and, just for a second, he’d made contact with a pair of unforgettably green eyes. The man had stood there, shocked still for just a second, before grabbing the girl and ushering her to safety. Away from the Soldier. 

 

As if he could hear Bucky’s train of thought, Percy lightly bumped his head against Bucky’s chest. “Not you.” He reminded. 

 

Bucky released a breath, the tension in his shoulders leaking out alongside it. “Not me.” He repeated. The arms around his boyfriend tightened slightly, and he rested his chin atop Percy’s head. “Not me.” 

 


 

annlis @anli

why do you refuse to use your twitter?

 

scientists hate this local new yorker @jbarnes

“too many buttons”

 

annlis @anli

king

 

piru @pirepiro

other than the zoomies, whats is like having a supersoldier bf?

 

scientists hate this local new yorker @jbarnes

“pretty neat. its nice dating someone who can just pick me up and take me places when i don't feel like walking.”

 

piru @pirepiro

🥺

 

annlis @anli

do you have any wisdom for the masses?

 

scientists hate this local new yorker @jbarnes

“sure. I'll tell you what my mom told me.”

 

annlis @anli

marry rich?

 

scientists hate this local new yorker @jbarnes

”kill people and sell their bodies.”

 

annlis @anli

well alright then

 

bingbongbeng @bennnnn23

why is barnes typing for you?

 

scientists hate this local new yorker @jbarnes

cause his arms are currently occupied with holding me, duh

 

scientists hate this local new yorker @jbarnes

“illiterate”

 

scientists hate this local new yorker @jbarnes

that too

 


 

spidey @spidey-official 

can i get an rip for mr. stark here

 

annlis @anli

Rip

 

Avengers!!!! @superherostan

rip 

 

piru @pirepiro

RIP

 

tony stark stan account @ilovehim

what happened???

 

spidey @spidey-official 

hes still losing his shit over the fact that he didnt know they were dating

 

You Know Who I Am @TonyStark

You say it like it was obvious!!

 

spidey @spidey-official 

ummm??? because it WAS???? they’re literally always with eachother, cuddle on the couches during movie nights, and bucky is literally always staring at him????

 

You Know Who I Am @TonyStark

and?

 

spidey @spidey-official 

They were holding hands when they came to dinner yesterday, percy told bucky he’d die for him 100% serious, and bucky shared his drink with him???? Percy called him jamie, bucky called him darling???

 

You Know Who I Am @TonyStark

THEY DID ALL THIS SHIT BEFOREHAND

 

spidey @spidey-official 

wait really

 

You Know Who I Am @TonyStark

YES

 

spidey @spidey-official 

oh jesus christ

 

You Know Who I Am @TonyStark

THEY ARE JUST L I K E  T H A T

 

You Know Who I Am @TonyStark

and i figured since bucky was STILL FLIRTING with percy, they hadn’t gotten together yet!

 

spidey @spidey-official 

HUH???

 

scientists hate this local new yorker @jbarnes

he needs to know i like him

 

You Know Who I Am @TonyStark

You’re dating.

 

scientists hate this local new yorker @jbarnes

so?

 

james @jimmyjammy

thats actually really cute

 

You Know Who I Am @TonyStark

yeah, you’d think so until you actually hear them

 

james @jimmyjammy

oh????

 

You Know Who I Am @TonyStark

[Video Attachment: It’s security footage of the common room. Percy is cooking, his face turned away from the cameras. Bucky is sitting at one of the barstools, reading. Then, he looks up. 

 

“Hey, do you have any Romanian in you?

 

Percy pauses for a second. “No.” 

 

Bucky hums and takes a sip of his drink. “Would you like some?” 

 

Percy walks into a counter.]

 

Bblimm @blooo

I-

 

Ferris wheel fighter @ihatecarnivals

NO CAUSE TELL ME WHY THAT WAS SMOOTH AS FUCK?????

 

scientists hate this local new yorker @jbarnes

im 106 not dead 

 

scientists hate this local new yorker @jbarnes

and even hydra couldn't make me forget how to be a whore

 

annlis @anli

im fucking SOBBING

Notes:

steve running around dc at 6 am is super soldier zoomies and nobody can convince me otherwise. bucky uses 80 years of accumulated stealth skills to get out of bed without waking his boyfriend so he can go RUN AROUND and JUMP and CLIMB STUFF-

remember way back at the end of demigods interlude when i wrote like, two sentences about percy being there when the winter soldier attacked fury? yeah.
percy: omg this guy just tried to kill my boss
percy: the boss who didnt believe me when i said hydra infiltrated and a bunch of people died and my life got a little ruined because of it
percy:
percy: give it, like, three years, and ill kiss him

queen sally jackson's life advice >>>

if you take one thing from this chapter, its that percy and bucky are fucking losers. they're so in love with eachother its gross. people see them and go 'oh my god, these pining dweebs, someone needs to set them up', but they've been dating for months. they're just sappy and gross.

plumbing baby. goodbye.

Chapter 34: local man uses twitter for evil

Notes:

(See the end of the chapter for notes.)

Chapter Text

ethically sourced sluts

 

vintage bi: barnes why do i hear mitski blasting from your room

 

antique gay: im SAD

 

antique gay: percy just said that he likes it when guys roll up their sleeves so he can see their four arms

 

antique gay: I ONLY HAVE TWO ARMS TONY

 

vintage bi: uh

 

antique gay: NOOOO

 

antique gay: I HAVE  O N E  ARM TONY

 

vintage bi: what the actual fuck is wrong with you

 

antique gay: IM SOBBING STOP BEING MEAN TO ME

 

vintage bi: forearms, barnes. not four arms. 

 

antique gay: 

 

antique gay:

 

antique gay: okay that makes a lot more sense but i still feel like you are being a little harsh

 

vintage bi: he’s blind. 

 

antique gay: fuck.

 


 

we had a bonding moment!!! i cradled you in my arms!!

 

Father of Five: for the love of the gods please go spend some time with barnes

 

crack dealer: ?

 

crack dealer: i literally just left to grab a snack

 

crack dealer: is everything alright? 

 

Father of Five: how long were you gone?

 

crack dealer: like five minutes im on my way back now why

 

Father of Five: i dont hate gay people but yall are so annoying god bless

 

crack dealer: ?????????

 


 

percy’s bimbos

 

president lincoln: does anyone know where peter is? 

 

nedleedle: yeah

 

nedleedle: hes on the front steps sunning himself like a lizard

 

mindiana jones: i was thinking cat, really

 

mindiana jones: but what do you need?

 

president lincoln: do you know if he wears his webshooters to school

 

nedleedle: what did you do

 

president lincoln: remember how cindy and i were climbing that drainage pipe and i scratched my arm and you gave me a paw patrol bandaid and told me not to pick at the scab

 

mindiana jones: oh my god

 

president lincoln: i am sitting in a pool of my own blood and the bandaid is no longer sufficient

 

nedleedle: and so you thought…webs?

 

president lincoln: yeah

 

president lincoln: i think i hit an artery please someone get peter

 


 

[Video: Tony, Rhodey, Bucky, Natasha, and Spider-Man sit at a long table in a room with a black backdrop. In front of each of them, there’s a container filled with slips of paper. 

 

Spider-Man: Hi! I’m Spider-Man,

 

Rhodey: I’m James Rhodes, also known as War Machine,

 

Natasha: Black Widow. Or Natasha, 

 

Tony: Tony Stark, Iron Man…

 

He trails off, and they turn to look at Bucky, who’s staring at someone behind the camera. He blinks and looks over. 

 

Bucky: What?

 

Rhodey: You’re supposed to introduce yourself. 

 

Bucky: Oh,

 

He turns to the camera, deadpanning. 

 

Bucky: Hi, I’m the only surefire way to snap your hyoid bone clean in half, Bucky Barnes. 

 

From behind the camera, someone lets out a loud bark of laughter. Bucky looks very pleased. 

 

Rhodey shakes his head. 

 

Rhodey: No, no, start over—

 


 

Bucky: It’s the guy who doesn't miss President Kennedy ‘cause his aim is perfect, Bucky Barnes—

 

Rhodey: I’m sorry?

 

More laughter from behind the camera. 

 


 

Bucky: Hey, it’s the Big Gulp you get behind the 7/11, Bucky Barnes—

 

Tony: NO

 

This time, the person audibly chokes and starts wheezing with laughter. 

 


 

Bucky, staring directly at the camera: You’re going to die in seven days. I’m Bucky. 

 

Natasha: Alright, that one was fine.

 

Rhodey: No, no it was not–

 

Whoever is behind the camera, they snort when they laugh, and Bucky’s face takes on an incredibly fond expression. 

 


 

Bucky: Named after President Buchanan because we’re both gay and unable to stop a Civil War, it’s Bucky Barnes—

 

Tony, baffled: Civil War?

 

Spider-Man: It’s what people are calling the parking lot fist fight. 

 

Tony looks slightly constipated. 

 


 

Bucky, put out: Hi. I’m Bucky. 

 

Tony: Christ, was that so hard?

 

Bucky: Well, excuse me for wanting some flair. 

 

Natasha, rolling her eyes: Right. Well, we’re the Avengers, and we’re here with Buzzfeed to read thirst tweets. 

 

She reaches forward to her bin and pulls one out. 

 

Natasha, reading aloud: ‘Does the Black Widow need a dog? Because I can bark.’

 

She looks up at the camera, face blank. 

 

Tony, stifling a laugh: Right. My turn. 

 

He clears his throat. 

 

Tony: ‘I know everyone keeps calling Tony Stark a dad, but what about daddy? Open your eyes, sheeple.’ 

 

Tony stares at it for a long moment before silently folding the paper and putting it down. He shakes his head. 

 

Tony, quietly: Why? 

 

Rhodey grabs a paper next. 

 

Rhodey: ‘I would put myself on a spit roast for James Rhodes, I’m tired of hiding my truth.’

 

Rhodey: …okay, uhm, thanks? I think. Yeah, thanks. 

 

Spider-Man, grabbing a paper of his own: ‘I bet Spider-Man is fucking adorable under that mask. Like, absolutely babey. I’m talking overwhelmingly adorable. I picture him and see an excitable golden retriever with Sticky’

 

Spider-Man buries his face in his hands while Tony laughs. 

 

Tony: He is! 

 

Rhodey, smiling: He’s got honest to God doe eyes.

 

Spider-Man, muffled: I hate you people. 

 

Bucky snorts. He unfolds a paper slip and clears his throat. 

 

Bucky: ‘I want to suck the SOUL out of james barnes, send tweet’

 

Bucky breaks out into laughter. 

 

Natasha: ‘Everyone keeps saying they have a crush on the Black Widow, but I would genuinely let her stab me. If she suffocated me I’d just be like ‘nice’ and tell her to squeeze harder’ 

 

Natasha tilts her head to the side. 

 

Natasha: Tempting. 

 

Natasha: ‘I would let natasha romanoff bend me over and snap my spine if it pleased her’

 

Natasha: I do not think it would, but I’ll keep it in mind, thank you. 

 

Tony: ‘how do people not moan when they fight iron man? genuine question’

 

Tony looks utterly defeated. 

 

Tony: I–I don't know? I’d really rather they didn’t, and I kind of hate this person for putting that image into my mind. 

 

Tony: ‘Saw a video of Iron Man bodyslam someone. Do—’

 

Tony takes a moment to collect himself. 

 

Tony: ‘Do me next daddy’

 

He shakes his head again and hides his face into Rhodey’s shoulder, who is fighting for his life to not laugh. 

 

Rhodey: ‘I want james rhodes to ruin my life, deadass, if you are reading this sir, im available literally any time you want’

 

He looks distraught, but carries on. 

 

Rhodey: ‘rhodes should snap me in half, light me on fire, and roast marshmallows over my burning body’

 

At this, he looks up at the camera. 

 

Rhodey: Haunted, you people are haunted. 

 

Spider-Man: ‘Spidey seems like he knows how to properly wash dishes and change a tire, I love him so much’ 

 

Though you can’t see his face, it’s clear that he’s beaming. 

 

Spider-Man: I do know how to do both those things!

 

Spider-Man: ‘Idk, spidey could take me out to dinner and engage me in polite and genuine conversation, generously tip the waiter, then walk me home any day. down horrendously bad for that guy’ 

 

Tony: Twenty bucks he's blushing under that mask. 

 

Natasha, shaking her head: No bet. He is. 

 

Bucky reaches in and grabs more papers. 

 

Bucky: ‘James Barnes looks like he could crush a watermelon between his thighs. If he can’t find a watermelon, my head is the same size please and thank you.’

 

Bucky: ‘Every day I wake up and resist the urge to lick james barnes’s biceps’

 

Bucky: ‘I’d climb James Barnes like a tree and never let go’ 

 

Bucky reaches into the bowl to grab more. Rhodey’s brows shoot up. 

 

Rhodey: You have more?

 

Natasha looks amused. 

 

Bucky shrugs. 

 

Bucky: ‘James Barnes should—’

 

Bucky’s eyes widen. He reads the paper again, then once more. 

 

Bucky: I’m not reading that out loud. 

 

Natasha leans over and pulls the paper from his hand. Similarly, her eyes widened. She methodically begins to shred the tiny paper into a thousand pieces, shaking her head. 

 

Bucky: ‘I’d let—’ Nope, no, no. 

 

Bucky: ‘If Bucky Barnes–’ Fucking Christ. 

 

Bucky: ‘Let it be known that—’ Dear lord. 

 

Natasha is still taking all of these and ripping them up, muttering about innocent eyes. Then, one of the producers walks on camera with a pile of papers and hands them to Bucky. Tony leans over the table to look at him, horrified. 

 

Tony: There are more? 

 

Bucky quickly shuffles through them, stifling laughter every now and then, brows raised comically. He finishes and just shakes his head, stunned silent. 

 

Producer, behind camera: Yeah, those just came in. There are dozens of them. All from the same account, too. 

 

Bucky: Wh–

 

He looks back through the papers and they are, indeed, all from the same person. Then, his narrowed eyes snap to somebody behind the camera. 

 

After a second, the camera is picked up and turned to focus on a man lounging on a chair—the one who was laughing earlier. His face is blurred out, but it’s clear that he’s on his phone. Twitter is open. 

 

The camera turns back to Bucky, who is staring at him, still in shock. 

 

The man laughs, sounding utterly and manically delighted. 

 

Unknown man: Consider this payback for all the pickup lines, Jamie. 

 

Bucky stands abruptly from the table.

 

Bucky: Those were shit one-liners! This—this is—I didn’t even know some of these sentences could be formed, how—

 

He waves the papers in frustration. The man cackles. 

 

Unknown man: ‘He needs to know I like him’

 

It takes a second for Bucky to realize he’s parroting his tweet from the other day. He’s rendered speechless. 

 

Natasha: I read one of them, and it was easily the worst sentence put together by the human mind. 

 

Unknown man: Thank you, it’s a gift. 

 

Bucky: You utter shit . I’m obsessed with you.

 

Bucky marches off camera. We don’t see what happens, but Tony’s eyes widen and he raises a hand to cover Spider-Man’s eyes. 

 

Rhodey gives a strained smile. 

 

Rhodey: Right. Uh, thanks for watching. We…we should probably leave them to this. Sorry to any production crew we’ve traumatized. 

 

The camera cuts.]

 

Avengers updates @avengersupdates

What a way to find out Black Widow is back! Jesus Christ. I don’t even know what to say about the rest of that. At least Barnes and his boyfriend are…in love? Stay turned for more news, I guess. 

Notes:

this is specifically to edene, who once told me 'idk, could be hornier' after reading one of my chapters. so, heres this, edene.

percy and bucky? so smart. honestly. but put them together and they are the dumbest mfs to ever walk the earth

bucky and/or percy as soon as one of them leaves the others presence for more than five minutes: screaming, crying, throwing up

i just know all the spidey thirst tweets are so incredibly respectful, hes just a little guy, big puppy vibes, and his 'thirst tweets' are literally just 'id buy that man flowers fr'

and yeah nats here now, i genuinely forgot to add that last chapter

poor producers, just trying to do their damn job while percy and bucky are making out on the floor. they're the real victims of this story

plumbing baby. goodbye.

Chapter 35: christmas 2: electric boogaloo - bucky gets into a knife fight with santa

Notes:

happy holidays everyone! this might just be the longest chapter i've ever written, so you better enjoy this

(See the end of the chapter for more notes.)

Chapter Text

It started out as a normal day. But then again, most of them did.

 

Bucky was up first, an hour and a half before the winter sunrise, carefully detangling himself from the sleeping furnace he shared a bed with. Percy’s face was mashed into a pillow, his hair sticking up every odd way, curled up on his side. Bucky gave his partner a fond look before slipping out from the covers. 

 

The cold air hit him instantly, and he moved to get dressed as quickly as he could without waking Percy. Mrs. O’Leary was watching him from her spot on the bed as he pulled on a pair of running shoes over his thick socks, tying his hair up and grabbing Percy’s old jacket from the top of the dresser. 

 

Soft brown leather, lined with fleece and fantastically warm. It fit Percy perfectly, like it was made for him. The strange part, though, was that even though Percy was a good half foot shorter and far narrower than Bucky, it seemed to be tailored to Bucky’s exact measurements as well. He suspected some sort of magic bullshit, which Percy had all but confirmed with how insistent he was Bucky wear it when he went out. 

 

That, and the fact that Percy had been wearing it for years, and there was not a single imperfection in the leather. 

 

If it was even leather, that was. 

 

Mrs. O’Leary sprang up from bed, stretching once her paws soundlessly hit the floor, and trotted after him into the elevator. Going on morning runs had become a routine for the two—Percy was most definitely not a morning person, and Bucky was all too happy to let his boyfriend sleep in. Gods know he needed it. Besides, Bucky had been waking up at six on the dot for eighty years—it was a habit he wasn’t getting out of anytime soon. 

 

He and Mrs. O’Leary made their way down Fifth Avenue and into Central Park, greeting the occasional other dog on the way. Though Bucky despised the cold, he couldn’t deny its beauty. The entire park was overlaid with a blanket of frost, turning the landscape grayscale, icicles hanging off tree branches glittering under the street lamps. Most of the paths were plowed and salted, but the majority of the grass was coated in a few inches of snow, which the hellhound eagerly dove in and out of, shaking off her fur and creating a tiny blizzard around her each time she returned to the path. 

 

They stayed out for almost an hour, until snowflakes began to spill out of the clouds. They melted on impact with the ground, but Bucky knew they would eventually pile up. When they returned to the tower, Mrs. O’Leary went straight to the kitchen to get some water, while he took a quick shower. Steam fogged up the mirror, and as he wiped it off, he could hear Percy shift under the covers. It was a funny thing that Bucky had discovered—Percy typically stirred whenever there was water moving nearby. He doubted the demigod even knew he did it, but he privately thought it was rather cute. 

 

He stepped out of the bathroom, dressed back in his pajamas and toweling off his hair. Percy was sitting up in bed, his hair even more messed than before, rubbing at his eyes. 

 

“Morning, love.” Bucky greeted as he came to stand by the bed. Percy’s face scrunched in displeasure. “What time is it?”

 

Bucky glanced at the clock as he sat on the mattress next to Percy, who automatically lifted the covers to accommodate him. “Half past seven.” He reported. Percy hummed and leaned into him, lightly bumping their heads together. As he did so, Bucky felt his hair instantly dry, leaving it fluffy and hanging in his face. In return, he kissed the tip of his boyfriend’s nose. 

 

They’d had a surprising lull in cases lately; no strange murders, no psychos with alien tech or superpowers—not even any Hydra activity, which left something satisfied in Bucky’s chest. By the time he was done with them, the entire organization would be nothing but script in a textbook. 

 

The next hour found the couple sitting at the kitchen island, eating banana and chocolate chip pancakes—bright blue, obviously—and then washing dishes in comfortable silence. Tony, dragging his feet and clutching a coffee mug like a lifeline, emerged as they were putting the final plate back in its cabinet. 

 

Bucky gave the engineer an amused look. “You alright?” 

 

Tony mumbled something in response. Percy rolled his eyes, and an unspoken message passed between him and Bucky. They moved at once; Bucky swooped in and took Tony’s mug from his grasp while Percy wrapped his arms around the man’s torso and began to drag him out of the kitchen. It took a few seconds before Tony even realized what was happening, and he gave Percy a mutinous look as he was deposited on the couch. Bucky dropped a blanket on the man, and Mrs. O’Leary hopped up on the couch to lay next to him. 

 

Even as he glared at the pair, he gave the hellhound scratches behind her ear. He was asleep in minutes. 

 

Vision drifted by to return a book he’d borrowed to Bucky, and the two chatted about it for a few minutes while Percy called his mom like he did most mornings. Pepper and Rhodes dropped in to check on Tony, smiling fondly at his sleeping form. Peter bounded into the tower sometime around ten, shaking snow out of his hair in a way that was reminiscent of Mrs. O’Leary. Natasha came up from the gym and commandeered the television, flipping on the subtitles and muting to let Tony sleep. 

 

All in all, a pretty calm day. 

 

Of course, that’s when FRIDAY spoke up.

 

Fifteen minutes later, they were suited up and on the streets of New York, braving the torrent of snow building up beneath their feet. Vision, Rhodes, and Tony were hovering a few inches above the ground, and Peter was crouched on Vision’s shoulders to avoid the snow. It left Bucky, Percy, and Natasha on the ground, the two assassins looking far more disgruntled about it than the demigod. Before they’d left, Percy had insisted Bucky wear his jacket, zipping it up to his chin and giving him a smile. 

 

Yep, definitely magic. 

 

Peter, Tony, and Rhodes all had insulated suits, and Vision didn’t really get cold. Natasha had exchanged her usual suit for thermal wear with a jacket overtop, even adding a knitted hat with the red hourglass associated with her on the brim. Somehow, she made it work. Both Bucky and Natasha wore thick snow boots laced up tightly, added on after they glanced at the forecast. 

 

Percy, on the other hand, was wearing his normal suit, everything but the tips of his fingers covered by a material Bucky knew wasn’t insulated for below freezing temperatures. But because it was Percy, he didn’t even seem to notice, and had no issue walking through the snow like the rest of them. 

 

Locating the disturbance FRIDAY had reported was easy enough—not even five minutes later, they spotted him. There was a man standing right by Pulitzer Fountain, in a blood red cloak that seemed to float around him unnaturally. Bucky squinted at the man and the strange golden glow that seemed to be emitting from his hands. 

 

Tony, naturally, was the first to speak up. “Man, what the hell are you doing?” He called out. “It’s freezing out, can you do this later?” 

 

The cloaked man turned towards them at the sound of Tony’s voice. He had a neatly trimmed goatee and was graying at the temples, and appeared to be wearing blue robes. Bucky squinted and began weighing the chances that this man was a cosplayer. Please, just a cosplayer. 

 

“It’s not quite what I’m doing,” The man replied snappishly, “But more what I’m here to stop. And I’ve got it under control. Go back to your tower.”

 

Tony and Rhodes exchanged looks. “Stop what, exactly?” Rhodes ventured. 

 

The man didn’t respond, his eyes narrowed and gaze sharp. He was staring right at Percy, who was heading up the back of the group. Bucky stiffened slightly and shifted to stand in between the two. 

 

“You,” The man said, low and dangerous, and Bucky’s hand slid to his thigh holster. “What did you do?” 

 

Percy tilted his head to the side, and Bucky could hear the frown in his voice. “You’re gonna have to be a little more specific, man.” 

 

The cloaked man didn’t seem to appreciate that response. He did a strange, choreographed movement with his hands, and a golden rope of light shot out from his palm, wrapping around Percy’s legs and yanking him forward. The effect was instantaneous, the assembled Avengers readying and aiming weapons while shouting warnings. 

 

The demigod hung midair upside down, eye level with the cloaked man, who leaned forward into his face. “Don’t play dumb with me.” He snarled. Another flick of his hands, and a golden halo wrapped around Percy’s shoulders, moving down across his head and taking his helmet along with it, exposing his face to the cloaked man. 

 

In synchronization, Natasha and Bucky flipped off their safeties. “Put him down.” Bucky ordered, voice as cold as the blizzard surrounding them, words accompanied by the whine of charging up repulsors. 

 

Percy’s brow was knit, face scrunched, obviously confused. The cloaked man, face dark and furious, leaned in further to scrutinize Percy. None of them but the apparent wizard were surprised when Percy lunged forward from his hold and sank his teeth into the cloaked man’s nose. 

 

The man howled and jerked back, the glowing cord around Percy’s legs flickering out and dropping him into the snow. Bucky was at his side in an instant, easily hauling him up and yanking him backwards, where Vision touched down and stood in front of the demigod. Bucky tackled the cloaked man into the snow, landing atop him and roughly jamming the barrel of his gun into the man’s temple. 

 

The man’s eyes were calculating, and Bucky bared his teeth like an untrained dog. “You think you can move faster than I can shoot? ‘Cause I don’t.” 

 

Webs shot forward and stuck the man’s hands to the ground, and Natasha crept forward to stand over the two, her own weapon aimed at the cloaked man. Vision still stood ready to grab Percy, just in case, and the two armored men didn’t waver in the aim of their repulsors. 

 

“You have no idea what you’re dealing with.” The man grit out. 

 

Bucky pressed the barrel harder against his skin. “Enlighten me, and maybe I won’t decorate the snow with the insides of your skull.” 

 

Before the man could speak, a deep roar reverberated across the streets, loud and powerful enough to seemingly shake the ground. Peter gave a full body flinch at the loud noise and the jolt of his sixth sense that accompanied it. The cloaked man closed his eyes, letting his head thump back into the snow. “That.” He said. 

 

“Fri—” Tony could be heard saying. The AI responded, though Bucky couldn’t make out the words from the suit’s insulation. Whatever it was, Tony made an aborted choking noise. The engineer turned to the cloaked man. “Alright, who the hell are you and what the hell is that.” 

 

The cloaked man eyed Tony cooly. “Dr. Stephen Strange, Sorcerer Supreme. And that is the temporal anomaly I was trying to prevent.” 

 

“And you tried to wreck my shit because…?” Percy ventured, arms crossed. Dr. Strange gave him a hard look. “Because there’s been a weird magical energy leaking all over the city since this morning, and you have the strangest aura I’ve ever encountered. I don’t know just what you are, but you sure as shit aren’t human.” 

 

Percy made a mutinous noise in the back of his throat. “Rude.” 

 

“I’m sorry,” Rhodes broke in. “Are you trying to tell us you’re a wizard?” 

 

“Sorcerer.” Strange corrected. 

 

“Jesus Christ,” Rhodes muttered. “Whatever. If you promise not to try and kidnap our friend again, we’ll let you up. Clear?” 

 

Strange cast a look at Percy’s unmasked face once more, wary. “Fine.” He agreed tersely. Bucky pinned the man with another glare before getting off of him, flipping the safety back on and reholstering his gun. He was at Percy’s side in a second, checking the demigod over worriedly. Percy submitted to his pokes and prods, exasperated but considerate to his boyfriend’s worry. 

 

Other than the snow in his hair, which Bucky gently brushed off, Percy looked no worse for wear than he did that morning. He still stuck close to the demigod’s side as Strange stood up, brushing himself off. He gingerly touched his nose, where bloody puncture marks had been made in the shape of Percy’s mouth. 

 

“Do I need to get this checked?” He asked warily. 

 

Tony clapped the man on the shoulder. “I’d double check that you're up to date on your shots.” He said cheerfully. “But that seems like a later type thing. What the hell is a temporal anomaly?” 

 

Strange adjusted the collar of his cloak. “It means that somebody was powerful enough to open a rift through layers of reality or time and bring something here. What were you doing this morning?” He said, immediately switching his gaze back towards Percy, who rolled his eyes. “Made pancakes and talked about Dance Moms with Natasha. I didn’t do shit, man.” 

 

Strange still seemed skeptical. “Let’s say I believe you. No missing time? You haven’t come into contact with anything odd?”

 

“Depends. How odd do you think Spider-Man’s skittle omelets are?”

 

The sorcerer looked mildly disgusted, but relented. “Even if you didn’t do this, you practically stink of magic in the way no man should. In the meantime,” He looked past the group. “I need to go take care of something.” 

 

“It’s we now, man. You yoinked him, you forfeited your right to be left alone.” Spider-Man informed him from his spot, now on Tony’s shoulders. Strange curled his lip. “I can handle this.” 

 

Another roar sounded, far closer than before. Strange turned his head to the side, eyes scanning the streets. The ground beneath them began to shake, a steady pounding that grew in strength as whatever had been summoned drew closer. 

 

It rounded a corner, and Bucky’s jaw went slack. The shadow alone casted by the creature stretched all the way across the street and onto them, making the environment seem just a little bit colder. Its footsteps were heavy, its cry loud enough to make Bucky cover his ears. Looming above them, an honest-to-God T.Rex threw its head back and roared, showcasing rows of curved teeth the size of Bucky’s arm. 

 

“You are about that?” Tony said weakly. “Because I may have a limited knowledge about dinosaurs, but I don’t think those ones are supposed to be that big.” 

 

As the beast grew closer, it became apparent that the animal was far too large for its size. The head alone was the size of a van, its legs three times the height of the people standing across the street. It looked unbalanced as it walked, lurching to the side as if not used to the new weight. 

 

“That,” Peter said quietly, “Is not what Jurassic Park told me those were supposed to look like.” 

 

“There is definitely something wrong with that.” Strange confirmed, looking a bit pale. “It’s saturated in a magic I’ve never even seen before. Whatever that is, it did not come from here.” 

 

“The dinosaur isn’t from New York?” Rhodes repeated. 

 

Strange broke his concentration on the dinosaur to look at Rhodes.  “Not from this plane.” He stressed. “I can’t even begin to imagine how to send it back.” 

 

“Killing it, then.” Natasha affirmed. Strange cast her a look over his shoulder. “You think you can kill that?”

Natasha was one of the most skilled fighters Bucky had ever come across. She spoke countless languages, was a brilliant actor, and was an expert spy and assassin. The Black Widow was a fearsome opponent who should never be underestimated. Despite all that, she was still a human being with a gun. 

Another thing that made Natasha the best of the best—she knew her limits. “No. I’m going to start evacuating the block.” She said plainly. Strange raised an eyebrow, and Natasha, along with the remaining Avengers, looked expectantly across the group towards Percy. “You up for it?”

 

The demigod grinned broadly, showcasing sharp canines that made Strange narrow his eyes. “I’m a little offended you even asked.” 

 

“I can use a ritual to get a better trace on where it came from, but it won’t work once it’s dead. It’ll take five, ten minutes tops.” Strange warned. Bouncing back and forth on the balls of his feet, Percy nodded. “You guys get everyone out of the block, I’ll entertain the dinosaur, Strange can do his magic detective work.” He paused, turning to the man. “Hey, can you turn stuff into pigs?”

 

“What? No.” Strange replied, baffled. 

 

Percy sighed, seemingly disappointed. “Alright. Let’s get going, then.” 

 

Natasha jogged across the street into the first storefront while Vision flew to the opposite side of the block and began to empty people out from there. Peter, Tony, and Rhodes started somewhere in the middle, clearing out civilians from the top down. It was startlingly efficient and oddly calm despite the very visible dinosaur stomping across West 59th Street right towards them. This wasn’t much in comparison to aliens, Bucky supposed. 

 

The supersoldier hung back for a moment, putting a light hand on Percy’s shoulder. “Are you sure about this?” He murmured to Percy. “I’m not doubting you, I just worry.” 

 

Percy gave him a soft smile. “I know. I’ll be fine, Jamie. Don’t worry your pretty little head.” He teased. “I get to fight a dinosaur, and then you get to go inside out of the snow. Win-win.” 

 

Bucky shook his head, an amused huff of laughter escaping him. “Right. See you in a few.” 

 

“Wish I could see the same. Love you!” Percy chirped back as he turned to meet the dinosaur rampaging across the crosswalk. Bucky stood there a second before smacking his palm into his forehead and jogging off to join the rest of the evacuation effort. He paused as he passed Strange, any trace of the adoration in his face wiped away. The supersoldier leaned into Strange’s space, shoulder to shoulder, not quite facing him as he spoke to his ear. “I have full faith in Percy,” He said, far too calmly. “But I want you to know that I broke out of eighty years of conditioning and torture for that man, and if something happens to him, not even your magic will be able to save you from me.” 

 

He didn’t wait for a response.

 

Strange shook his head as he made his way to the edge of the sidewalk, staring up at the mutated dinosaur. Now that he could get a better look at it through all the snow, he could tell it was a pale gray color, blending in quite well with the weather. There were spines along its back, short but sharp, and two-foot-long talons tipped its hands. 

 

Their saving grace, so far, seemed to be the dinosaur’s relatively short attention span. It pursued a fleeing civilian for only a moment before getting distracted and switching its attention to another one, snapping its enormous jaws at them as they screamed. Thanks to the quick evacuation efforts, it hadn’t gotten anybody yet. Yet. 

 

He watched as the man—Percy, the others had called him—walked right up to the creature. Strange began the spellwork, eyes flicking up to the action scene whenever he could. Runic work was always one of the hardest parts of sorcery. Everything had to be just right, from the angles of the lines to the size of the runes. He let himself sink into his work, the warm golden glow enveloping him as he constructed the ritual. 

 

Meanwhile, Percy, after a moment of internal debate, left his sword sheathed. It would be like trying to stab this thing with a toothpick, anyways. Instead, he reached his arms out, collecting flurries of snow that melted into long ribbons of water, twisting and slithering around his arms like serpents. 

 

All the buildings near them had been emptied out, and he could feel the mass of heartbeats moving the block over. Satisfied the area was empty, Percy moved his focus back to the dinosaur in front of him. Though the snow was falling heavier by the minute, it noticed him almost immediately. As it got closer, he noted its eyes, which were large and wide-set. Percy felt the moment it zeroed in on him, pointing to excellent depth perception. It sniffed the air, nostrils flaring. A good sense of smell then, as well. 

 

Strange added another layer to his tracing spell, linking runes together and forming an intricate design out of the chains they made. He risked another look up as the ground shook, the dinosaur stomping its foot as it readied to charge. It lowered its head and released a booming roar, strings of spittle flying out of its mouth and hitting the ground. 

 

Percy did not seem cowed in the slightest. Strange watched in a sort of sick fascination as the inhuman tossed his head back and released a guttural roar of his own, utterly animalistic in nature and deafening compared to that of the creature he faced. Instead of waiting for the dinosaur to charge, Percy ran at it in a full sprint. It met him halfway in the middle of the street. 

 

It happened alarmingly fast—the inhuman leapt upwards, far higher than the capabilities of any man, and grabbed a hold of the first curved spike that rested on the crest of the creature’s head. He hauled himself up, swinging his legs over it until he was sitting on the dinosaur’s ginormous head. Strange choked slightly, almost losing focus on his spellwork. The man let out a whooping laugh from atop the beast’s head, holding on by sheer thigh strength and nothing else. The dinosaur let out an enraged cry, furiously shaking its head from side to side to throw the inhuman off. 

 

He added another layer, twisting the golden threads into neat knots as he went. The next time he glanced upwards, there was a thick cable tied around the beast’s snout, holding its mouth shut, keeping it from snapping at evacuating civilians. When Strange squinted, it almost seemed to move, ebbing and flowing like water. 

 

He tied off the last layer, now standing inside a masterpiece of spellwork. It pulsed like a steady heartbeat, almost alive as it began the trace. Strange moved all his focus into keeping everything in place as it worked, holding it all together. 

 

Strange felt it in his core when the spell finished, the runes and cords losing their sheen as they died off. He then looked back up at the spectacle taking place in the street, trying to decide how to get the inhuman’s attention to tell him the spell had finished. Oddly enough, though, the man just seemed to know. With an unearthly grace, he swung off the dinosaur’s head and landed into the snow on his feet, completely unbothered by the significant fall he just took. 

 

The beast’s entire body shook, as if to make sure he was truly off its back before making another charge attempt. Like before, it lowered its head and fixed its eyes on Percy, but this time, the man stayed just where he was. 

 

It barreled down onto him, footsteps like thunder. Strange’s breath caught in his throat as it grew closer and closer, heart leaping. The inhuman’s grin was sharp, something wild contained in it. At the very last moment, he dropped down under the snapping jaw, barely missing the bite that instead turned the concrete of the Pulitzer Fountain to dust. 

 

The inhuman dashed forward under the dazed beast, wrapping his arms around its tree-trunk-thick legs. He pivoted on his heel, and to Strange’s horror, the beast was completely lifted off the ground, spun and then tossed into the air. 

 

It slammed into the snow-covered asphalt with an ear splitting crash, letting out an agonized cry as it lay there. The inhuman stuck out a hand and the snow it was laying on began to pick up, moving and swirling in mesmerizing patterns. It was hard to notice at first, how the individual flakes began to land on the beast’s belly, forming lines upon lines across the scales. The lines turned to thick stripes, coagulated and thickening until the powdery snow turned into shining ice, immobilizing the dinosaur further and anchoring it to the ground. 

 

Curiously, he did not turn completely to face Strange when he spoke, rather a bit to his left. “Do I have to kill it?” He asked hesitantly. “It’s…well, it’s kinda cool.” 

 

Strange floated forward, his cloak billowing around him as he surveyed the damage. “It tried to eat you.” He deadpanned. 

 

“If I held grudges against everyone who tried that, I wouldn’t have many friends.” 

 

Looking at the possibly demented man, Strange shook his head. He wasn’t quite sure what realm this inhuman was from, but Strange most definitely did not want to pay a visit. 

 

“I’m unable to send it back.” Strange said forcefully. “And either way, it’s been tainted by dark magic. That kind of thing takes its toll—it will decay over time, slowly and agonizingly. Putting it down now is for the best.” 

 

Percy looked surprisingly upset by that, but nodded. The inhuman didn’t even have to move to make the snow around them solidify into another shape—a long, inch-thick rectangle of glimmering ice, slanted at the bottom edge and wicked sharp. It was easily fifteen feet wide, made of perfect angles and straight edges. Percy sighed, and the guillotine blade came down and severed the beast’s head from its neck in one clean cut. As soon as it touched the ground, the blade dissolved back into snow. 

 

Blood spilled out in a tidal wave, staining the brilliant snow scarlet. The inhuman tilted his head to the side, crouching down and leaning close to the red slush, a confused-looking frown on his face. Strange edged around the massive corpse, larger than a double-decker bus, to get a look at whatever had caught the inhuman’s attention. But before he could get close, it began to dissolve, turning into a fine, dark powder and lifting up into the wind. The entire body was gone in seconds. 

 

Strange stared after it as it evaporated, a deep crease in his forehead. The inhuman, on the other hand, did not look the least bit concerned, as if massive beasts turning into dust was a normal occurrence for him. 

 

The other Avengers caught up to them in the next few minutes. Stark and Spider-Man touched down together, followed by Colonel Rhodes. Romanoff jogged up the next minute, and the Vision a second later. Barnes came last, going straight to the inhuman, clearly checking him over for any injury. 

 

As the group formed, Strange only got one snippet of the conversation between the two. “—they’ve never bled before, Jamie.” The inhuman was saying in a hushed voice. They were pulled apart by Stark’s metallic voice. “How was it?” 


Percy smiled broadly. “Fantastic, thank you for asking.” The engineer nodded before turning to Strange. “So,” Stark said, faceplate retracting. “Any leads on what the fuck that was?”

 

“I’ve never seen anything like it.” Strange said truthfully. “The fact that the body disappeared is…concerning.” 

 

“Disappeared?” Romanoff echoed skeptically. 

 

Strange gestured to the large depression in the snow where it used to be. “It dissolved into a black powder-like substance. Not a physical trace left of it.” 

 

“Black powder?” The inhuman interrupted, looking slightly troubled. 

 

“Black.” Strange repeated, exasperated. “However, the trace spell did work, and I should be able to track down the origin relatively soon.”

 

“How, exactly?” Stark asked. 

 

About to give a rundown of basic magical principles, Strange opened his mouth, but was cut off once more. “Nothing that has to be explained out here, I’m sure.” The inhuman said flatly. Oddly enough, all the others seemed to accept it easily, beginning to head towards the tower. Stark send Strange a grin before beckoning him to follow, his faceplate flipping back down as he turned away. 

 

Strange sighed and began to trudge after them.

 


 

 

To the Avengers’ credit, their common room was quite tasteful. The decorating was mild and inoffensive, a pleasant color scheme with a cozy, homey look to it. Most of the personality came from the personal effects strewn about the area, from the jumpers hanging over the backs of chairs to the textbooks scattered across the kitchen island. Christmas decorations were also up—a tree, decorated in an eclectic collection of ornaments, including a cheesy Iron Man one Strange doubted the man himself bought. Lights were strewn up around the room, and stockings hung from the fireplace. 

 

A large black Mastiff—perhaps a St. Bernard—was waiting at the elevator entrance, massive tail wagging as it caught sight of them. As they passed, each of the Avengers leaned down to give the dog a quick pat, and once the procession had all stepped over the threshold, it trotted after them. 

 

Stark’s suit practically melted off of him, folding inwards and curling off of his body like it was a second skin, seamless and fluid. Strange couldn’t help but stare at the marvel of engineering, and Stark caught his eye. The man gave him his signature grin, upturned and challenging. Everyone else went their different ways, Romanoff shaking snow out of her hair and muttering about finding fuzzy socks, Spider-Man off on a quest to grab a snack, Vision phasing straight through a wall, and Rhodes to call a contact to speak of the attack. 

 

The inhuman gently brushed a hand through Barnes’s hair, all of the accumulated snow miraculously falling out with his fingertips. The supersoldier regarded him with such fondness Strange was unaware his cold face was capable of. Before the two turned down the hall to go change, Barnes looked over his shoulder and pinned Strange with a vicious glare. 

 

Witnessing the interaction, Stark snorted. “Good luck with that one.” 

 

“What do you mean?”

 

The engineer cocked a brow. “Yeah, that’s the ex-Winter Soldier, and you just attacked his boyfriend. Again, I wish you the best with that.” Said Stark. “But, seriously, pull some shit like that again and I’ll melt your skin off your bones.” He added on lightly. 

 

“...Duly noted.” 

 

When they all reconvened, everyone was dressed down. Even Spider-Man had changed into pajamas and had just pulled his mask back on. Romanoff was sporting yoga pants and a sweatshirt, Barnes cargo pants and a sweater, the inhuman in sweats and a faded tee. 

 

They all looked remarkably comfortable, taking seats on the various couches and armchairs. Barnes and the inhuman were curled up together on the loveseat—Strange couldn’t help but notice the discarded wrist braces on the coffee table. Barnes was holding the inhuman’s hands in his own, thumbs rubbing his wrists soothingly. Interesting. So maybe the inhuman wasn’t as invulnerable as Strange had previously assumed. 

 

“The trace spell.” Stark prompted. 

 

“Assuming I’m right, which I typically am, whatever magic that was came from a different realm. Even my spells cannot be exactly precise from this far away. It will give me an approximate location that I can summon a portal to. From there, it will act as a compass to point us in the right direction. We’ll have to go on foot for a bit to get there.” He warned. 

 

He can’t help but glance back to the inhuman. His legs are curled up to his chest, and his head is leaning on Barnes’s shoulder. If Strange hadn’t been so closely attuned to the mystical arts, he would’ve said they looked normal, if not incredibly sappy. Barnes catches his gaze immediately and glowers at him. “Does the name Dormammu mean anything to you?” Strange asks, watching closely for any sign of familiarity. 

 

None come. “No…” The inhuman says slowly. “Why? Who’s that?”

 

“An interdimensional entity who rules over the Dark Dimension. Known as the Cosmic Conqueror, the Destroyer of Worlds. A few years ago, a sect of sorcerers devoted themselves to him in return for a fraction of his power. Bloodthirsty zealots who didn’t care in the slightest whom they killed.” Power hums beneath Strange’s skin as he scrutinizes the inhuman. “His magical signature is unlike any I’ve ever seen before. Except for yours.” 

 

The inhuman blinks. “I’m…I’m sorry about that. But I have no idea who this Domumu guy is.” 

 

“Dormammu, babe.” Barnes corrects. The inhuman just shrugs.

 

“All of his disciples had a rune carved into their foreheads. If what you say is true, then you won’t mind if I do a quick spell to burn away any illusions you may carry?” He tests warily. 

 

He receives a shrug. “Go nuts, man.” Barnes elbows his partner. “Percy!” 

 

“What? I don’t have a weird-ass face tattoo. I don’t mind if it makes this dude stop staring at me like he wants me under a microscope.” He defended. 

 

Rather than get within striking range of the inhuman’s untamed street dog of a partner, Strange gestured for the man to stand. “Right here, please.” He requested. To Strange’s slight annoyance, he stopped about a foot to the right of where Strange requested, but it was of no major inconvenience. 

 

The unveiling spell was one of the first ones Strange had learned after driving Dormammu away from Earth. He would never forget the entity’s face, its eyes that seemed to bore straight into his soul. Merely standing in front of Dormammu had made every hair on Strange’s body stand up, had quickened his pulse and made his throat dry. Master of the mystic arts or not, he was still just a man. And he’d known instinctively that this entity in front of him was far, far beyond him. Dormammu’s true power was beyond any human comprehension and imagination—the mere concept of attempting to him was impossible. Using the Eye of Agamotto to trap the entity was the only viable way out. 

 

Their only saving grace were the Sanctums. If Dormammu had no human emissaries to act through, he could not break through Earth’s defenses. And so Strange learned every spell he could to rip away one’s illusions to hide Dormammu’s mark so he could weed them out, had combined and overlapped them in the dangerous experiment of creating his own spell. The end result, through much trial and tribulation, was a revealing rune that would savagely shred any illusions, no matter the caster. 

 

Strange casted it with a smooth motion and a calculative stare as it formed. A simple flick of his wrist and the glowing symbol shot towards the inhuman like a bullet, slamming into his chest and knocking the air out of him. Time around them turned sluggish, thick and heavy. 

 

It began to peel off the man like a second skin, shedding and falling to his feet. Strange did not feel victorious at the thought of being right—the only thing confirmation gave him was ice cold dread. Layers and layers of concealment magic like he’d never before seen were torn up, revealing what lay beneath.

 

To Strange’s astonishment, it was not Dormammu’s sigil that was hidden. In fact, there was no mark at all carved into the inhuman’s forehead. The rest of his skin, on the other hand, was a completely different story. 

 

Brutal lines carved into his flesh now turned golden, microscopic particles of golden dust swirling beneath his skin. In all shapes and sizes, they stretched across him, peeking out from his sleeves and glowing from underneath his clothes. Scars, Strange realized, his trained eyes picking out each and every one. Not all of them had reacted oddly—some were just plain old scar tissue, like the one clearly from a bullet on his bicep. The illuminated ones, on the other hand, appeared to be from much stranger things. Claws, teeth, and strange, jagged weapons. Shining through the inhuman’s shirt, almost blinding, was a large knot of scar tissue. To be that old and still that size, he must’ve been impaled by something the size of a telephone pole.  

 

The dichotomy between the mundane marks and the golden ones was extraordinarily odd, and Strange’s curiosity only grew. Jagged lines, thin in some places and gaping in others, also wrapped around his skin. Particularly around his ribs, though a few on his left leg and right wrist. Strange had been a world-renowned surgeon—he knew what a compound fracture looked like, and these lines looked exactly like where the skin would be broken. His eyes flicked back to the inhuman’s ribs, and he almost gagged. If his theory was correct, at some point in time, his ribs would have been broken badly enough to have almost each and every one sticking out of his body, like something had picked him up like a ragdoll and squeezed. Strange shivered. 

 

However bad he thought the body was, though, the face was far worse. Black hair had been endlessly deepened, seemingly sucking the light out of the room, inky as the depths of the ocean. A sole gray streak up front, pale and lifeless in comparison. Strands stuck up on end and floated as if he was underwater, unnaturally framing his face. The scars around his eyes that Strange had barely even noticed earlier were bloody and raw, as if someone had taken a blade to the inhuman’s face and carved out the skin, revealing bloody tissues beneath. Slightly sharpened teeth had been replaced with massive fangs, curved and serrated, dozens of them in razor-sharp rows. And his eyes. 

 

His eyes. 

 

Any traces of sclera and pupil were gone. Taken over by swirling blues and greens, thousands of oceans churning in between lash lines. Waves crested with brilliant shocks of white, rain pounded noisily onto the surface, lightning striking against the water. Rivulets of entire seas ran down his face, catching in the seams of his lips and dripping down his chin. It was bright enough to blind a man, dark enough to turn him insane. 

 

This inhuman, this being, was no zealot of Dormammu’s. No, Strange likened him more to the Destroyer of Worlds himself. But unlike the ruler of the Dark Dimension, when Strange looked at him, he did not feel any semblance of the terror Dormammu gave him. No unfamiliarity, nothing unrecognizable. Nothing strange or foreign, nothing unknown. 

 

When Strange looked into this being’s eyes, he instinctively knew that this was familiar—deeply, undeniably so. He stared into his face and the primal sources of the Earth stared back, the very fabric of this dimension reflected in his infinite eyes. Despite never even hearing of a creature such as this, Strange knew that whatever stood in front of him, it belonged here, far more than the rest of them ever would.

 

The ancient arcane arts were lost to time, nothing but a whisper in the wind, but Strange had no doubt he was staring at them right now. He understood in a way he never had. He heard the arcane in the rolling thunder and snapping lightning, saw it in every tide and quake that shook the ocean floor, smelled it in sea salt. 

 

Time snapped back like an elastic, and all of that was gone. Like it had been wiped away, the layers of illusionary magic crawled back up the inhuman and rested comfortably on his scarred and weathered skin. Strange felt like the breath had been stolen from his lungs as he continued to stare, transfixed at the being in front of him. The inhuman was rubbing his chest where the rune had hit, looking a little confused but no worse for wear. 

 

For the rest of the group, it had barely been a blink of an eye, but it had felt like an eternity of Strange. From the couch, Barnes was glaring at him even as he held an arm out for the inhuman to sit under, pressing back up to his side. “Satisfied?” Barnes snapped. 

 

Strange nodded, still shellshocked. “Yes.” Is all he offered. He turned back to Stark, who was looking at him like he knew something. Far too smart for his own good, that man was. 

 

“When do we leave?” Romanoff asked, leaning forward. “As soon as you get dressed. I can’t get an exact reading,  but I’m able to get a vague impression of where the portal will lead us before I open it. And wherever that is, it’s quite cold.” Strange answered easily. He had countless wards at his disposal to keep himself warm, which he could extend to the others in case of emergency, but he’d rather save up his energy for whatever they found and keep that as a last resort. 

 

Barnes groaned aloud and buried his face in his partner’s shoulder. The being, Percy, he called himself, ran a soothing hand through the supersoldier’s hair. “Sorry, Jamie. We can stay home, if you want.” He offered. 

 

From what Strange had heard, the man had been cryogenically frozen on and off for over eighty years—if that didn’t cause an aversion to the cold, he had no idea what would. Perhaps he could cast a warming spell specifically over Barnes. He doubted he’d let him, though. 

 

“It’s fine,” Barnes muttered. “I’m stealing your fuzzy socks, though.” Percy kissed the crown of his head. “Whatever you want.” He sounded like he truly meant it, too. 

 

Sickeningly sweet...and strangely human. 

 

Once more, Strange and Stark were left alone as everyone wandered off to hunt down even heavier winter gear. “Not wearing a coat over the suit?” Strange asked wryly. 

 

Stark’s smile crinkled the corner of his eyes. “Don’t need to.” He said simply. “I’ll be fine in there.” 

 

“With a power source like that, I don’t doubt it.” It was the raw truth—Strange had never been a huge follower of the tech industry, but even he couldn’t continue looking in other directions when Tony Stark returned after three months of abduction, shut down his company’s most profitable venture, and started churning out clean energy sources decades ahead of anybody else. 

 

He’d met Stark once before, many years before the world had even heard of Iron Man. What Stark had been doing at a neurosurgery conference, he’d had no idea, but hadn’t really paid much thought in favor of preparing for his speech. At the very end, Stark had raised his hand and asked a single question. Strange didn’t exactly recall what it was, but he remembered being surprised at how well thought out it had been. After that, the man had nodded and leaned back into his chair, letting the other attendees ask their own questions. 

 

It had been quite different from what was said about Stark—there was no arrogance there, no carelessness nor selfishness. Confidence, sure, but the easy, earned kind. Strange hadn’t thought about it a moment longer, and now he kind of wished he had. 

 

That got him another smile, Stark’s hand unconsciously coming up and rubbing at the blue circle of light shining faintly through his thick sweater. Then, that same hand extended. “Nice to officially meet you, Strange.” He said. “You aren’t bad when you’re not doing a claw machine impression with my friend.” 

 

Strange smiled. “I apologized,” He said, shaking his hand firmly.

 

“Did you?”

 

“I’m taking them on a field trip, am I not, Stark?”

 

Stark laughed. It was a pleasant noise, Strange found. “I suppose so. And it’s Tony.” 

 

“Stephen, then.” He insisted in return. 

 


 

Percy was a little bit stressed, alright? He knew James didn’t do well in the cold, plus Peter had a few thermoregulation issues, and wherever they were going was apparently cold enough to warrant multiple layers and boots with ice cleats on them. It wasn’t the actual journey he was worried about—Gods know he’s been on far worse quests to mysterious locations. But he could hear Tony about to have a conniption about shoving Peter into a parka, and James, no matter how much he loved him, was a stubborn asshole sometimes. 

 

“You really don’t need to do that.” The man himself commented as he tied his boots. Percy tossed a glare in his vague direction as he shoved another scarf into his bag. “Shut up.” 

 

Bucky sighed dramatically and leaned back on their bed. “You’re doing something nice but you’re so mean about it, it’s honestly astonishing.” 

 

Percy throws a balled up sweater at his head. The supersoldier laughs, and it lightens something in Percy’s chest. 

 

Bucky watches as he packs his backpack, quickly and efficiently. The bottom layer is a spare sweater, hat, gloves, along with a scarf. Then medical supplies, followed by bottles of water, packets of carrot sticks, apple slices, and granola bars on top. The next pocket over has a few emergency supplies; stuff to start a fire, multi-tools, flares, what may or may not be a grenade of some sort, and rope. Percy shoves a few spare blades and extra ammo for Bucky in, then some treats for Mrs. O’Leary. A flashlight, duct tape, and a tupperware filled with smooth white orbs the size of apples. 

 

“What’s that?” He asks, leaning forward to get a better look. 

 

“Pig balls.” Percy says simply. “Lou Ellen made me some.” 

 

“Pig balls?” Bucky repeats incredulously, grinning. 

 

“Explodes and turns people to pigs.” 

 

“...Is that why you asked Strange if he could do that?” 

 

A smile creeps up on his face. “Maybe. I mean, he calls himself the Sorcerer Supreme, but he can’t turn people into pigs? My cousin can do that, and she doesn’t even have a fancy cloak.”

 

“Gods, I adore you.” Bucky blurts out. Percy perks up and leans over to peck him on the lips. “The feeling is mutual. Pass me the pack of tissues over there?” 

 

He does as requested, and Percy shoves them into his bag. “You must do this a lot, huh?” Bucky notes. “Packing for a quest, or whatever.” 

 

Percy nods as he zips it up. “I guess. You just get into the habit of making sure you have everything, cause if something can go wrong, it probably will.” 

 

“That’s a terrible motto.” 

 

“It’s true,” Percy corrects. Bucky shakes his head and pushes off the bed to stand. Percy slings his backpack over his shoulder and stops in front of Bucky. Like he had earlier, he catches the bottom of his jacket and zips it right up to Bucky’s chin, fingers spaying across his collar. Bucky can’t help but smile and leans forward to press his forehead against Percy’s. “Are you ever going to tell me what it is about this jacket?”

 

Percy hums. “How nicely are you gonna ask?”

 

Bucky leans forward and kisses him soundly, free hand coming up to thread through his hair. “Really nicely.” He can feel the curve of Percy’s smile against his lips, the mock exasperated sigh he exhales. “Well, as long as it’s really nicely,” He drawls out. “Nemean Lion skin.” 

 

Then, he steps back, adjusts his backpack straps, and walks out of the room to go grab his boots, leaving Bucky rooted to the spot. “Nemean Lion?” He echoes, dumbfounded. “Like the one Hercules wore? Percy? Am I wearing what fucking Hercules wore? Percy!”

 


 

Bucky kept shooting Percy skeptical looks out of the corner of his eye, Peter couldn’t help but notice. The demigod looked slightly smug, the corner of his mouth twitching upwards every time Bucky squinted down at the jacket he was wearing. It was Percy’s, the one he’d lent Peter a couple times. Underneath, Bucky wore a long sleeved shirt and lined gloves, along with a pair of thick pants and snow pants overtop those. Percy had even forced the man into a scarf and hat, and there were goggles around his neck. 

 

Peter, on the other hand, was dressed rather oddly. He was in his suit, sans mask, which did have a heater on its own, but Mr. Stark had harassed him into wearing snow pants, a parka, and boots overtop. “I made that suit for cold New York nights, not subzero bullshit.” The man had muttered, which was followed by, “I have a heart condition, Pete, put the damn boots on.” When he’d first emerged, Strange had done a double take at seeing his face. Peter knew Mr. Stark had thoroughly threatened the man to not tell anyone, so Peter wasn’t really concerned. 

 

The Iron Man suit was much thicker, and especially with the nanotech Mr. Stark had been working on, Peter knew the man would be fine. He was wearing clothes suited for the weather underneath, anyways. A sweater in his signature red, thick pants, and boots.

 

Natasha had done her hair in a long braid, pulled a hat on, and had a parka with a red hourglass embroidered on the bicep, which was very cool. Her gloves were nicely made, and her boots perfectly tied. She, like Bucky, had a pair of goggles hanging around her neck. 

 

Percy stuck out like a sore thumb. He was in cargo pants which tucked into his boots, a sweater and unzipped jacket, his wrist braces, and a hat Peter knew his mom had made him. No gloves, no scarf, no coat. The only thing appropriate for the weather he had on was the ice cleats on his boots, but Peter genuinely believed that was just because he wanted to kick someone while wearing them. Even Mrs. O’Leary, standing next to him, was wearing a XXL Christmas sweater and boots. 

 

Strange gave the man a considerate look, but ultimately shrugged it off. Peter wasn’t quite sure what had passed between the two when Strange cast his revealing-thingy, but there was no doubt in Peter’s mind something had. 

 

The wizard dude had, apparently, opened a portal back to his own home to change, and had abandoned his wizard outfit for cold weather gear of his own. The brilliant red cloak, though, still sat on his shoulders, now just overtop his jacket. He looked strangely normal like that, and Peter couldn’t help but stare. 

 

Ultimately, Vision and Rhodes had decided to stay home—Vision to fight another dinosaur if one showed up, just in case, and Rhodes to deal with the mountain load of paperwork that was apparently generated by the appearance and subsequent takedown of a dinosaur. 

 

Mr. Stark looked everyone over, a slightly pained look on his face when he saw Percy’s lack of heavy duty clothes. “Everyone ready?” He checked, looking at Bucky the longest. “You better have a lotta layers, Barnes, because if you even shiver, I’m pretty sure that one is setting the nearest thing on fire.” He said, jabbing a thumb in Percy’s direction. 

 

Natasha snorted. “You got gasoline in that bag of yours, Jackson?” 

 

The demigod snorted derisively. “Only amateurs need accelerant.”

 

Everyone looked a little wary at that, and everyone but Bucky inched away from the man. Peter really needed to get Ned on trying to unearth Percy’s criminal record. 

 

Strange eventually cleared his throat, and Peter watched, mesmerized, as the man moved his wrist in a circular motion. Orange-gold sparks appeared in the air, swirling and spitting, widening up with each rotation. The cold air blasted them the second the portal was wide enough for it to slip through, icy and stinging. It lowered the temperature of the entire common room in just a few seconds, and Peter huddled closer to Mr. Stark. 

 

With a dramatic swish of his cloak, Strange stepped aside and gestured to the portal. “After you,” 

 

Mr. Stark gave a mock bow. “Why thank you.” He stepped through it, immediately beginning to look around the area. One by one, they all filed after him, carefully stepping in and making the transition from hardwood to snow-covered ground. 

 

As soon as he touched the snow, Peter shivered. It wasn’t the cold—everything just felt…off. And not in a bad way, per se, but somehow, he just knew that wherever they were, it was different. Mr. Stark gave him a concerned look, but Peter flashed him a thumbs up and continued looking around. 

 

They were surrounded by sky-stretching evergreens, trunks wider than an SUV, tall enough to brush the clouds. The scent wasn’t overwhelming like he expected; it was actually rather pleasant. For one of the first times in his life, when Peter inhaled deeply, the stink of city smog didn’t coat his nostrils. 

 

Snow fell undisturbed around them for as far as the eye could see, a white blanket over the forest. Most of the animals were taking shelter in their dens, hiding away from the weather. Everyone, even Nat, was craning their necks up at the massive trees, lips parted in awe and visible breaths puffing out of their lips. Percy’s eyes were closed, snow landing on his lashes. Peter wondered what this was like for him—if water was a large part of how he saw the world, was the snow making everything better? Peter hoped so. 

 

Strange broke the reverie they’d fallen into. He waved his hand, and the portal behind them collapsed in on itself, solidifying into a sole line of light with an arrow at one end. It spun in place as it oriented itself, before snapping to attention and pointing to their left. 

 

“It might be best if you all grab a partner, just in case. Visibility may get worse.” Strange warned them as he looked around. From the back of the group, Percy grumbled. “Oh no, my visibility.” Bucky smacked him on the arm, but then grabbed his hand. He figured Mr. Stark would want to be partners with Strange—they seemed to get along fairly well, so Peter turned his head to look for Mrs. O’Leary, but instead found Natasha. She was grinning at him, her brilliantly red hair a pop of color on the white and green landscape. “Team arachnid?” She offered, holding out a fist. Peter beamed and knocked their knuckles together. “Team arachnid!” He agreed enthusiastically. 

 

Mrs. O’Leary was an independent woman and he would only slow her down, anyways, Peter thought as he watched the hellhound begin to scale one of the massive trees. 

 

Strange and Mr. Stark headed up the front of the group, Peter and Natasha in the middle, and Bucky and Percy in the back. He could catch Mr. Stark and Strange talking as they went through the snow, though he couldn’t catch exactly what about without purposefully eavesdropping. Natasha asked him about his patrols after a few minutes of silence, and he ended up recounting all the nice people and cute animals he’d met over the years. Percy and Bucky seemed content to walk in relative silence, but they never let go of each other's hands. It was so cute it was kinda gross. 

 

They followed Strange’s spell for almost half an hour before Percy spoke up. “There’s stuff up here.” He announced, head tilted. “Like…a town, maybe? Buildings. People, definitely.” 

 

Strange gave him an interested look. “How did you do that?” Any hostility between the two seemed to have vanished, leaving only Strange’s curiosity. 

 

Percy just shrugged. “I just can.” Strange, to his credit, left it alone after that. And, sure enough, about ten minutes later, Peter was able to smell the smoke of wood fire and hear the distant chattering of voices. 

 

The village itself was nestled in a large clearing, mostly hidden by a thick curtain of pine needles and thick trunks. Peter counted about two dozen buildings at first glance, arranged in a two-layered circle. At the center, a massive hearth sat, stocked with logs thicker than Peter, crackling and spreading warmth throughout the entire clearing. 

 

As they got closer, his breath caught in his throat. Each house was built out of expertly cut logs, icicles hanging off the roof. Designs on the roofs and outer walls were done in white, giving each building the appearance of a gingerbread house. People milled about, dressed in shades of red and green, cable-knit sweaters and thick, bundled up scarves. A reindeer was hooked up to a wagon full of firewood, and a group of small children huddled around it, feeding it carrots. 

 

“Hello!” A jovial voice called out. The source, a tall, older woman in a cherry-colored sweater waved at them. As she approached, Peter couldn’t help but notice her hair, from the twin plaits tied off with bows to her eyelashes and brows, were the same color as the snow. It was striking, and strangely beautiful. “What brings you to this neck of the woods?” She asked as she got within normal hearing range. 

 

Bucky, ever polite, smiled back at her from the back of the group. “We were looking around, ma’am, and stumbled across this place. Awfully pretty.” He complimented. The woman cooed at him. “Aren’t you nice? Well, you’re all welcome here. Truth be told, it’s been a while since we’ve had any visitors in our neck of the woods.” 

 

Peter grinned. “Thank you, miss.” She waved him off. “It’s no problem, sweetie. Here, I’ll show you around.” She offered. 

 

“We don’t want to be any imposition.” Bucky protested. Once again, the woman dismissed it. “No such thing. Come, come, my wife just made an excellent batch of hot cocoa, and we’d be delighted to share.” 

 

After a shared glace, they followed her into the village. It was even more picturesque up close—twinkling fairy lights lined windows and doorways, ornaments hung from the smaller trees dotting the pathways, and every single mailbox was painted with candy cane stripes. The group got led to the village center, to the bonfire, where a woman was stirring a large pot with a ladle. 

 

Around them, the other townspeople stood in small groups, all sipping from steamy cups. Noses and ears were red, but their smiles were blinding. Kids ran around, seemingly playing tag, weaving in and out of the adults’ legs. All of them had snow-white hair, lashes and brows too, blending into the landscape. 

 

“Cynthia, dear! We have visitors!” The woman who greeted them called as they approached. Cynthia looked up, her face brightening at the sight of her wife. “Wonderful! Grab them some cups, would you, Ella?”

 

The woman who greeted them—Ella, apparently—stopped by a table set up in the frozen grass and grabbed six cups from the stack. Her wife filled each one and handed them back, looking up at the group. 

 

His spidey-sense was extraordinarily quiet, so Peter took a sip. It was, like Ella had said, fantastic. Cinnamon-y and rich, but not too sweet. “Thank you,” He chirped. The two women smiled at him. “Glad you like it.” Cynthia said. “Now, I believe introductions are in order. You already met Ella, and I’m Cynthia. It’s a pleasure to have you.” 

 

Peter grinned back. “Thanks for having us. I’m Peter! This is Percy, Bucky, Natasha, Mr. Stark, and Dr. Strange.” 

 

Mr. Stark rolled his eyes fondly. “You can call me Tony, please.” 

 

“And Stephen is fine.” Strange input. 

 

It was then that one of the kids, engrossed in an intense game of tag, tripped and barreled right into Percy. He must not have been expecting it, because he lurched to the side, the steaming hot cocoa in his cup spilling over the side, threatening to upturn all over the kid’s head. It happened so fast that even Peter barely caught it—both Percy and Bucky’s hands shot out. Bucky’s caught hold of Percy’s jacket, keeping him from stumbling, and with Percy’s outstretched fingertips, the cocoa stayed suspended in the air, like it had been flash frozen. 

 

In the blink of an eye, the cocoa returned to Percy’s cup, and he bent down to check on the kid. Not fast enough to escape Ella and Cynthia’s notice, who were now staring at him with wide eyes. 

 

“You alright?” Percy asked gently. 

 

The girl who’d bumped into him sniffed. “‘M okay. I didn’t mean to make you fall. I’m sorry,” Her voice was wobbly, like she was going to cry. 

 

Percy’s face softened further. “Hey, hey, it’s okay. Don’t worry about it. No harm done, see?” He said, gesturing to himself. The girl sniffed louder, looking unconvinced. Percy leaned in, dropping his voice to a whisper. “In fact...you wanna know a secret?”

 

She looked up at him and nodded, eyes wide. Percy smiled. “I fight monsters for a living. And while you’re pretty strong, you’re no monster. I like to think I’m quite tough, so, really, don’t worry about it, alright?”

 

This time, the girl smiled. “Really? Monsters?” She asked excitedly, all traces of tears vanished. Percy nodded solemnly. “Monsters.” He agreed. “But that’s our secret, right?”

 

“Right.” She said instantly. Then, she squinted at him, standing on her tiptoes to get a better look at his face. “You have hair like me!” She chirped excitedly, turning to face Cynthia and Ella. “Look! Look, he has hair like us!”

 

Ella crouched down to get on the girl’s level, looking at Percy, the pale streak in his hair being ruffled by the wind. “Indeed he does!” Ella overdramatized. “And it looks quite fetching, does it not?”

 

“Very pretty!” The girl agreed. Percy turned scarlet, and Bucky snickered. “Sorry again, mister.” She said before running off. Bucky hauled his stunned boyfriend to his feet before lightly tugging on the pale streak in his hair. “Very pretty.” He echoed. Peter didn’t think it was possible, but Percy flushed further. 

 

Cynthia snorted, covering her mouth with her hand. “You all are an interesting bunch, aren’t you?”

 

Bucky shrugged. “We try.” 

 

“So, what really brings you here? You…obviously aren’t from around.” Ella asked, no doubt having seen Bucky’s metal hand when he helped Percy up, plus the whole hot cocoa incident. There was no malice nor skepticism in her voice, just curiosity. 

 

“Well,” Nat said, digging for her phone. “We’re looking for something. Have you seen any creatures like this around?” She held it up, a photo of the T. Rex that had attacked New York displayed on the screen. Ella took a moment to look at it before nodding. “Oh, those? They live out in the woods. Bit cold for them to be out—they retreated to their dens months ago.” She squinted at the screen. “And that one looks awful big. Sick, too.” 

 

“Sick?” Strange repeated.

 

“Yeah, I’ve only seen ones that color when they were dying. Nasty stuff, poor thing.” Commented Cynthia. 

 

“Are they…aggressive?” Mr. Stark ventured. 

 

“Oh, heavens no. Friendliest things—we take the kids to ride their backs during the summer.” 

 

Percy looked distinctly excited by that. Before he could speak, Nat continued. “That’s really helpful, thank you. One more question, if you don’t mind—do you know of any magic users around here?”

 

“Magic?” Ella repeated. “Oh, nobody here has a talent for that sort of thing, I’m afraid. Why, the only magic we’ve seen in decades was what your friend just did. Very nice, by the way.” She complimented.

 

Percy ducked his head. “Thanks.” 

 

Cynthia snapped her fingers. “Oh! Well, there was this one fellow…I’m not sure if he lives in the area anymore, though. We’re the only settlement for miles, so his people used to swing by to run a couple errands. I heard from one of them that their boss was quite adept at magic.” 

 

Natasha nodded slowly. “But nobody has come in a while?”

 

“Almost a year, I’d say. He lives a bit north of here, but we’ve been quite busy preparing for the cold season, so we haven’t gone up to check on him, unfortunately.” 

 

“And what do you mean by ‘his people’?”

 

“Oh, they all worked for him. Nice people, really. Seemed to like him, too. Oh, I forgot his name…” She trailed off with a frown. “It started with a N, I believe.”

 

Bucky, adjusting his scarf, tilted his head to the side. “What sort of errands did they run?”

 

“Supplies, mostly. Bought a lot of the produce we grow here. Ah, they stopped by the tailors one time. I ended up almost taking the coat they'd brought in home by accident, it was the exact color of the sweater I’d dropped off!” Ella said with a laugh, Cynthia looking at her fondly. 

 

“Red?” Peter asked after a second.

 

“Quite a lovely red, too.” Ella confirmed. Mr. Stark gave Peter a questioning look, but the vigilante kept going, bouncing on the balls of his feet. “You said his name started with a N. Did it happen to be Nick?”

 

Cynthia pointed at him. “Nick!” She exclaimed. “Of course! Yes, that’s it! How did you know?” 

 

“Just a hunch,” Peter said, practically vibrating out of his skin. “Thank you so much for your help. And the cocoa. It was really nice meeting you two.” 

 

“You too, Peter.” Ella said warmly. “If any of you find yourselves in the area again, feel free to stop by.” 

 

“Sure thing.” Peter promised. 

 

As they walked away, Mr. Stark turned to Peter. “...Nick?” 

 

“We’re in a literal winter wonderland, there's a magic man who wears red, and has a bunch of people working for him. Why wasn’t Nick your first guess?” Peter huffed. 

 

It took a second, but Mr. Stark got it. “As in…Saint Nick?”

 

“Well, I was right, wasn’t I?”

 

“I’m sorry, you think Santa sent a dinosaur to New York?” Strange checked. 

 

Peter crossed his arms. “I’m saying there’s a Nick who wears a lot of red and knows magic. And he might know about the dinosaur.”

 

Strange stared at him for a long moment before shrugging. “You know what? That’s not completely out of the realm of possibilities. They said he lives up north, and, wouldn’t you know,” Strange flicked his hand, and the glowing compass materialized once more. “Pointing north.” 

 

“Alright,” Natasha said. “Let’s go do a welfare check on Santa.” 

 


 

Percy was actually having a pretty fun time. The village was nice, the hot cocoa good. He was enjoying the snow, too. It made everything a lot clearer for him to map out, almost as good as being underwater. He linked his hand with James’s as they began to trek north, following Strange’s lead. James had informed him that a glowing arrow was leading them, but Percy, unfortunately, couldn’t make heads or tails of it. Apparently, magic didn’t have a high water count, oddly enough. 

 

James was guiding him along as they walked, occasionally tugging his hand lightly when they adjusted directions. It was effortless and absentminded on his part, but it made Percy smile. As they walked, he couldn’t help but wonder about the dinosaur. If what Ella and Cynthia said was true, which, according to their heart rates, it was, the one he’d killed was acting extraordinary odd. Not only was it way bigger than it should have been, it was uncharacteristically aggressive. Not to mention the dark magic coating it like a second skin. 

 

The whole thing was weird. But then again, they were currently on a quest to find Santa. So, whatever. 

 

As it happened often, Percy felt it before any of them saw it. A massive structure, not of wood or brick but stone. It sat at the foot of a great mountain, carved into the cliff face, wrapping around the base of the mountain and stretching upwards. There were towers, multiple levels, and what even felt like a basement level. 

 

The moment all the others saw it, Percy felt their breaths catch in their throats. James’s hand tightened slightly on his, and Percy squeezed back. “Pretty?” 

 

“Very.” James breathed out. “It’s covered in snow, and the icicles are catching the light just right, it practically glows. It’s amazing.” 

 

They wander right up to the front doors, which stretch dozens of meters high above their heads. Natasha presses her palm against the thick stone consideringly. “Are we sure we should just waltz in here?” 

 

“Knock?” Peter offers. 

 

She gives him a dry look, and he grins at her. Strange looks at his arrow, which is stubbornly pointing inside. “We could always try another entrance, just in case.” He suggests. 

 

“Are there any others?” Tony asks with a frown. 

 

Peter shrugged. “I mean, we can at least look—”

 

“Hey, guys?” Percy says suddenly. Everyone looks over at him. “There’s blood in the snow over there.” He flicks his pointer finger and, about a dozen feet away, a large chunk of scarlet snow lifts up for them to see. 

 

“Shit,” Tony says. “Is it human?” 

 

“Definitely.” 

 

James’s face tightens. “Looking around, it is.” He says resolutely. “Can you find any other entrances?” 

 

Percy tilts his head to the side, searching for gaps where the snow has flitted in. “Window, low enough for us to climb into.” He reports. Strange nods. “Lead the way.” 

 

They circle around the stone behemoth, keeping a careful distance away from the building proper, just in case. It’s so large that it takes almost five minutes for them to reach the gap Percy had found. None of them hear anybody nearby, so, one by one, they swing a leg over the sill and climb inside. Despite the uncovered window, it’s perfectly warm inside, and Percy gets the familiar feeling of magic creeping down his spine. The others must feel it too, because they, sans Strange, all tense up at the new sensation. The carpet underneath their feet is plush, and a fire crackles in a hearth a few meters to their right. The hallway is long, deserted, and carries echoes with relish. 

 

“Left or right?” Percy whispers. 

 

Strange looks both directions. “Arrow says left.” Is all he offers. 

 

“But we have no idea what we’re dealing with. I say we poke around a little more. Right.” Natasha proposes. When nobody objects, she turns in that direction and soundlessly pads across the carpet. 

 

Every hallway they pass through is entirely deserted. By the ten minute mark, it begins to put everyone on edge. They still check every corner, move as silent as possible, but encounter not a single living soul. 

 

Eventually, they locate a staircase and descend into the basement level Percy had felt earlier. A wave of heat hits them as they go down, the air turning from relatively warm to comfortably toasty. Both James and Peter let out soft, content sighs as they drew nearer. 

 

Almost at the same time, Strange and Percy stopped. “There’s something here.” The sorcerer says. “Heartbeats.” Percy finishes. “Dozens.” 

 

Natasha draws a blade, and James’s hand rests on his holster. Percy inches closer to the landing, straining his ears. The heartbeats sound…small, almost like those of children. Something was wrong here. Very, very wrong. 

 

He opens his mouth to speak, but before he can, Natasha shoves her shoulder into the door and it bursts open. 

 


 

It’s a kitchen, with low ceilings and wall-to-wall shelving. A crackling fireplace is laid with messy brick, a group of people are huddled around it, shoulder-to-shoulder and curled in on themselves. They were dead silent beforehand, but as soon as they catch sight of Bucky and the people around him, they shriek and flinch back, frantically scrambling back against the far wall. 

 

Their screams are high-pitched and squeaky, and very, very small. 

 

All of them are tiny. Round, soot-smudged faces stare back at him, eyes wide and shining. Immediately, Bucky drops to his knees. “Hey, hey,” He says softly. “It’s alright. We’re not here to hurt you.” He reassures them. 

 

Tony’s helmet retracts, revealing his face, and Strange’s glowing shields dissolve. Percy, hand on Bucky’s shoulder, crouches down next to him. The kids look at the two of them, hearts quick and fluttery. 

 

“We…we’re working, we swear.” One girl blurts out. “Please don’t tell Mister. Klaus we’re all down here.” She begs. 

 

Bucky blinks. “Klaus?” 

 

“...Our boss?” A boy says. 

 

“Okay, wait, why are you all down here?” Natasha interjects. 

 

That gets her a round of guilty shuffles. “Mister Klaus is…strict.” Someone says. “Usually our parents are around to make sure he doesn’t see us, but they’ve been working a lot recently.”

 

“Strict?” Percy asks, forcing lightness into his tone. “Does he yell a lot?” 

 

The children nod. “He…he hit Nellie yesterday.” Another girl says quietly, as if she’s afraid to speak aloud. “We’ve been hiding down here ever since.” Percy’s fists tighten, and Bucky bites down on the inside of his cheek.

 

“Who are your parents?” Strange leans in. 

 

“They make stuff for him,” The first boy explained. “They’re always busier around the year end, but never like this. They’ve been stuck in the factory all week.” 

 

“They haven’t come home? Not even late at night?”

 

“No,” He says pitifully. 

 

Bucky, recalling the conversation they had with Ella and Cynthia, speaks up. “Do you know anybody named Nick?” 

 

At that, they all perk up. “Mister Nick was super nice.” A girl informs them. “He always gave us candy and let us play with the reindeer.” 

 

“Where is he now?” Bucky inquires carefully. 

 

“We…don’t know. Mister Klaus wouldn’t tell us. He just said that he was our new boss. We work down in the kitchens until we’re old enough to move to the factory.” She says. 

 

“And the reindeer?” Peter inputs. 

 

“They’re stuck in the stables. Mister Klaus doesn’t let them out to play like Mister Nick did.” 

 

The assembled heroes begin to exchange looks, uneasy. “Do you guys have any idea where Nick could be?” 

 

At that, silence reigns. Then, from the back, one boy stands. He’s clearly much older than the others, on the cusp of adulthood. “The west tower.” He says. “I…I’d snuck out of our rooms last week to get an extra blanket. I heard him talking to one of the older elves, one of the ones who runs the factory now. He’s up there, but I have no idea how to get in.” 

 

Bucky works his jaw. “If we wanted to bring Nick back,” He says suddenly, “What would he have to do?” 

 

The older boy blinks in surprise. “You’d do that?” 

 

He shrugs. “This Klaus guy sounds like a real piece of work.” Is all he offers. 

 

The boy looks wary, but eventually replies. “I don’t know. Besides freeing Mister Nick…” He shrugs helplessly. 

 

Sharing another look with the rest of the group, Bucky stands. “We'll figure something out.” He promises. 

 

“About Mister Nick?” The girl in the front whispers. 

 

Tony gives her a comforting smile. “We’ll do our best.” He promises. 

 

They file back out of the kitchen, dead silent until the kitchen door is firmly shut. “This is fucked up.” Natasha says firmly. 

 

“Oh, for sure. But, if I’m getting this right…a rival, evil Santa, usurped jolly-good Santa?” Tony says slowly.

 

“And evil Santa is mean to animals and children.” Percy says, eyes dark. 

 

“Capitalist scum working his elves to the bone.” Bucky adds. 

 

Then, in unison, “Let’s kill him.” 

 

Strange choked. “What?”

 

Bucky crosses his arms. “We’re deposing him to bring Nick back. I’ve deposed a lot of world leaders in my time, Strange, and the only way to really get them out of the way is to kill them. If we don’t, he’ll probably just come back.” 

 

“Klaus made a mistake when he didn’t kill Nick. We don’t make the same one.” Percy concluded. 

 

Strange looked slightly unnerved, but Tony and Natasha were nodding along. “Kill evil Santa.” They agreed. 

 

“We also need to free the reindeer and check out the factory.” Strange reminded them. “And I still think we should stay in pairs, just in case.” 

 

“But if we do, and Klaus gets word of what’s happening, he might escape before we can get to him.” Peter commented. 

 

Percy tapped his chin. “Two to Nick, two to the reindeer, two to Klaus. We need extra manpower.” Then, a slow, slow smile came across his face. “I have an idea.” 

 


 

The portal opens up to what looks like a relatively normal living room. A gray couch with a crocheted afghan tossed over the arm, a mug sitting on a coaster on the coffee table next to a book with a pen acting as a bookmark in it. 

 

Distant rustling, a soft clang, and then footsteps. Cautiously, someone walks into the living room, then approaches the portal to see Percy. 

 

Bridgette Lehey looks at him, then turns her head to the side. “Lee!”

 

A moment later, Lee Van Keppel’s face appears, inquisitively looking between Bridgette and the portal. The two of them are wearing matching plaid pajama pants, but white Bridgette is in a tank top and cardigan, Lee is wearing a thick sweatshirt with a cactus on it. 

 

“Sorry to bother,” Percy says. “But can you call the others? It’s a bit important.” 

 

Bridgette groans, dropping her face in her hands. Lee, on the other hand, looks fascinated with the portal and doesn’t stop poking the sparking edges of it, and though they can’t see it, Strange’s eye twitches with every prod. 

 

Fifteen minutes later, a sleepy-eyed Ross, Mal, and Dan fill the apartment, all in their pajamas. Percy doesn’t beat around the bush. “How do you feel about revolutions?” 

 

They perk up in unison. 

 

It’s a tangle of zipping up coats and lacing boots, pairing gloves and tying scarves, but eventually they get all of the members through the portal. First Mal, then Ross and Dan, and lastly Lee and Bridgette. Strange closes the portal behind them, and the SWORD members take a good minute to look around, eyes wide as they take it all in. Strange clears his throat, pulling their attention away from the snow-coated landscape. As soon as they turn, Lee and Bridgette make noises in the backs of their throats. 

 

“Stephen?” The two exclaim loudly. 

 

Strange’s eyes widen. “You two!” 

 

Bucky frowns. “You guys know each other?”

 

“He’s our neighbor!” Bridgette yelps. “What—how did—” 

 

Lee looks Strange over, the flowing cloak and glowing symbols around his wrists. He turns to Bridgette. “I told you he was a wizard!” Lee says triumphantly. Bridgette sputters, and Strange goes white as a sheet. “You knew?” 

 

“Of course I did! Wong got drunk and turned one of my spiders blue!” 

 

“You know Wong?” Strange says shrilly. 

 

“And when was this? You told me Nellie’s species just does that sometimes!” Bridgette crossed her arms. 

 

“Wong comes over every time you go to your book club! We watch Riverdale, and why the fuck would a spider randomly turn baby blue?”

 

“I don’t know, do I look like someone who knows stuff about spiders?” 

 

“You certainly look like someone who can Google stuff!” Lee refutes. 

 

Tony cautiously steps forward and puts a hand on Strange’s shoulder. “Let’s…all calm down.” 

 

“We’re all very calm!” Bridgette snaps. Tony puts his free hand up placatingly. 

 

In the back, Ross raises a hand. “Uh, I was told there would be a revolution?” 

 

Strange buries his face in his hands and screams. 

 


 

They divided up their missions into teams. 

 

The SWORD members, eyes shining, demand to go to the factory and instigate. They decide to sneak across the sublevel to the other side of the fortress, to the workshop. Tony and Strange volunteer to go outside to the stables and free the reindeer, and Natasha and Peter decide they’re in the mood for a jailbreak, so the newly dubbed ‘spider squad’ elect to find the prison Nick is being kept in. 

 

“You guys good with Klaus?” Tony checks. 

 

Percy, eyes gleaming, nods. “I want his hat.” He whispers. Stephen shivers. Bucky, on the other hand, pulls the demigod close and pressed a kiss to his temple. “I’ll get you his hat, baby.” He promises. 

 

The SWORD members head off first, one of the elves showing them a hidden passageway they can use to get all the way to the main hall. From there, they elect to take a roundabout route, and head outside to skirt around the elves’s dorm wing. They circle around the factory, eying the tall smokestacks sticking out. They find a few doors from the outside, but all of them don’t budge, locked with no apparent lock. 

 

They end up locating a large snowbank, and Lee, as the tallest of them, climbs atop it and presses his face to the glass, breath fogging against it. He watches for a moment, then appears to shrug and slams his elbow through the windowpane, shattering it. Lee gives Mal and boost and she hauls herself through it, landing quietly on the concrete floor on the other side. 

 

The team waits a long few minutes before they hear the soft creaking of door hinges. Mal's head sticks out from a side door, grinning. “Come on,” She whispers. 

 

Inside, it’s…well, it’s rather dreary. They’re off in a corner, hidden behind a large stack of crates the size of small cars. Bridgette gets a glance at an open one and sees it filled to the brim with brightly wrapped presents, and covers her mouth to suppress a gasp. She peeks out from behind one of the crates, is met with the sight of rows upon rows of worktables, hundreds of elves hunched over them as they work. The clang of hammers and the buzz of electric saws is constant and overwhelming, but it had covered their rather messy entrance, so she couldn’t complain too much. 

 

Nobody is speaking, oppressive silence reigning over the cavernous factory. Bridgette’s first thought after hearing ‘elves’ was tiny people with big eyes, pointed ears and striped socks. Instead, all the elves look rather…normal. Their ears are pointed, sure, and they look a little short from where she’s sitting, but other than that, nothing about them makes her look twice. They’re all wearing gloves, hair tied back under hair nets as they work. She looks around, and the only thing that meets her eyes is droopy shoulders and lowered heads. At the end of every couple rows, a tall, cushy chair is set up, an elf in each one. Some are watching the workers with craned necks and curled lips, and others are slumped backwards, snoring. How they can sleep through the constant noise, Bridgette has no idea. 

 

The entire place is freezing, as well. The SWORD members are all in coats and boots, but the working elves certainly aren’t—they’re in plain gray coveralls. The ones up in the chairs seem to be quite comfortable, she notes with disdain. All the ones she can see are drinking hot cocoa and have blankets over their laps. 

 

It's incredibly bleak and honestly quite depressing. Ross’s voice is quiet. “Is anyone getting sweatshop vibes from this, or is it just me?” 

 

Dan is frowning deeply. “No, no, not just you. This is…” He trails off, shaking his head. 

 

“Wrong.” Mal finishes softly. 

 

Bridgette’s lips are pursed. “Alright, so what are we gonna do about it?” 

 

Lee and Dan share a conspirative look. “I…think I have an idea.” Dan says. “We’re going to need some duct tape, though.” 

 

Ross immediately holds out a roll. When Mal raises an eyebrow at him, he just shrugs. “Jackson had some in his bag. He also had snacks.” He informs them through a mouthful of granola. Mal sighs. 

 

Out on the factory floor, an angry yell echoes back to them. “You already used up all your breaks!” One of the elves in the elevated chairs thunders. “Please, sir,” The worker elf says quietly. “I-I’ll be quick.” 

 

“You better. Sneak off, and I’ll have your head. In fact,” He snaps, “You, with the bow, go with him. Any funny business, and you’re both going to get it.” 

 

The elf, tying a neat bow around a wrapped box, nods fearfully and stands, scampering after the first elf. Mal and Dan exchange looks, then soundlessly peel off from the group to go after them. Less than five minutes later, two coverall-wearing elves come back and quietly take their place, heads down. 

 


 

Far away, by the stables, Tony frowned. “I don’t think melting it is the way to go.” He finally said. Stephen frowned at the charred, but undamaged, walls. “Maybe.” 

 

Slowly, Stephen lifted his hands. “Magic fire?”

 

Tony looked at him, eyes wide and nodding. “Magic fire.” 

 


 

Lee, Ross, and Bridgette wait a couple minutes before moving. Bridgette sneaks around to the main door that connects to the rest of the fortress. It’s a bit smaller than the average door on Earth, and after checking the floor for scuff marks, she determines that it opens inwards. Protected by the barrier of white noise, she carefully begins to move the boxes scattered around to barricade it. As soon as she’s finished, the crouches down behind one, hidden. 

 

Lee and Ross, still behind the massive stack of crates, exchange looks. “I’ll stay and watch this one. All the others are still locked?” Ross checks, looking back at the door they came through. Lee nods in affirmative, and takes a deep breath before stepping out from his hiding place. His stride is long and his chin held high as he walks right up to one of the overseeing elves, namely the one who had yelled at the two workers earlier. Lee climbs up on the raised platform the chair is on before roughly grabbing the elf by the collar and tossing him onto the floor like a sack of potatoes. Lee kicks over the chair, and the clatter it makes as it falls seems deafening. 

 

Everyone stops. Power tools turn off, hammers are lowered, and wrapping paper cuts are paused. Lee clears his throat. “This is bullshit!” He screams out to start. From all the way across the factory, Ross and Bridgette make eye contact and immediately look away to keep their laughter at bay. 

 

“I mean, look at this place! Hundreds of you, hunched over at your tables, day in and day out! You sit here, and you freeze, and you starve! And what do they do? They watch!” Lee roared. “Look at this, look at this man!” He pointed to the elf he’d thrown to the floor. “While you toil, waste away in your labor, this man sits and watches, under his warm blanket and coat. No more! I implore you, my fellow laborers, throw your tools aside! Reject the box this man is so desperately trying to put you in!” 

 

One of the other overseeing elves stands up from his seat. “Sit down!” The man orders angrily. Lee casts him a hateful look and continues. “Aren’t you tired of it? They own your tools and your uniforms and so they own your jobs, and with that power they own you! Will you let these men be the masters of your fate, or will you consciously cast them aside! Freedom will not be handed out with your visors and your bootlaces—it is up to you, the individual, to stand up and seize it for yourself! They will own you until you have the courage and the mind to decide otherwise!” 

 

The elves below are murmuring to one another, casting looks at the other overseeing elves in their chairs. Then, Dan, wearing stolen gray coveralls, screams out, “Why do they get to sit up there and not us? What makes them more worthy?”

 

Coming from their own ranks, the working elves began to speak amongst themselves louder. The nearest overseeing elf trips in his haste to get out of his chair and make his way to Lee, who’s still going. “The oppressor cannot be put in such a position without your consent. Every day you come to work, you put on your uniform to become one with the masses, you sit and you say nothing, you are tending not to yourself, but to him!”

 

“Get down from there!” The overseeing one yells, marching up to Lee’s platform. The pathologist doesn’t stop speaking, even as he climbs the back of the chair to put distance between him and the elf. “They are nothing without us! They can own the building, the tools, the uniforms and the very tables you sit at, but not the people!”

 

“You know what, I’m done with this bullshit!” Mal, also wearing a stolen uniform, screams in frustration. Then, to everyone’s astonishment, she picks up the nearest item, a long, thin screwdriver, and smashes it against the corner of the table until it bends. 

 

“But, our jobs—” One working elf nervously starts. 

 

“What are you so scared of? They cannot fire every single one of us, my friend! Then who would do the work? Certainly not them!” He proclaimed as the overseer elf began to attempt to drag him off the platform. “Our strength lies in our numbers, in our resolve! Rise up, grow a backbone! Do not lay at the feet of the ruling class, polishing their boots in hopes that it will get you somewhere in the world! Fight back! Change comes with you! A new tomorrow that starts today!” Lee screams as another overseeing elf joined the first to drag him away. 

 

Dan looked around at the stunned silent factory workers. Then, he took a readying breath, and flipped the table in front of him. “We have nothing to lose but our chains!” Dan roared, and chaos ensued. 

 

Ross tossed Mal the duct tape, and she ran at the nearest overseeing elf she found and, with the quickly forming mob, duct taped him to his elevated seat. “Your throne will become your prison!” One elf screamed. 

 

At one point, Lee broke free from the elves holding him down, and climbed atop one of the few unflipped tables, cackling as he watched the elves revolt. Bridgette soon appeared by his side, and he smiled at her. 

 

She got on her tiptoes to press a kiss to his jaw. “You needed that, didn’t you?” 

 

He sighed contentedly as he watched a group of elves burn the cushy chairs. “I did.” 

 


 

Outside, halfway across the grounds, Stephen and Tony eyed the stables. It was a relatively small building, low ceilings and no windows. There was a single door, but when either of them tried to push it open, it didn’t even budge. 

 

“I don’t even think there’s a lock to cut through,” Tony said, inspecting the doorframe. 

 

“There’s a magical signature coming from the entire place. I thought it might be the reindeer themselves, but I think the building itself might have some spellwork imbued into it as well.” Stephen observed. 

 

“Can you try your portal thing?” Tony asked, glancing back at the sorcerer. 

 

Stephen raised his hand, going through the familiar circular motions. Golden light sparked midair, and his face screwed up in concentration. The circle sluggishly began to expand, awkward and forced in comparison to the gracefulness Tony had seen earlier. Then, Stephen gasped raggedly and the portal collapsed. The sorcerer bent over, drawing in rushed lungfuls of air. Tony darted over to him, putting a hand on his shoulder. “Are you alright? What the hell just happened?”

 

The sorcerer’s breaths were heavy. “I—I don’t know. I could only hold it for a second, it was like it was draining my energy. Nothing like that’s ever happened before.” 

 

Tony’s eyes were wide in his worry, his grip on Stephen’s shoulder tightening slightly. “Are you going to be alright?” 

 

Stephen nodded, the color already returning to his face. “Yeah, just…give me a second. Whatever wards they have up, they're insane. I don’t think magic is going to be our way in."

 

Eyes sharp, Tony looked back to the stables. At the moment, he couldn’t help but wish Percy was here. He doubted Percy’s abilities really counted as magic, so the dude could probably just level the building if it came to that. Or, hell, maybe reindeer were close enough to horses that he could just convince them to come out on their own. 

 

Just like that, inspiration struck. 

 

 “Or…maybe it is.” He suddenly said. “Now, I don’t know shit about magic, so correct me if I’m wrong, but spells are usually made for one specific thing, right?” 

 

“There’s not a lot of multipurpose spells, yes. The stronger the magic, the more specific it must be.” Stephen confirmed. 

 

Around him, the suit began to disassemble, folding and condensing down until it was the size of a small briefcase, which Tony deposited in the snow. Stephen was watching, fascinated, and warm pride burst in his chest. It was always nice to have his genius appreciated, after all. 

 

Then, he frowned. “Aren’t you freezing?” 

 

Tony shrugged it off. “It’ll only be for a moment.” He dismissed. 

 

Stephen, instead of nodding and moving on, drew another one of his fancy symbols in the air. It floated over to Tony, landing on his sternum, right over the arc reactor. It sank into his skin, and immediately, warmth spread outwards from the impact site, down to the tips of his fingers and toes. It was surprisingly pleasant, chasing away any whisper of chill. “Warming rune,”

 

Tony blinked, then smiled back. “Thanks.” 

 

“Don’t mention it,” Stephen muttered. 

 

Tony rubbed the palms of his newly warmed hands together, a wicked grin creeping up on his face. “Alright, I originally grabbed these for Spidey, but,” Tony reached in his coat pocket, and pulled out a small bag of carrot sticks and apple slices. “I doubt Klaus gives these guys a lot of treats.” 

 

Strange was looking at him curiously. “Probably not.” He agreed. 

 

Then, Tony reached down and tapped the side of his briefcase. One of the corners unfolded, forming into a red and gold gauntlet. Tony held it up, messing with something on the back of the hand. “And if this magic is as strong as I’m assuming, it’s gotta be pretty damn specific. Based on stopping people from getting in, not breaking out.” 

 

It took a second, but realization dawned. “You want to lure them out.” 

 

“Give the man a prize!” Tony exclaims. “I’m thinking you shove another portal open, and I can send the gauntlet through with the bag, and it’ll lead them out.” 

 

“I’m not sure I can hold it that long,” Stephen said with a slight frown. Tony clapped him on the shoulder. “Have some faith in yourself, Stephen. You got this.” 

 

The sorcerer looked a little doubtful, but nodded and lifted his hands. Once more, golden sparks lit up the white landscape, slowly beginning to swirl. The strain on Stephen’s face was visible as he widened it, and the gauntlet lifted itself into the air, clutching the bag of snacks between two fingers. 

 

“That’s a little creepy,” Stephen gasped out as he continued to force it open. 

 

As soon as it was wide enough, the gauntlet darted forward. “Yes!” Tony cheered. But then, a loud scream sounded from across the grounds, a hundred tiny voices forming into one. “Union!” 

 

The unexpected cry startled both men, and Strange flinched, losing concentration just as the gauntlet moved to enter. It collapsed in on itself, leaving a gauntlet clutching a severed bag of snacks in the snow. “What the hell was that?” Stephen exclaimed, looking around for the source of the noise. 

 

“I have no idea,” Tony whispered. Cautiously, he stepped forward to pick up his fallen gauntlet. He inspected the bag, and sighed. “It cut some of it off.” He said, holding up the bag, neatly cut down the middle. 

 

Then, a loud thud. 

 

Another. 

 

Then another. 

 

The two shared wide-eyed looks. The force shook the side of the stables, getting louder and louder each time. It was nearly deafening as it picked up in speed and aggression. Tony reached for his briefcase, and the suit began to reform around him, the gauntlet in his hand seamlessly reconnecting to the rest of the suit. 

 

In front of them, the wall caves in with a mighty bang, sending up flurries of snow and dust. A single hoof sticks out, pawing at the snow. It retreats back inside, and is replaced by a massive head, with a glowing, red nose. 

 


 

Meanwhile, across the grounds, Natasha and Peter stood at the foot of a turret, staring upwards. “This is…pretty tall.” Peter finally said. They’d wandered around inside, trying in vain to find a door that wasn’t magically sealed, and had ended up outside. Peter squinted upwards. “There’s a window with bars on it near the top.” 

 

Natasha looked over at him, calculative. “Hey, how strong would you say you are?” 

 

“Last I checked I can lift about…200 tons, I think?”

 

A smile slowly crept over Natasha’s face. “I have a fantastic idea.” From her jacket, she took out a long coil of rope, and started making knots. “Come here.” 

 

Peter shrugged and moved to stand in front of her. 

 




Tony grabs onto Stephen’s arm. “Oh, my Gods.” He whispers. 

 

Stephen can’t even bring himself to be curious at the use of the plural, too transfixed on the sight in front of them. A pair of antlers knock loose pieces of wall out of the way, widening the hole for the reindeer to step through. 

 

Rudolph, his nose truly as bright as described, leads the escape. The reindeer are enormous, antlers the size of tree branches jutting out of their heads. Each one is covered in a thick layer of gray-brown fur, and a single name tag hangs from each neck. 

 

A single apple slice sits between Rudolph’s lips, and Tony pales. 

 

Dasher, Dancer, Prancer, Vixen, Comet, Cupid, Donner and Blitzen. One by one, they fan out to stare at Stephen and Tony, jingle bells sounding from their harnesses. The two are rooted to the spot, eyes wide. 

 

Then, slowly, Tony reaches for the bag and pulls out a single carrot stick, shakily offering it to Dasher. The reindeer leans in, narrowly missing Tony with his antlers, and exhales a warm gust onto his palm. He takes the carrot surprisingly gently, and Tony relaxes. 

 

“They’re…actually kinda cute,” He comments, cautiously resting his hand on the crest of Dasher’s head. The reindeer seems to enjoy the attention, leaning into the touch. “I doubt Klaus plays with them much.” 

 

Stephen, eying Vixen, makes a motion for the bag. Tony hands it over, and the sorcerer takes out an apple slice and offers it. Vixen accepts it happily. “This isn’t really how I expected this to go.” He admits, glancing at the busted in wall. “They must’ve really wanted some treats,” 

 

“Guess so.” Tony mutters, scratching Comet behind the ears. 

 

“You’re awfully calm about this.” Stephen notes. 

 

Tony shrugs. “They kinda remind of Percy’s horse, actually. Bit nicer, if I’m being honest.”

 

“He has a horse?” Stephen asked, surprised. 

 

“Giant black pegasus.” Tony confirms. “The thing just shows up, Percy feeds him a couple donuts, they chat for a bit, and it leaves.” 

 

“Pegasus,” Stephen repeats faintly. “Alright.” 

 

Tony looks at the man over his shoulder. “You get used to it.” 

 


 

“Are you sure this is alright?” Peter checked. 

 

Natasha, firmly harnessed to Peter’s back, nodded. “Yeah, I think it’ll be fine.” 

 

Peter shrugged against her, and tugged his mittens off with his teeth. He was fairly sure he would be able to stick through them, but he didn’t plan on taking any chances, especially with a passenger. He was still wearing the gloves to his suit underneath anyways, so it wasn’t like he was going to get too cold. 

 

“Ready?” He asked, placing a hand against the stone.

 

“Ready.” Natasha confirmed, her legs wrapped firmly around his waist, arms around his front. He’d toed off his snow boots earlier, leaving them hidden behind a snow bank, just in case. Free to climb, he began to haul the two of them up with a surprising amount of grace. Like it was natural to him, Natasha noted, a second nature. 

 

It was a pretty smooth journey, all things considered. Her little spider was extraordinarily strong, unflinchingly latching onto the smooth stone face. The wind whipped at them, snow piling up on their heads and shoulders. Every now and then, Natasha leaned forward and wiped the excess off the top of his head. About halfway up, she turned her neck to look down below. 

 

Everything looked so much smaller from this height. The trees, which had seemed infinitely tall from the ground, looked more like weeds shooting up from the snow. She could almost see the whole fortress, from the factory to the stables to the main hall. A bright, colorful blast smacked against the sides of the stables, and she raised an eyebrow. Strange and Tony were an odd duo, but they suited each other. And they probably wouldn’t bring the whole place down. 

 

No, it was Bucky and Percy she was worried about in that regard.

 

“So,” Natasha said, turning back to him. “Tell me about this MJ.” 

 

“Nat,” Peter whined as he pulled them up another couple feet. Then, he paused. “Hey, do you hear that?”

 

Natasha listened, but heard nothing. “Not everyone has super senses like you, little spider.” She reminded him. 

 

Peter hesitantly began to climb once more. “It…it almost sounds like people are chanting the word union?” 

 

“...Odd.” Natasha replied after a second. “But, ultimately, not our problem.” 

 

“Fair enough.” Peter said. “I can see the window.” Sure enough, when she looked up, the indentation where the bars sat was visible. Peter climbed until they were level with it, a few feet to the left and out of view of whoever was inside. 

 

“Is it Nick?” Peter whispered. Natasha precariously leaned to the side, grabbing ahold of the ledge and peering inside. She kept her glance quick to lessen the chance he would see her, just in case. 

 

The room inside was rather drab. A single cot, a toilet in the corner, and an imposing wooden door with a slot the size of the empty food tray on the floor next to it. On the cot, facing away from them, was a man. His hair and beard were scraggly and dirty, but clearly white. “Sure looks like it.” She reported. 

 

Peter hummed, but the quiet noise was mostly lost to the wind. “Maybe try calling him?” 

 

Natasha leaned back to the window, grabbing ahold of one of the iron bars covering it. “Yo, Nick!” 

 

The man jolted up and whipped around to look at her head, peeking through the bars. His face held a pleasant flush to it, cheeks round and rosy, eyes kind and twinkling. He certainly didn't look like someone who belonged in a jail cell. “Hello?” He called.

 

“Back up a little, would you?” Natasha asked, trying her best to be polite to the man. He stood from his cot and did as she asked, backing up the far wall of his call. 

 

Peter, after making sure the rope securing Nat to his back was tight, moved closer to the window. He wrapped a hand around the nearest bar, giving it an experimental tug. He then turned his head back towards his passenger the best he could. “Hold on tight.” He warned. 

 

Then, Peter yanked the bar backwards, ripping it clear out of the stone it was embedded into. He let the broken piece of metal fall and hit the snow, hundreds of feet below. Nick looked absolutely stunned as the young man repeated the process with the rest of them, effortlessly tearing through steel and stone. 

 

Once there was nothing but a gaping hole in the wall, Peter turned to the side so Natasha could get a leg over the ledge. Sitting half in and half out, precariously keeping her balance, Natasha’s deft fingers began to untie the knots connecting the two of them. She slipped out of the rope harness and hauled herself through the window, landing in a crouch on the stone floor. Peter followed easily, sliding in and dropping onto his feet.

 

“Hi!” He chirped. “I’m Peter, this is Nat, and we’re here to bust you out!” 

 

Nick’s bushy white brows met his hairline. “That’s…awfully kind of you.” His voice was deep and smooth, full of warmth. “I take it you’ve heard of my situation?”

 

Peter nodded solemnly. “The usurper.” 

 

“So, then you understand that freeing me won’t do much, I’m afraid.” Nick said morosely. “It will take quite some time for me to gain my strength back and clear Klaus out.” 

 

Nat gave him a devilish grin. “Oh, I wouldn’t worry about that. We brought friends.” 

 


 

 

Bucky and Percy, fingers intertwined, wander down the hallways. They took the stairs up from the kitchen and backtracked to the window they’d first come into. From there, remembering Strange’s arrow, they head left. 

 

“Heartbeat coming up,” Percy comments as they round a corner. “In the big room up there.” 

 

Neither of them so much as pause as they reach another set of great stone doors, each going to a side and shoving them open with their shoulders in tandem. They make a tremendous clanging noise as they burst open, slamming against the walls. 

 

Inside is what looks like a study—floor to ceiling bookshelves, maps pinned up on any available wallspace, marked up with red push pins. The far wall is made entirely of large windows, displaying the forest outside. The fireplace is crackling, and carpet is soft and a rich scarlet, and, most importantly, a grand mahogany desk sits right in the center. And, there, in a plush armchair, is a man. 

 

He’s tall and broad, with a neatly trimmed white beard. When they enter, his gaze snaps to them. His eyes are dark and narrow, mouth set in a perpetual sneer. “Who the hell are you?” He roars, shooting to his feet. 

 

“Klaus, I presume?” Bucky checks. 

 

“What’s it to you?” 

 

“Is that a yes or a no, old man.” Percy demands. 

 

“Yeah, I’m Klaus.” He spits. “Now get the fuck out of my office.” 

 

The demigod tuts, unsheathing his sword and dropping his backpack by the door. “That’s not very Christmas spirit of you.” 

 

Bucky puts a hand over Percy’s, stopping him from raising his sword. The demigod tilts his head, and Bucky raises a brow. “You got to fight the dinosaur.” He reminds. 

 

Percy huffs, but sheaths his sword. “Fine,” He grumbles. Bucky pecks him on the cheek as he takes off his coat, and then opens the demigod's discarded bag, pulling out the extra twin blades Percy had packed. “Love you.” 

 

Just like that, any semblance of a pout leaves Percy’s face. “Love you too.”

 

Bucky twirls one of the blades in his hands, turning to Klaus. “Post up, bitch.” 

 

As his boyfriend charges the man, Percy lightly toes his bag. It was a lot lighter than it was when he’d stepped through the portal. He knew Nat had taken his rope and Tony his carrot sticks and apple slices. He was pretty sure it was Ross who’d grabbed his granola bars and duct tape. For what, he wasn’t sure he wanted to know. The spare sweater, scarf, and hat he’d packed were also gone—Dan and Mal, he was pretty sure. And now that Bucky had taken the spare knives, it was practically empty. 

 

On the other side of the room, Bucky broke the acting Santa’s nose. 

 

The med kit and treats for Mrs. O’Leary was still there, along with the firestarters and multitools. Percy frowned, feeling like he was forgetting something. He began to run through the list of what he’d packed that morning, thumbing his bottom lip. 

 

Clothes, snacks, first aid supplies…

 

Klaus roared in pain as Bucky kicked him in his gut, forcing him back. Then, while the man was still winded, he jumped and pulled a textbook perfect 360 kick, his boot connecting with the man’s face hard enough to send him sprawling. Percy clapped politely, then returned his focus to his bag. 

 

Flares, ammo, hellhound treats…

 

What was he missing?

 

Bucky, now pinning Santa to the floor, drew his knife. Percy cupped his hands to his mouth and called across the room, “Ask him about the dinosaur!” 

 

The supersoldier looked scornfully down at the man. He didn’t speak, he just raised a sole eyebrow. Very visually intimidating, Percy was sure of it. Klaus inhaled raggedly. “I sent it to grab people, nothing more. Wasn’t there to hurt anybody.” 

 

“The magic you used was going to kill it.” Percy pointed out angrily. Not only did the man apparently take a creature, considered widely peaceful in this realm, and send it to terrorize New York, he did it at the poor things expense. 

 

Klaus remained silent, and Bucky brought the tip of his blade to the man’s jugular. “What do you mean, grab people?”

 

“Just needed a few new workers, that’s all.” Klaus wheezed out. 

 

“What happened to the old ones?” Bucky snarled, leaning in closer to the man. 

 

He received no response, which was answer enough. Bucky bared his teeth. “You disgust me. Stand up.” The supersoldier hauled himself off of the man, dusting off his clothes. Klaus stumped to his feet. 

 

“Say something cool,” Percy urged from the sidelines, head tilted to the side as the situation unfolded, Bucky advancing on the man. His boyfriend was clearly deliberating something as he backed Klaus against the wall of his study. 

 

Once he’d apparently decided, he regarded the man for a moment. Then, with a wide, unhinged grin, he spoke. “See you in jingle hell,” Before driving his blade into Klaus’s gut. He ripped it out, and Spartan kicked the man straight through the window, shattering it. Right before he fell over the edge, Bucky plucked the hat right off his head, then let his body plummet to the ground, two hundred feet below. 

 

Bucky wiped off his blade, then turned and walked towards Percy. His boyfriend was breaming at him, all dimples. Bucky, the taller of the two, had no problem fitting the stolen hat right atop his head, pulling it down over his ears. Percy’s hands came up to cup his face, and he tipped their foreheads together. “I have literally never been more in love with you.” He breathes. 

 

Smiling, Bucky slides a hand around his waist. “That was cool?” 

 

Percy laughs, a soft thing that Bucky wishes he could hear forever. “Very, very cool.” 

 

Bucky’s hand rests on the nape of Percy’s neck, and he can’t help but stare at him. Percy’s skin is flushed, snow from the broken window blowing inside and resting on the inky locks peeking out of the hat Bucky had put on him. His lips are chapped from the cold, and Bucky’s eyes linger. 

 

He hears Tony’s surprised voice, way down below. Clearly, someone had found Klaus. Whatever, he could be gay later.

 


 

They all meet back up outside, standing in a circle around Klaus’s body. The SWORD members were red-cheeked and grinning. Bridgette is tucked up under Lee’s arm, and Ross has linked arms with both Dan and Mal, who are, oddly enough, both wearing gray coveralls. Stephen and Tony are standing side by side, and there’s a flock of giant reindeer behind them, though neither of them look willing to address it. Peter and Natasha stand on either side of a man in red—he looks much more like Santa should, unlike beady-eyed Klaus. 

 

Nick is eying the scarlet pool of snow with a wrinkled nose. When Bucky and Percy wander out of the fortress into the courtyard, the man looks at them consideringly. When he catches sight of the hat on Percy’s head, he sighs. 

 

“You stabbed him?”

Bucky shrugs. “The revolution slows for nobody.” 

 

Nick doesn’t seem to know what to do with that, so he turns back to everyone else. “You…freed the reindeer?” Tony runs a hand down Donner’s side. “Yes. They deserve lots of apples.” He says forcefully. 

 

Donner chuffs, and Percy nods. “The green ones.” 

 

“The green ones.” Tony agrees. 

 

Nick rubs a hand over his face. Mal, watching the whole thing with a crooked grin, pipes up. “We also started a socialist revolution amongst your elves. Better hope you pay them a fair wage, ‘cause they just formed a union and are duct taping their former corporate overlords to the ceiling.” 

 

“...You radicalized the elves?”

 

“I’m a passionate speaker.” Lee deadpanned. 

 

Nick, after a second, shrugged. “Good for them. I imagine Klaus made a lot of changes for the worse, around here. I’m glad they’ve learned to stand up for themselves.” 

 

Dan flashes the man a thumbs up. “Oh, by the way, Jackson, we traded the extra hats and stuff you brought for two of their uniforms to infiltrate the workforce.” Percy just nods. 

 

“Your temporary replacement forced dark magic on one of the dinosaurs from the forest and sent it to our realm to kidnap people.” Percy tells the man after it's silent for a second. “He needed to replace workers, apparently.” 

 

Nick pales. “Did he say what happened?” 

 

Bucky shakes his head regretfully. Then, “If you try to take Percy’s hat, you’ll end up like the other guy.” 

 

“Barnes!” Tony hisses. “You can’t threaten Santa!” 

 

Bucky doesn’t even twitch. Nick sighs again. “He can keep that hat. While you lot may have an…unconventional way of it, you really helped me out a lot. I cannot thank you enough for what you did for the elves and my reindeer.” He says sincerely. “Really, thank you. I might even be able to get everything back on track for Christmas…” He trails off. “What’s today?” 

 

Natasha checks her watch screen. “The 24th.” She reports. Nick relaxes. “Oh, that’ll definitely be enough time. You all have my eternal gratitude. The least I can do is send you back home.” Then, he pauses. “I can use a portal, or…” He trails off with a smile.

 


 

“This is amazing!” Peter whoops, leaning over the side. Tony is keeping a grip on the teenager’s sleeve, just in case, as he laughs. 

 

From the front, Nick flicks the reigns of the sleigh. “Nothing quite like it, you’ll find.” He comments. 

 

They’re far up in the evening sky, riding above the clouds. Despite the altitude, they all breathe easy as the reindeer team pulls them along. Rudolph’s nose shines brightly, illuminating the way. The sun is beginning to dip in the horizon, turning the sky a rich, vibrant orange. Peter laughs again, a carefree, joyous sound. Natasha smiles fondly at him as they soar through the clouds, wind whipping at the strands that had escaped her braid. Even Stephen has abandoned his usual demeanor, grinning wide and unashamed. He and Tony make eye contact for just a second, eyes crinkled and the tips of their ears red. 

 

Ultimately, the SWORD members had decided to take the portal option home. Lee, the only one who'd given an opinion about it, had simply said, "If I wanted a reindeer as a method of transportation, I'd just go back home." 

 

In the back row, Bucky has unzipped his jacket and wrapped one side around Percy, who’s leaning into his side and holding onto the supersoldier for dear life. He knew Percy wasn’t much of a fan of flying, but he didn’t say anything when he heard how excited everyone else was at the idea. 

 

“You’re way too selfless sometimes,” Bucky murmurs directly into his ear over the wind. Percy just grumbles something against his side. Bucky sighs and presses a kiss to his forehead. “Love you.” 

 

This time, he can make out the returning, “Love you too.” 

 


 

By the time they get back to the tower, it’s late. Nick bids them goodnight before rushing off back home to prepare for upcoming his worldwide journey. Tony ushers Peter straight off to bed as soon as they get inside with a stern, “You can tell your weirdo little friends about it tomorrow.” 

 

Peter, who’d been beginning to type out a very long text message, made a face at Tony, but trudged off to his room. Natasha, undoing her braid and raking her nails through her hair to get the snow out, laughed a little. “I think I’ll be following the little spider’s example.” 

 

“Night, Nat.” Percy and Bucky call. 

 

“See you tomorrow,” She calls as she steps into the elevator. 

 

Eventually, Tony convinces Strange that, yes, it’s fine if he stays the night, it’s getting late and they’re all tired, there's no need to back to the sanctum. FRIDAY directs the sorcerer to a spare room, and the man gives them a grateful smile before departing. 

 

Tony, Percy, and Bucky sit heavily on the couches for a long period of blissful silence. Eventually, Tony looks over at Percy. “Nice hat.” 

 

Percy’s smile is sleepy but radiant. “James got it for me.” 

 

Bucky and Tony exchange amused looks. “That’s nice of him.” Tony says. Percy nods along, already curled into the supersoldier's chest. “Strange is nice.” Percy says suddenly. 

 

Tony pauses. “What?”

 

“Strange. He’s nice too.” Percy repeats.

 

“What does Stephen have to do with this?” 

 

Bucky’s grin is wolfish. “Stephen?” 

 

Tony’s ears turn pink. 

 

Percy hums. “Your pupils dilate when you look at him.” He drops. Bucky laughs, mindful of the volume as he slides an arm under Percy’s knees. He picks up his boyfriend with ease, standing smoothly. He carries him into the elevator, leaving Tony spluttering on the couch. 

 

Five minutes later, the two are in pajamas, their gear strewn across the desk and chair in the corner. Mrs. O’Leary is sitting on the bed, wagging her tail, and Percy scratches behind her ear. “Hey, didn’t she come through the portal with us?” Bucky asks. 

 

Percy hums. “Probably. She comes and goes.” 

 

Bucky kisses the hellhound on the snout. “A strong independent woman. Wonder what she did all day.” 

 

They peel back the covers and curl under them. Percy’s nose pressed into Bucky’s collar, one arm wrapped around him and resting across his back. Bucky holds him close, his chin atop the demigod’s head. They’re comfortable in their silence, breathing patterns falling into sync. 

 

They both have full days tomorrow—visiting Percy’s mother in the morning, then a get-together at the tower. After that, Percy’s going to bring him along to his Camp holiday party, so he can finally meet the few remaining cousins that haven’t dropped in on them so far. 

 

But, until tomorrow, they can relax in each other's company, content to just lay there.

 

Then, Percy gasps. “The pig balls.” 

 

“What?” 

 

“I knew there was something missing from my bag! It’s the pig balls!” 

 

Slowly, Bucky turns his head to look at the end of the bed. Mrs. O’Leary wags her tail, and Bucky swears she’s grinning at them. 

 

At the same time, he and Percy burst out into laughter, the round, deep kind that comes from the belly, hard enough to bring tears to their eyes. When they can finally catch a breath, Bucky leans down and catches Percy’s chin. His eyes flit to the clock on their nightstand. Its exactly midnight. 

 

He tips Percy’s chin up and kisses him soundly. “Merry Christmas, love.” 

 

The smile he gets is one that plays again and again behind his eyelids. “Merry Christmas, Jamie.” 

Notes:

its got it all! wintersea fluff, the spider duo, ironstrange, socialist revolutions, violence against santa, and reindeers! what more could you ask for :)

also shout out to my friend M, who specifically requested the line 'see you in jingle hell'. you are iconic and i love you.

me last year: some fluff, they all celebrate the holidays together :)
me this year:
me this year: percy fights a t.rex. tony is a reindeer whisperer. nat dreams of jailbreaks. SWORD yearns for revolution. bucky kills santa. peter takes to the skies.

bucky about nat: i just think shes neat :)

strange is lowkey a dumb bitch. like “He wasn’t quite sure what realm this inhuman was from, but Strange most definitely did not want to pay a visit.” bitch you mean manhattan

me: he's fighting a t.rex, strange got bit by a feral demigod,
me: percy is an eldritch being, connected to the primal sources of the earth, unknowable to mankind-
me: the dog has a little sweater lmao

i just thought it'd be a little bit of a neat idea if the scars monsters gave demigods glowed a little with the golden dust they turned into. like the more violence you commit, the more tiny pieces of monsters become part of you

anyways stan cynthia and ella <3

lee and wong >>>>>>>>
if anyone caught that one chapter of the sword babes at the end of TLS, they're at bridgette and lee's house, which is right next to the sanctum

lee, eyes narrowed: what do you want you wizard bitch
stephen, who just needed an egg:

me: christmas story :)
me but in a evil little cloak: c a p i t a l i s m
me: ....okay-

percy: i w a n t s a n t a s h a t
bucky, preparing to commit a murder: dw babygirl i got you

bucky: see you in jingle h e l l
percy, weeping, already down on one knee:

strange and percy at the beginning of the chapter: >:(
strange and percy at the end of the chapter: 🤝 caring about tony

i had to deliberate between ironstrange and pepper/rhodey/tony, but ultimately, i decided that the dynamic of two very well put together sophisticated people cheering on their dumbass friend to seduce a wizard was too good to pass up

happy holidays, everyone!
beans out B)

plumbing baby, goodbye

Chapter 36: fistfulls of shredded carrots and cabbage before the sunrise

Notes:

(See the end of the chapter for notes.)

Chapter Text

*kills you in russian*

 

natatouille: so…

 

natatouille: you and jackson?

 

bucky bear: huh

 

natatouille: you’re together, are you not?

 

natatouille: because if you aren’t, i swear to god i WILL be fixing that

 

bucky bear: please no

 

bucky bear: ive heard horror stories of your matchmaking efforts

 

natatouille: :)

 

bucky bear: yeah we’re together

 

bucky bear: have been for a while

 

natatouille: im happy for you

 

bucky bear: thanks

 

natatouille: but i gotta ask

 

natatouille: how?

 

bucky bear: i captivated him with my encyclopedic knowledge of tolkien and also my mental illnesses

 

natatouille: 👍  

 

natatouille: providing hope to ex-assassins all around

 

natatouille: but he is good to you about that kind of stuff, right? 

 

natatouille: obviously, it wasn’t your choice to do all that, but i know some people have issues with pasts like that regardless. 

 

natatouille: everythings okay on that front?

 

natatouille: i can lace his jello with cyanide if not

 

bucky bear: uh

 

bucky bear: first, please dont. the man is absurdly protective of his jello

 

bucky bear: second, yes, he’s amazing. honestly, nat, i dont know what i did to deserve him. he’s such a genuinely good person it surprises me every day. i dont know where i’d be without him

 

natatouille: gross

 

bucky bear: :/

 

bucky bear: and nat? 

 

bucky bear: he’s not going to judge you. you dont need to worry about it. talk to him. it'll go better than you think. 

 

natatouille: 

 

natatouille: alright. I will

 

 


 

 

Natasha Romanoff and Perseus Jackson

 

NR: hey, can we talk?

 

PJ: im ironing my socks right now

 

PJ: we could get lunch later?

 

NR: sounds good

 

 


 

 

*kills you in russian*

 

natatouille: 

          PJ: im ironing my socks right now

 

natatouille: ?????????

 

bucky bear: god he’s so weird

 

bucky bear: i desire him carnally

 

natatouille: you two most definitely deserve each other actually

 

 


 

 

robert <3

 

egg: its a genuine fear, dan

 

class traitor: no?? I dont think it is????

 

certified monster fucker: is it someone sticking you with heroin while you walk past them on the sidewalk, pulling you into addiction and ruining your life?

 

certified monster fucker: cause i get that

 

egg: no what

 

egg: ross what is wrong with you

 

Local milf: me living in constant fear that my gardening will get me taken down by the fbi

 

class traitor: girl huh

 

Local milf: i like the way poppies look!! but what if im making drugs :(

 

class traitor:

 

class traitor: well ARE YOU???

 

Local milf: no!

 

Local milf: but what if i do it on accident

 

class traitor: you're. insane, actually

 

egg: hey the focus shifted away from me and i don't like that

 

certified monster fucker: right sorry

 

certified monster fucker: mal, what fear were you talking about? 

 

egg: im deeply untrusting of tall people

 

egg: what if they lick my head

 

Local milf:

 

Local milf: are you serious

 

egg: yes!!! literally what is stopping them

 

Local milf: a BRAIN

 

egg: i live in constant fear of like half of you

 

egg: and you belittle me????

 

Local milf: lee is telling me to tell you that he never thought of doing that to you until you brought up the idea

 

egg: SHIT

 

certified monster fucker: speaking of, where is my dearest discount thor??

 

Local milf: he’s sitting in the kitchen chewing on the contents of a tea bag

 

Local milf: he says it “appeals to his autistic sensibilities”

 

class traitor: so real for that one

 

Local milf: since we’re all sharing

 

Local milf: dan whats a weird fear you have

 

class traitor: the next time aliens come to earth what if a piece of their ship falls off and impales me through the foot, immobilizing me, and they laugh at me from above and call me names. i wouldn't be able to understand what they’re saying, but i would hear them jeering and yelling, and so i know it would be mean but i wouldn't know exactly what they're making fun of me for. and since i wouldn't be able to move because of the metal spike through my foot, id just have to stand there and take it, wondering about every little thing they could possibly be making fun of me for. every insecurity i've ever had would come to surface. It'd be terrible

 

thor understudy: and the food processor

 

class traitor: and also the food processor

 

class traitor: but i feel like thats your fault

 

thor understudy: get over it

 

thor understudy: if you cant handle midnight vegetable shredding, then you have no right to be here

 

class traitor: every. goddamn. night. 

 

class traitor: THREE YEARS

 

thor understudy: youve never experienced joy until you know fistfulls of shredded carrots and cabbage before the sunrise

 

class traitor: ill literally never forgive you

 

class traitor: to this day i hear the shredder in my sleep

 

thor understudy: and it continuously improves you as a person

 

class traitor: :/

 

 


 

 

coolest intern @peterparkour

 

come with me to see if any of the avengers will finish the heart <3

 

coolest intern @peterparkour

 

[Video Attachment: Peter walks up to Tony and holds out a hand, first finger extended and middle finger bent to make half a heart. Tony looks up from the papers he’s reading, and, after a second, puts his coffee cup down. 

 

Tony: What are you doing?

 

Peter: It’s a heart, Mr. Stark!

 

Peter: Well, half of one. 

 

Tony nods, squinting. He holds up a hand to mimic Peter’s, taking a second to get it right. He holds it up to Peter’s, completing that heart. 

 

Tony: Like that, kid?

 

Peter: Yep!

 

Then, he’s standing across from Rhodey. Once more, he holds out his hand, fingers in the shape of a half-heart. The Colonel regards him curiously. Then, he looks down at his own hand, hesitantly raising it and completing the heart. 

 

Rhodes: Did I do it right?

 

Peter nods, giving a thumbs up.

 

Peter: Fantastic job. 

 

Next, he approaches Natasha, who is crocheting on the couch, a large black mastiff next to her. As soon as she catches a glimpse of Peter, she holds up a half-heart before he can even say anything. Peter is the one to finish it this time. 

 

Peter: How did you know I was going to do that?

 

Natasha, somehow crocheting with one hand: I know everything, kid. 

 

Peter: You’re so cool.

 

Natasha looks up at that and smiles at him. 

 

Lastly, he approaches Bucky. The supersoldier is sitting on the couch, sharing a throw blanket with another man, who's cuddled up against him. Though he stops when Peter draws near, it appears he was reading aloud. Peter holds out his half-heart, and Bucky tilts his head to the side. 

 

Bucky: Is that a threat?

 

Peter: What? No!

 

Bucky, squinting: Oh! It’s a heart?

 

Peter: Yeah!

 

Bucky finishes the heart. The man next to him, his face mostly hidden, turned into Bucky’s side, makes a confused noise. Bucky, lovingly gentle, takes the man’s hand and moves his fingers into the right position. Then, smiling, he connects their two hands to make another heart. 

 

(Though you can’t see it, the other man beams.)

 

Peter, choked up: You guys are disgusting. 

 

End of video.]

 

 

piru @pirepiro

why am i fucking sobbing

 

annlis @anli

WHEN WILL IT BE MY TURN TO BE HAPPY

 

Avengers!!!! @superherostan

oh my god i love tony stark so much,.,.,,..,,,,,rjghregvrequghGRJHDSJTK

 

Bblimm @blooo

natasha im SCREAMING <3 <3 <3 <3

 

bearbi @bearbi3 

I will be a colonel rhodes stan until the day i DIE

 

mimi @wheresmybeans

barnes helping his bf make the little hand thing 🥺

 

Ferris wheel fighter @ihatecarnivals

tbh thats so valid of him, it took me like fifteen minutes to figure out

 

scientists hate this local new yorker @jbarnes

“couldn't see it :(“ –my boyfriend

 

Ferris wheel fighter @ihatecarnivals

omg that was my issue too!! My friend was trying to show me when I’d lost my glasses lmao

 

scientists hate this local new yorker @jbarnes

“blind”

 

Ferris wheel fighter @ihatecarnivals

me fr 😭 my prescription is BAD

 

scientists hate this local new yorker @jbarnes

“I actually cant see”

 

mimi @wheresmybeans

omg dude help your boyfriend find his glasses????

 

Bblimm @blooo

bro help him

 

piru @pirepiro

find his glasses for him!!

 

 


 

 

YES we have very strong opinions about colors and NO we dont all know each other

 

“blue”: i swear to god

 

“red”: What’s wrong?

 

“blue”: ask someone to pull up james’s twitter for you

 

“red”: Okay.

 

“red”: Oh my God.

 

“blue”: i dont know whether to laugh or cry

 

“red”: People are fantastic at ignoring what’s right in front of them.

 

“red”: It works in our favor, though. 

 

“blue”: indeed it does

Notes:

I HAVENT UPDATED THIS SINCE CHRISTMAS LMAO

natasha and percy went to dennys btw

for those wondering, dan's fear is a genuine fear a friend of mine has

guess who "red" is :)

plumbing baby. goodbye.

Chapter 37: TONY STARK SEDUCED OUR PARENTS???? (NOT CLICKBAIT) (REAL)

Notes:

(See the end of the chapter for notes.)

Chapter Text

SSEA

 

Tony Stank: commencing the public shaming of one Peter B. Parker

 

skrunkly raccoon: :o

 

percenary: ooooh someones in troubbblleeee

 

skrunkly raccoon: what did he do???

 

Tony Stank: i got a call from the school to pick him up

 

Tony Stank: for his SUSPENSION

 

percenary: 

 

percenary: @babyavenger tell me it was worth it

 

baby avenger: >:(

 

baby avenger: i will not be shamed for defending my territory

 

Tony Stank: …kid

 

Tony Stank: you know what

 

Tony Stank: barnes, add me to to the chat with all of peter’s rat bastard comrades

 

skrunkly raccoon: aight

 

baby avenger: WAIT DONT

 

 

 

 

percy’s bimbos

 

[terminator has added TS to the group]

 

TS:

 

TS: admittedly, the pure shock coursing through my body has tempered my rage.

 

TS: who named this?

 

TS:

 

TS: @TheNews(™) what???

 

TheNews(™): freedom of speech, bitch

 

terminator: this is my friend tony, everyone

 

TheNews(™): 

 

TheNews(™): stark?

 

TheNews(™):

 

TheNews(™): freedom of speech, sir*

 

TS: uh huh

 

TS: now, would any of you like to explain why i was called away from work to come collect peter?

 

TS: furthermore, why every single one of your guardians was standing outside the principal's office with me?

 

moonmoon: 

 

moonmoon: well, i’d like to start by saying that it was an honest mistake

 

moonmoon: and that, if any blame is cast, it should be upon Mr. Dell

 

TS: are you seriously trying to tell me that your history teacher is at fault?

 

moonmoon: yes sir i am

 

murphy’s law: he made the medieval age unit very intense, sir

 

murphy’s law: his descriptions of dark age warfare were very elaborate and descriptive

 

president lincoln: we’d just gotten out of his class

 

president lincoln: and we were sitting in the AcDec room

 

president lincoln: and the door was locked

 

president lincoln: and flash shoulder checked it really hard instead of knocking (cause he sucks)

 

president lincoln: and

 

TS:

 

TS: and all eight of you immediately took on the mindset of medieval peasants under siege?

 

The News(™): i believe so, sir

 

The News(™): the loud noise awoke something in all of us

 

Murphy’s law: i panicked and started moving the desks to barricade the door

 

moonmoon: and when charles panics, i panic, so i started helping him stack chairs on top of the desks

 

Avril lavigne: it was contagious, sir. i was reinforcing the windows with textbooks and scotch tape before i even knew what was happening

 

nedleedle: and when i saw all of that, i knew we were going to be preparing for the long haul, so i started rationing food for the winter

 

TS: well that explains the lunchable stack in the corner

 

The News(™): we were preparing a last stand. the pressure started getting to us. abe and i began our offensive maneuvers.

 

TS: you made flashbangs and exploding acid packets. 

 

president lincoln: we thought poisonous gas would be too hard to control

 

TS: and i thank the gods for that modicum of common sense in the midst of your madness

 

TS: but acid? really?

 

moonmoon: we were worried about the trebuchets, sir

 

Scary Captain: i realized fifteen minutes in that we might not last, so i boosted peter up into the vents to start the escape tunnel

 

TS: and thats why peter had that shovel?

 

tungsten dioxide whats this: and thats why i had that shovel.

 

TS: i don't even know what to say about this

 

moonmoon: neither do our parents. my mom is on the phone with ned’s to get us drug tested

 

The News(™): mine are calling my psychiatrist

 

Murphy’s law: mine haven't been able to look me in the eyes. I think they’re calling a priest

 

President lincoln: oh, you’re catholic?

 

Murphy’s law: nope

 

Murphy’s law: they're just that desperate

 

Avril lavigne: last i checked, mine were looking into reincarnation and past lives

 

Avril lavigne: my dad was on the phone with a lady who claimed to be a serf in a past life

 

TS:

 

TS: barnes, take me out.

 

[terminator has removed TS from the group]

 

 

 

 

ethically sourced sluts

 

vintage bi: i meant with a gun, but that works too. 

 

vintage bi: grab percy and bring him to my office? I have an idea.

 

antique gay: 🫡 you got it boss

 

 

 

 

[TS has created a new group]

 

TS: Hello, everyone. It’s recently come to my attention that many of us are at a loss of what to do with our respective children after today’s events. After speaking with my colleague, I believe I have found a solution that would benefit all parties. 

 

Emma Moon: You’re Peter’s other guardian, correct? May has mentioned you, but we haven’t gotten a chance to formally meet. Other than the brief chat we had outside Morita’s office. 

 

TS: That would be me. If all of you are available, I’d like to invite you to dinner for us to speak about today. My treat. 

 

Evan Murphy: That’s awfully generous of you, but not necessary. What time are you proposing?

 

TS: Please, I insist. I have a strong feeling this may be more my fault than any of yours. Does 7:00 work?

 

Susan Avril: 7:00 works for me. And how could this possibly be your fault?

 

TS: Good to hear. And as for the second part, I feel as though I’ve let Peter have too many unsupervised conversations with an…ancient warfare enthusiast I know. 

 

Isa Leeds: Ancient warfare enthusiast? How fascinating! If that’s the case, then I’m sure it can’t have been that much of an issue. People with obscure hobbies are delightful to be around! A while back, I had a lovely conversation with a young man about seagulls. 

 

Isa Leeds: Peter’s older brother, I believe. He was a very nice young man. 

 

TS: Ah. 

 

 

 


 

 

 

[TS has created a new group]

 

[TS has added Peter Parker, James Barnes, and PJ to the group]

 

[Peter Parker has added Ned Leeds, Michelle Jones, Sally Avril, Cindy Moon, Betty Brant, Abe Brown, and Charles Murphy to the group]

 

TS: Before any of you ask, this is for my own benefit. I don’t want to be haunted by the history of that other chat. 

 

Charles Murphy: …that’s fair. 

 

TS: Anyways, the reason I brought you all here. You see, I had the most delightful dinner with all of your parents.

 

Abe Brown: is that where my dad was?????

 

Charles Murphy: wait.

 

Charles Murphy: are you the reason my parents came home wine drunk

 

 

 

 

percys bimbos

 

moonmoon: PETER

moonmoon: MISTER BARNES SIR

 

tungsten dioxide whats this: what?

 

terminator: yes?

 

moonmoon: IS TONY STARK ABOUT TO TELL US THAT HE SEDUCED OUR PARENTS

 

tungsten dioxide whats this: im sorry???

 

 

 

 

Unnamed Group

 

TS: Yes, I suppose so. We were discussing how to proceed with all of you at Le Bernardin last night. 

 

 

 

 

percys bimbos

 

avril lavigne: I JUST GOOGLED THE RESTAURANT

 

avril lavigne: IT HAS THREE MICHELIN STARS AND I CAN'T PRONOUNCE HALF THE MENU

 

terminator: i'm going to be fully honest with you guys,

 

terminator: tony stark may or may not have had sex with some or all of your guys parents.

 

president lincoln: WHAT KIND OF SICK FUCKING POWER PLAY IS THIS

 

 

 

 

Unnamed Group

 

The News(™): you?? fed?? my??? mother??? scallop caviar??????

 

TS: Along with mesclun salad with truffle vinaigrette, some lovely halibut, and caramelized rice pudding with white peach sorbet. It’s amusing that you think I didn’t treat Amelia with multiple courses and dessert. 

 

The News(™): AMELIA?????

 

TS: You heard me. Are we done here?

 

The News(™): 

 

The News(™): ʸᵉᵃʰ

 

TS: Good. We came to the decision that, if you all have so much energy and a strange proclivity for violence, you’ll be learning to direct it in a healthy and heavily supervised environment. 

 

[James Barnes has changed the group name to ‘bootcamp’]

 

James Barnes: welcome to hell, kids :)

Notes:

*dissapears for two months*

*gently nudges TONY STARK SEDUCED OUR PARENTS???? (NOT CLICKBAIT) (REAL) towards you* hi

a very sincere thank you to everyone who reached out! i am fine and alive, i was just super busy for a bit, and then had some major computer troubles. everything is resolved now!

also, a VERY late happy pride month to everyone! enjoy tony stark, our slutty bisexual king :)

love you all!

plumbing baby. goodbye.

Chapter 38: mmmmmmmmmmmmm widely available explosives

Notes:

(See the end of the chapter for notes.)

Chapter Text

Bucky would almost be tempted to blame May Parker if she wasn’t the fantastic woman she was. It had started off fairly innocuous, the woman leaning on the counter and chatting with Tony while she waited for Peter to pack up the last of his things. 

 

“Yeah, the whole building used to get together on the rooftop and have a cookout, but the landlord put an end to it after last year,” May said with a roll of her eyes. “Bastard.” 

 

Tony made a face. For a man who had to be completely unfamiliar with landlords, he sure managed to hold a burning passion for them. The cogs in his brain were almost visible as they worked. He took a sip of his smoothie, then shrugged. “If it’s important to you, my rooftop is available.” 

 

“Really?” May asked, taken aback. “Oh, I can’t ask you to do that. Besides, I’m pretty sure most—if not all—of our neighbors made plans already.” 

 

A dismissive gesture. “Probably for the best, FRIDAY has been spending a frightening amount of time with Peter’s friends, and I’m worried she might try and use her newfound evil on the next unsuspecting stranger. Besides,” He said, “I’m sure the view of the fireworks will be much better from here.” 

 

May chewed on her lower lip for a moment, then broke out into a smile. “I’ll talk to Peter,” She said. Then, before exiting the kitchen, she put a hand on Tony’s arm. Voice warm, she said, “You’re a good friend, Tony. Really.” 

 

His face turned an alarming shade of scarlet, and, from his spot on the couch, Bucky laughed. 

 

 

 

 

From there, it was a flurry of preparation. The entire SWORD team, all of Peter’s horrible little gremlin comrades, the Parkers, and all of the tower’s occupants were invited with varying levels of respect. 

Pepper and Rhodey both received gilded and embossed envelopes with hefty cardstock invitations. Percy and Bucky, at least, received the courtesy of a polite knock and a verbal invite (Though, that may have been more out of fear than courtesy. Tony would never forget the last time he hadn’t knocked. Scarred. For. Life.) At the bottom of the chain, Peter’s friends received a text that said ‘ hey shitheads 🤪 come to the tower or i’ll zip your assholes shut’.

 

Surprisingly, that was the more orderly part of the preparation. Divvying up food responsibilities afterwards was much, much worse. 

 

“Alright, BBQ! Ribs, hot dogs, burgers, do I have an offer!” Pepper called, standing on the coffee table with a clipboard. “Grill’s already on the roof, we just need someone to man it!” 

 

Rhodey raised his hand. “I can do that and baked beans!” Pepper nodded approvingly, not trusting the majority of the others with flames in any form, ticking it off her papers. “I can help,” Natasha offered. Rhodey scrutinized her for a moment, then nodded, deeming her sensible.

 

“Side dishes!” Pepper announced next. “May’s already bringing corn on the cob.” Mal slapped a hand on the counter. “My dips could convince someone to kill their grandmother.” She said, intense. Pepper accepted that with a nod and the scratch of a pen. “Potato salad and some fruit would be nice.” 

 

Tony shrugged. “I can handle the potato salad.” This, for some reason, got him some serious stink-eye from Bridgette. From behind them, Percy offered. “I can find the best watermelons in a seven mile radius.” 

 

“Aw, man.” Ross muttered. “I wanted to bring the watermelons.” 

 

Percy slowly turned towards him. “I’ll fucking kill you.”

 

Ross clammed up and nodded. Bridgette was still staring at Tony, and now muttering under her breath. 

 

Another nod, two marks on the paper. “Drinks?” Bucky silently raised his hand. 

“Desserts?” Bridgette and Lee exchanged looks, then Bridgette broke her spell-casting(?) and spoke up. “We can do that.” 


“I’ll handle decorations. Can we get someone on silverware and plates?” Dan, who just learned how to boil water last week, turned to Ross, who was inching away from Percy’s menacing expression. “I guess that’s us.” Dan sighed. 

 

Pepper nodded. “Alright. You all have your missions.” She looked up from her clipboard for the first time. “Do not disappoint me.”

 

It was a simple statement, but somehow so, so threatening. 

 

 

They met on the roof a few hours before sunset. The tables were adorned with season-appropriate tablecloths, and chairs had been set up around the space. Ross and Dan’s plates and cutlery were stacked at the far end of a long, rectangular table, and the space from there to the grill Natasha was watching over slowly began to fill up; Bucky’s contributions of sweet tea and lemonade, large bowls of baked beans and potato salad, and Mal’s dips laid out in a surprisingly artful spread. Right next to the grill, stacks of corn sat, and large platters were slowly being filled with hot dog and hamburger buns, a couple neatly latticed apple pies behind them. 

 

Music was playing from a speaker by the roof access door, and a few blankets were set up near the ledge for later in the night. Peter was bouncing up and down, a motion that only increased as more as his friends showed up. Thanking the Gods that Percy was still inside, Tony watched them stare at Natasha with wide, starry eyes. The assassin seemed reluctant, but still greeted them. Cindy looked like she was going to pass out. 

 

They were just about to start dishing up when Percy arrived, a large platter balanced easily on one hand. He set it down on the only free space on the table, and everyone went silent. “Hey, Percy?”

 

“Hm?”

 

“Have you ever done anything fucking normal? At any point in your life.”

 

Percy’s deadpan was impressive. “I have no idea what you’re referring to.”

 

The platter had multiple fair sized watermelons on it, each elaborately carved. From where Tony saw, he could see multiple watermelon sharks circling around an absolutely breathtaking rendition of an eighteenth century ship. Other fruits made up small details, forming waves and a distant, rocky shoreline—-he could pick out pineapple, grapes, and strawberries, at the very least. 

 

To the left of him, Percy hummed. “It’s the HMS Victory.” He informed Tony blithely. “Served 245 years.” 

 

Tony just stared at him. “Why do you do these things?” He whispered. 

 

 

Rhodey and Nat had grilled everything to perfection, his experience combined with her lethal focus. Mal’s description of her dips was apt, and the lemonade was the perfect mix of sour and sweet. It had taken Peter’s friends a couple minutes to stop staring, open-mouthed, at Percy, and a few more for them to clean up the drool, but after that, the party began. 

 

(Rhodey took pity on Natasha, who was watching the teenagers follow Percy with their eyes borderline obsessively. “They’re infatuated. We can’t do anything about it. We’ve tried. Barnes thinks it’s funny.” He supplied.)

 

Tony, Pepper, and May all relaxed back in lawn chairs as they ate, soaking in the last of the sun’s rays as it began to inch towards the horizon. Natasha was, once more, monitoring the grill with a burning intensity as Rhodey filled up plates for the both of them. Bridgette was leaning back in her chair, using one of Lee’s broad shoulders as a footrest. He was seated on the ground in front of her, seemingly not minding, talking quietly with Mal. All three of them were keeping an eye on Ross and Dan, Bridgette’s eye developing a twitch whenever one of them got vaguely near the grill. 

 

Thank the Gods for Natasha’s vigilance. 

 

Peter’s knees were curled up to his chest, clutching nothing but the serving bowl of baked beans and a large spoon. The other kids sat in a loose circle with him, and Tony was honestly too tired to even try and listen to whatever they were talking about. All he knew was that Abe was on his sixth hot dog, Cindy was gnawing on an entire watermelon shark, and Betty was online shopping for fireworks. All of them were fixated on Percy and Bucky, the only ones seated at a table. With a sick sort of fascination, they, including Bucky, watched as Percy steadily destroyed an entire rack of ribs. 

 

Charles leaned forward, half-heartedly chewing as Percy stuck an entire rib in his mouth, only to spit out a gleaming bone a second later. Bucky looked, quite frankly, delighted. 

 

Tony looked away and resumed his conversation with May and Pepper. Those two were each other's problem tonight. 

 

As the evening dipped into night, everyone started crowding closer to the ledge, settling on the blankets spread out. It was warm enough to not have to worry about the night’s chill, the breeze only lightly ruffling clothes and hair. Peter had a pair of headphones sitting in his lap in preparation for when the fireworks began, eagerly focusing on the East River in the distance. 

 

“Are you sure we’ll be able to see them?” Sally asked. “It’s a bit far.” 

 

Tony sighed dramatically. “No faith, child. None.”

Sally blinked, and slowly turned back to the cityscape, now equal parts nervous and excited. Anticipation was curled in their guts as the sky further darkened, checking watches and phone’s every couple minutes. The rooftop had settled into silence, the grill turned off and conversations flowing to an end. 

 

The first firework shot upwards into the sky, a spark with a plume of smoke trailing after, exploding in a massive shower of blue and red sparks. The accompanying sound would be better attributed to a bomb than a firework, deafening and unmistakable. For just one second, the entire sky seemed to light up.

 

Slowly, Sally turned back to Tony. “That can’t be legal,” She breathed. 

 

The man just grinned and raised his Solo cup of lemonade. “You’d be surprised what people are willing to do when you supply the explosives.” Was all he said. 

 

The barges floating down the river started shooting more, some making high-pitched whistles and exploding into clouds of shimmers, others booming like a mortar and expanding across the sky. It was blinding and deafening and absolutely breathtaking. Even Peter, with the padded headphones fixed over his ears, was transfixed, the explosions of light reflecting off his eyes. 

 

Lee, too, had brought ear protection, leaning forward and resting his chin on Bridgette’s head, who’s migrated from her chair into her partner’s grasp, settled between his legs. Mal, Ross, and Dan were all individually plotting to try and get Tony to supply them with whatever he had given the barges to shoot into the sky. May’s gaze went back and forth from the fireworks to Peter’s awed expression, her eyes soft and adoring. Even Natasha, a hip leaning on the table, was watching in silent appreciation. 

 

Percy and Bucky sat in the back, both supplied with earplugs. Bucky rested against the wall by the roof access door, Percy propped up against his chest. The supersoldier’s arms circled around his boyfriend, hands resting on his stomach. The first half hour of the show was completely lost on him, instead staring at the starburst reflecting on Percy’s eyes. The demigod, though unable to see the fireworks, assured Tony with a shrug that feeling the explosions in the sky was entertaining enough. “Feels fuzzy,” He’d said as they began planning earlier. 

 

Percy was engrossed with the strange sensation in the sky accompanied by his boyfriend’s heartbeat. He’d been a bit worried about how his James would react to the fireworks—though they were both veterans in some form, Percy’s experiences involved a lot less loud bangs and more children hacking eachother apart with blades. Bucky, though, seemed content with the earplugs and Percy in his arms.

He was glad. Bucky, of all people, really deserved to have some fun. 

 

A particularly flashy one went off, arcing across the sky in a brilliant shower of gold and green, and a soft round of exclamations went off from the teens sitting by the ledge. Peter, at some point during the night, had ended up sitting next to MJ, and, at another point, had began to lean against her. Though she hid it fantastically, her heart jumped up into her throat. MJ turned her head to look behind her, careful not to jostle Peter, and made eye contact with Bucky, who had practically enveloped his boyfriend with his arms. The supersoldier raised a sole eyebrow, lips twitching upwards, and MJ, heart thumping in her ears, settled an arm over Peter’s shoulders. 

 

He squished further into her side at that, and MJ’s mouth suddenly felt very, very dry. (...He was still holding the fucking bean bowl. It was a terrible thing that she found that endearing.)

 

Charles was on his stomach, chin propped up in his hands, and Cindy was using his back as a pillow, staring directly upwards into the sky. These fireworks, whatever the hell they were made of, shot high enough for her to not even need to turn her head to see them. Sally and Ned were awfully close and Abe and Betty were fighting over a hamburger bun, eyes glued on the show. 

 

None of them spoke for what felt like hours, a captive audience. Each firework seemed more impressive than the last, brighter and more colorful. They seemed to rip the sky open like it was made of fabric, tearing open the night and letting flashes of the day come through.

Percy tipped his head up, lips barely an inch away from Bucky’s ear. “It’s going to end soon,” He said softly, the proximity allowing him to be heard despite the earplugs. “Rain’s coming.”

 

Sure thing, the show seemed to be building up to a finale. There was a short pause, like bated breath, before a barrage began. All at once, the barges on the river let off a whistling arc of fireworks, setting the world ablaze in scarlet and gold, a bombardment in signature colors. For just a moment, the night turned to day. 

 

Then, silence. 

 

Peter was the first to break it, slipping his headphones off and turning to stare at Tony, who was still lounging in his chair. The boy scrambled up and launched himself at his mentor, wrapping him in a hug. Tony wheezed but laughed all the same, returning the embrace. As Peter pulled away, he was already firing questions at the man. “How did you do that? When did you do that? How many laws did you break? Do we need to be worried? Should we—” 

 

Tony pat Peter on the back. “I have my ways.” 

 

Surprisingly, that seemed sufficient to Peter, who beamed at him and hugged him once more. “Thank you,” He murmured against Tony’s collar. The man just smiled and tucked his face into Peter’s curls. 

 

May was the second to get up, watching the two with a smile, and beginning to cover dishes and stack them to be moved inside. Percy wiggled free of Bucky’s grasp, and, after hauling his boyfriend to his feet in a show of strength that had the AcDec team wheezing, the two began collecting trash. Natasha and Rhodey took care of the grill while Tony, who still had Peter clinging to him, started folding up the tablecloths. Pepper and the SWORD team collapsed the tables while the AcDec team folded chairs and blankets. 

 

“That,” Abe finally said after a long moment of reflection, “Was badass. I didn’t even know fireworks could get that big.” 

 

“Yeah,” Cindy breathed. “Forever ruined for other fireworks.” Charles and Betty nodded solemnly. 

 

Tony, plus his parasite, helped collect the last of the trash. “So,” The man asked over the quiet chatter than had picked up as everyone milled about. “How was it?” 

 

Percy, who’d taken out his earplugs, beamed at him. “Very cool.” Tony nodded. “I’m glad. The people on the barges were all too happy to accept my donations. Maybe…too happy. I might need to—” He was cut off by a loud boom as one last firework went off. At the sound, Percy squeaked, and, across the roof on the only remaining table, a watermelon exploded. 

 

Luckily, nobody had been directly in the blast zone, but a large area of the roof was now covered in chunks of fruit. 

 

“I think they forgot one.” Lee finally observed, shattering the stunned silence. Percy’s face, though it was near impossible to tell in the low lighting, was bright red. “I’ll clean that up.” He promised. Bucky, who looked to be fighting an agonizing battle to not burst out laughing, offered to help through his wheezes. 

Everyone slowly migrated inside, most of them hiding smiles. The AcDec kids ran for their overnight bags, eager to set up the promised blanket fort in the common rooms as Rhodey, Pepper, Natasha, May, and Tony retired to their usual rooms, leaving Percy, Bucky, and an exploded watermelon on the rooftop. 

 

The second the door had shut behind the last person, Bucky burst out into peals of laughter, doubling over. 

 

Percy’s cheeks burned. “Shut up, oh my Gods. I hate you so much.” 

 

Bucky wheezed. “You…you blew up a watermelon.” 

 

“I am aware,” Percy mumbled, bending down to begin collecting chunks of rind. “I got startled.” 

 

His boyfriend, still grinning, began to help, scooping the massacred fruit into a garbage bag. Above them, the sky gave a warning rumble. Moments later, rain began to fall from above, as if the fireworks had torn holes into the clouds themselves. 

 

As he flicked a puddle of watermelon juice into the trash, Percy sniffed. “People who laugh at my watermelon-related accidents don’t get the benefit of me keeping them dry.” Bucky’s smile was unrepentant, even as the the droplets began to drop down on his shoulders and head. 

 

The last of the massacred fruit taken care of, Percy tied off the bag and turned to bring it inside with the others, only to find Bucky standing in his way. His boyfriend pressed up against him, hands settling on his waist and pulling him even closer. Percy didn’t resist, letting the bag gently hit the ground. 

 

The rain began to pour harder, flattening clothes and hair. Neither minded, staying exposed to it in each other's embrace. Percy’s soft curls stuck to his forehead, and Bucky ran his fingers through them, pulling them back to expose his face. “I love you,” Bucky reminded with a smile. “Watermelon murders and all.” 

 

Percy’s flush returned, a rosy shade that Bucky adored. One hand slipped away from Percy’s waist, tilted his chin up for Bucky to kiss him. Percy melted into the embrace, settling fully into Bucky’s arms as he kissed him. “Love you too, jackass,” He breathed as they separated. Bucky hummed, pressed another quick kiss to his lips before reluctantly stepping back, picking up the trash bag Percy had dropped. “C’mon. It’s late.” He beckoned. 

 

They ran into Tony in the kitchen, who had changed into his pajamas and was speaking quietly to FRIDAY before he went to bed. He looked them over—soaking wet, fingers laced together and smiling. 

 

“You’re dripping on my floors.” He said flatly. 

 

“Better water than watermelon, though, yeah?” Bucky asked with a shit-eating grin. Percy smacked him on the chest and dragged him into the elevator. “Goodnight, Tony!” The demigod called as the doors slid shut. 

 

The engineer rolled his eyes. “Night.” 

 

Once in their room, Percy and Bucky shed their soaked clothes, leaving them in a heap on the bathroom floor with a nonverbal agreement to deal with them tomorrow. Bucky tossed a change of clothes towards Percy, who had been shaking his hair dry like a dog. 

 

As Bucky dressed himself, he watched Percy’s unamused expression as he pulled on the sweats, having to roll them a few times at the ankles. “You think you’re so funny,” The demigod grumbled, pulling on the sweatshirt he’d been provided. 

 

Bucky shrugged, unashamed. “You look nice in my stuff,” 

 

“Be shorter,” Percy advised as he walked back into the bathroom to brush his teeth. Bucky didn’t have to see him to know his cheeks were tinged red. Bucky rolled his eyes and followed him. 

 

They brushed their teeth in pleasant silence, only disturbed once they’d finished and Bucky caught Percy by the hip as he walked past him, scooping him up into his arms. Like he did every time, Percy made a high pitched squeak of surprise. Bucky shook his head as he walked towards the bedroom. “I really don’t understand how you still don’t see this coming.” 

 

“I don’t see anything coming. Fuck you.” 

 

Bucky deposited his boyfriend gently on the mattress and immediately climbed atop of him, pinning him with his bodyweight and pressing merciless kisses to his exposed neck and jaw. “You love me so much it’s stupid,” He said against Percy’s pulse point, then making his way down the column of his boyfriend’s throat. 

 

Percy made an indignant noise, cut off by a whine as Bucky took the soft skin in between his teeth. “James,” He got out. Bucky hummed against him, continuing to darken the his throat with his lips and teeth. One hand, skin warm and rough, slid up to thread through Percy's hair, the other curling around his shoulder. Percy, despite his whining, was soft and limp beneath him, completely relaxed between Bucky and the mattress. 

 

“It’s like one in the morning,” Percy’s breath hitched as Bucky moved down to his collarbones. The supersoldier made an acknowledging noise, leaving one last mark that Percy knew would be all sorts of colors in the morning before climbing off of him. “None of those were very nice responses to declarations of love.” 

 

Percy made a face, climbing under the covers. “Yeah, and this was?” 

 

“A more permanent reminder,” Was the unashamed answer. “You wear high-collared shirts to work anyways.” 

 

A pause. “Yeah, I definitely hate you.” The demigod said as he pulled the comforter up over both of them, leaning his back against Bucky’s chest, who slung an arm over his waist and pressed his open palm to Percy’s heart. “Mhmm,” Was the only response he got. 

 

Percy, shrouded in the darkness of their room and pulled snug against his partner, huffed, a smile making its way onto his face. “Dick.”

 

“Asshole.” Was the reply. 

 

Percy tilted his head back to kiss him one last time before going to sleep.

Notes:

a??? fourth of july??? chapter????

got some irondad, wintersea, mj and peter, and general shenanagins and tomfoolery for you all

fun fact: early on, before the lost soldiers was even written, i had drafted percy and bucky's first kiss being in the rain after watching fireworks together :)

funner fact: where was mrs. o'leary during this, you ask? driving the barges. all of them at once. she's the demolitions expert.

percy weaponizing watermelons was something that needed to be explored okay
that and him just. fucking demolishing a rack of ribs. covered in sauce gnawing on bones fully regressed into some sort of fucking animal and bucky just dreamily staring like 'what a man'

(somehow the fireworks tony provided had no negative environmental impact. dont ask me how. its for my peace of mind)

plumbing baby. goodbye.

Chapter 39: bucky twitterdumping era

Notes:

usernames list:
we had a bonding moment! i cradled you in my arms!
-Father of 5: tony
-crack dealer: percy

percy's bimbos/bucky's victims
-moonmoon: cindy moon
-President Lincoln: abe brown
-murphy's law: charles murphy
-avril lavigne: sally avril
-The News(TM): betty brant
-Scary Captain: mj
-nedleedle: ned
-tungsten dioxide whats this: peter
-terminator: bucky

(See the end of the chapter for more notes.)

Chapter Text

[James Barnes has changed the group name to ‘bootcamp’]

 

James Barnes: welcome to hell, kids :)

 


 

we had a bonding moment! i cradled you in my arms!

 

Father of 5: how is it going

 

crack dealer: james is making them do push ups

 

crack dealer: i think charles passed out

 

Father of 5: have they begun to regret their life choices?

 

crack dealer: oh most definitely

 

Father of 5: excellent

 


 

percy’s bimbos

 

[nedleedle has removed terminator from the group.]

 

[nedleedle has changed the group name to ‘bucky’s victims’.]

moonmoon: jesus fucking christ

 

moonmoon: i cant feel my arms

 

murphy’s laws: can confirm, she’s typing with her nose

 

president lincoln: i hate it here. i hate it here. i hate it here.

 

avril lavigne: i think im going to vomit up my lungs

 

Scary Captain: im going to be fully honest; i didnt even know i could sweat from some of these places

 

The News(™): agreed

 

tungsten dioxide whats this: losers.

 

murphy’s law: PETER D:

 

moonmoon: don’t act like this isn’t killing you too

 

murphy’s law: cindy

 

murphy’s law: look up

 

moonmoon: what

 

moonmoon: 

 

moonmoon: oh ok what the fuck

 

avril lavigne: peter can you please stop doing laps and taunting us with your superior athleticism

 

The News(™): why are you going so fast

 

Scary Captain: i feel like you guys have forgotten that being spider-man requires him to actually train

 

tungsten dioxide whats this: yeah, im sorry guys but this is kind of normal for me

 

President Lincoln: how dare you.

 

President Lincoln: YOU ARE SUPPOSED TO HAVE ASTHMA

 

tungsten dioxide whats this: i got over it

 

moonmoon: peter…traitor to our people

 

avril lavigne: god its like you dont even have a peanut allergy anymore

 

tungsten dioxide whats this:

 

avril lavigne: NO

 

tungsten dioxide whats this: i eat shit ton of peanut butter for p̵̺͎̹͝r̸̛̰̩̲̊̈́o̶̞͎̥̓ṯ̷̑e̸̪͂̉̀i̶͚͂̚̕ǹ̵̨͇͍͂͊ now

 

The News(™): WHY ARE YOU TALKING LIKE A GYM BRO

 

tungsten dioxide whats this: sally…

 

tungsten dioxide whats this: i am a gym bro.

 

The News(™): IM SOBBING

 

murphy’s law: why would you do this to us peter

 

tungsten dioxide whats this: the society that separates its scholars from its warriors will have its thinking done by cowards and its fighting by fools, bitches

 

Scary Captain: hngg

 

tungsten dioxide whats this: mj?

 

Scary Captain: arm cramp. 

 

tungsten dioxide: oh

 


 

Michelle Jones and James Barnes

 

Michelle Jones: HE JUST QUOTED THUCYDIDES

 

Michelle Jones: HE BENCH PRESSED A COUPLE HUNDRED POUNDS, RAN FIVE MILES, QUOTED THUCYDIDES, AND INSULTED ALL OF OUR FRIENDS

 

Michelle Jones: i am feeling so many emotions right now i think. perhaps all of them.

 

James Barnes: oh boy

 


 

bucky’s victims

 

moonmoon: WHY ARE YOU EVEN HERE

 

tungsten dioxide whats this: warming up

 

tungsten dioxide whats this: gonna get my ass kicked soon

 

moonmoon: h u h

 

tungsten dioxide whats this: since i already have a singular muscle in my body

 

murphy’s law: rude and unnecessary 

 

tungsten dioxide whats this: im continuing getting my ass kicked by mr stark’s pet psychopath

 

The News(™): im sorry??????

 

tungsten dioxide whats this: p e r c y

 

President Lincoln: rude???

 

tungsten dioxide whats this: no you dont understand

 

tungsten dioxide whats this: if you guys think barnes is bad….

 

tungsten dioxide whats this: theres a reason percy’s not teaching you guys

 

tungsten dioxide whats this: he would break you.

 

nedleedle: gonna need some more info there bud

 

tungsten dioxide whats this: apparently percy’s idea of training children involved actual weapons, something about lava and climbing walls, and also releasing various Beasts into an arena with us

 

avril lavigne: 

 

avril lavigne: are you serious

 

tungsten dioxide whats this: unfortunately

 

tungsten dioxide whats this: it was all very specific, so im pretty sure that’s how he was taught

 

Scary Captain: is…is that why he is the way that he is

 

tungsten dioxide whats this: i believe so yes

 

moonmoon: so why is he teaching YOU??

 

tungsten dioxide whats this: honestly? 

 

tungsten dioxide whats this: im pretty sure it’s because, of the two people available to me that can know how to fight with super strength, percy just happened to show up at the tower first

 

tungsten dioxide whats this: every day i thank god my enhancements make me Sturdy and my bones don’t shatter when he hits me

 

nedleedle: that sounds fucking terrifying what the fuck

 

tungsten dioxide whats this: yep.

 


 

“Break time is over!” Bucky announced. The AcDec team, sans Peter, who were sprawled on the gym floor, groaned. Peter, over on the track, bounced over to the pile of his broken friends to put his phone with his gym bag. 

 

“Were you texting while running?” Bucky asks, unimpressed. Peter nods. “I was telling them how insane your boyfriend is,” He says conversationally. “And that they lucked out with you.” 

 

Cindy, sweaty and bright red, looks up at Bucky. “Is he really that…extreme?”

 

“Once, he was held captive on an undercover mission, and he got hung up from the rafters with chains. When the guy guarding him got distracted, Percy grabbed him around the neck with his thighs, lifted him up, and snapped his neck mid-air.” To their collective horror, Bucky says this dreamily, a besotted look in his eyes. 

 

A beat passed, the AcDec kids' eyes going distant. “You think that’s hot, don’t you.” Peter said, disappointed. Guiltily, they all nodded. 

 

Slowly, Peter turned to Bucky. “Do you think you can convince Percy to snap my neck, too?”

 


 

You Know Who I Am @TonyStark

@NatashaR, welcome.

 

You Know Who I Am @TonyStark

Everyone else, please be normal about this. 

 

BLACK WIDOW MY MOMMY @blackwidowsimp

OHHOHOHOOHOHEHEHEHEHE

 

You Know Who I Am @TonyStark

Dear Lord. 

 

 

Black Widow, Baby @NatashaR

 

142K Followers | 15 Following

 

Following:

spidey @spidey-official 

scientists hate this local new yorker @jbarnes

You Know Who I Am @TonyStark

Coolest intern @peterparkour

WSC @WorldSecurityCouncilPOfficial

Save the Children International @save_children

Operation Underground Railroad @OURrescue

Stark Industries @StarkIndustriesOfficial

See more…

 

Black Widow, Baby @NatashaR

To be truthful, I’m not exactly sure what I expected when I was told some of my colleagues had gotten a twitter account. 

 

Black Widow, Baby @NatashaR

The thirst tweets and marriage proposals are seen and appreciated. Some of you really have a talent for words. 

 

Black Widow, Baby @NatashaR

Yes, to everyone asking, I have seen the Nick Fury account. No, I have no idea what’s going on there, and I will not touch that situation with a ten-foot pole. 

 

Black Widow, Baby @NatashaR 

And thank you to @peterparkour, Tony’s best quality, for helping me find everyone I wanted to follow. 

 

Black Widow, Baby @NatashaR

Lastly, @jbarnes, would you like to explain yourself? At all?

 

scientists hate this local new yorker @jbarnes

i have no idea what you’re talking about.

 

Black Widow, Baby @NatashaR

 

Black Widow, Baby @NatashaR

     scientists hate this local new yorker @jbarnes

     for some reason, a lot of you keep asking me for relationship advice, so ill share this. an  important part of any healthy relationship is trusting your partner and keeping your  emotions in check. a good example of this is today, when i was out with my boyfriend shopping. this one guy kept making passes at him, even though he was told to back off. here's a thread on how i handled the situation.

 

     scientists hate this local new yorker @jbarnes

     i shot him.

 

Black Widow, Baby @NatashaR

     scientists hate this local new yorker @jbarnes

     im really into this skincare shit you guys have come up with. we just kind of used to rub  bars of soap on our faces if we felt like it. love this modern shit. kidnappers stand no  chance against my fucking skincare routine. grab me by the neck i will just slither out like a wet hotdog

 

 

Black Widow, Baby @NatashaR

     scientists hate this local new yorker @jbarnes

     you guys are all so lucky that my weighted blanket (my boyfriend) is holding me back

 

Black Widow, Baby @NatashaR

     scientists hate this local new yorker @jbarnes

     im being judged for buying twenty boxes of girl scout cookies. as if thats my fault.

 

     scientists hate this local new yorker @jbarnes

     there were four of them and only one of me!!

 

     scientists hate this local new yorker @jbarnes

     ‘you are literally an assassin’ ‘didn’t you fight in a war’ ‘dude they’re like 10’ have any of you ever MET a girl scout???? they are RUTHLESS

 

     scientists hate this local new yorker @jbarnes

     and they have DIFFERENT FLAVORS??? they used to have only shortbread!!! i was weak and distracted

 

     scientists hate this local new yorker @jbarnes

     just ate a box of each flavor and threw up.

 

     scientists hate this local new yorker @jbarnes

     I HAVE BEEN BANNED FROM BUYING GIRL SCOUT COOKIES

 

 

Black Widow, Baby @NatashaR

     scientists hate this local new yorker @jbarnes

     I WANT TO GET UP AND RUN AROUND AND JUMP AND CLIMB AND MAKE NOISE BUT MY BOYFRIEND IS ASLEEP ON THE COUCH!! HE IS MY WORLD!!!!

 

Black Widow, Baby @NatashaR

     scientists hate this local new yorker @jbarnes

     friendly reminder that life is a tornado and im just a cow being spun around for cinematic value

 

Black Widow, Baby @NatashaR

     ethan jones @ethanjones342

     Is it just me or is the ex-Winter Soldier guy never shutting up about his boyfriend really annoying? Like, we get it. Jesus. Stop shoving shit down our throat. 

 

     scientists hate this local new yorker @jbarnes

     ATGCTCTTAGGTCTAGATCTATGGAACTCAGACTG

 

     piru @pirepiro

     Did…did you just dox his genetic sequence? 

 

 

Black Widow, Baby @NatashaR

     scientists hate this local new yorker @jbarnes

     “you threatened to stab me in a fit of rage” and??? im literally vaccinated the cdc says im safe to be around

 

 

scientists hate this local new yorker @jbarnes

i think that’s all perfectly self-explanatory, natasha.

Notes:

the acdec kids: we're all loser nerds here
peter, nodding: yeah. we're all in advanced classes, read textbooks for fun, deadlift a couple tons, and love doing extra credit
the acdec kids:
the acdec kids: hey what was that one in the middle-

mj is learning about feelings. pray for her.

percy is tony's feral dog. i do not take criticism. see Rumlow Incident for proof.

also, save the children and operation underground railroad are real organizations, and those are their real twitter accounts! you guys should check out their work

bucky: so trust your partner-
somebody: literally how does that connect to you shooting that man??
bucky:
bucky: i trusted my partner wanted his ass dead.

plumbing baby. goodbye.

Chapter 40: Halloweenie 2: pumpkin

Notes:

(See the end of the chapter for notes.)

Chapter Text

Peter blamed Flash. 

 

They all blamed Flash. 

 

Third period had been going fine—Ned and Peter had been happily ignoring their teacher go on about Andrew Jackson’s love affair with the Presidential veto power, drawing little stick figure sketches of their halloween costumes, when Flash scoffed low in his throat. The two of them had ignored him, as per usual, but he’d drawn the attention of Cindy and Charles, sitting on either side of him.

 

“That’s the stupidest fucking thing I’ve ever seen,” Flash said under his breath, casting another look at the paper between Ned and Peter.

 

“Don’t be a dick.” Cindy snapped quietly. “What’s your problem, dude?” Charles asked defensively. 

 

“What are you two gonna do, trick-or-treat and go to bed at eight?” Flash asked mockingly, ignoring Cindy and Charles. 

 

Ned, after a moment, looked up at Flash. “Why, you angling for an invite?” He asked boredly. 

 

“Fuck, no.” Flash said with a sneer. “Just wondering when you’re gonna act your age. I mean, Jesus, I get you two aren’t invited to anything, but damn.” He leaned back in his chair.

 

Peter frowned. “There’s nothing wrong with having a Halloween party with just your friends, Flash. Piss off.” 

 

“Oh, it’s a party, is it?” He mocked. “Christ, Parker, you and your two friends plus your Aunt isn’t a party.” Flash spoke slowly, condescendingly. Then, “This is the reason nobody would fucking miss you.”

 

Silence.

 

Peter didn’t reply, his frown just getting deeper. After a second, he just looked down, not bothering to respond to Flash. Under the table, Ned gave his arm a quick squeeze in solidarity. 

AcDec practice isn’t any better. Despite their best attempts, they can’t get Flash off the team. The majority of the things he’s done are brushed off as accidents, or it's a typical case of their word versus his. Mr. Harrington can only do so much.

 

“Eugene. Pay attention.” MJ snaps after her third ignored prompt. 

 

He looks up at her from his phone. “Jesus, calm the hell down. Just responding to an invite.” 

 

“I don’t care.”

 

Flash rolls his eyes at her. “Don’t be a bitch just because you didn’t get invited to anything.”

 

Under the desk, Peter’s fist clenches so tightly his knuckles pop. Ned stands up, slamming his hands on the table. “Don’t call her that.” 

 

“Fucked up, man.” Abe agrees. 

 

He remains unbothered. “God, please. I get it, none of you got invited anywhere, you’re all pathetic and nobody wants you around. No need to take it out on me.” 

 

“Get out.” MJ’s voice is hard. 

 

Flash goes easily, slinging his bag over his shoulder. “My driver’s here for me anyways. I have a party to prep for.” With a mocking grin, he’s gone. 

 

“I hate him.” Sally says under her breath. A wave of quiet agreement follows from everyone but Peter, who’s staring down at the ground. MJ looks over at him. “Flash is full of shit, Peter. You know that.” Her voice was, even by her standards, gentle. 

 

Peter, where he was hunched into his sweater, nodded. “I know.” He said easily. He looked up at her, and there was something uncharacteristic in his eyes. “But sometimes…I really feel like making him regret being such an ass.” 

 

MJ stared at him for a long moment, something nonverbal passing between them, and, slowly, a smile crept over her face. 

 

Abe, from his spot across the empty classroom, shuddered. 

 

“Peter,” She breathed. “You certainly have your moments.” 

 

For the first time that day, he broke out into a small smile.

 

They had dragged the entire group along, abandoning the rest of practice in favor of walking to the nearest subway station and taking it a few blocks north, then walking in almost silence into the Stark Tower lobby. Peter waved to the receptionist, who gave him a smile as he took them all into the elevator. 

 

“Where is everyone?” Peter asked the ceiling. 

 

“Boss is working the 92nd floor, Ms. Romanoff is in the 91st common room with Sergeant Barnes, and Vision is in his apartment on the 93rd trying out a new recipe.” A pause. “He invites you to come taste test once he is finished. Colonel Rhodes, Ms. Potts, and Commander Jackson are all out at the moment.” 

 

Somebody makes a disappointed noise, and Peter blindly elbows them. “Thanks, Fri. Can you take us to Mr. Stark?” He blinked. “Actually, wait, no—to the 91st, please.” 

 

“Of course.” The elevator begins to move upwards, and MJ nods at Peter. “Get Barnes onboard. Smart.”

He sends her another blinding smile. Ned is pretty sure he’s the only one who notices the faint red that appears on her face. 

 

The doors open to reveal Bucky and Natasha sitting on the couch, looking displeased at the television. On it, somebody lets out a guttural scream, and there is a sickening snap sound. Bucky, who’s laying upside down with his knees over the back of the couch, scoffs. “Please. The blood would not have gotten that far.” 

 

Natasha takes a bite of a piece of licorice and hums. “The first part wasn’t too bad, though. Creative.” Bucky shrugs. “Sure, but not original. Did that back in ‘75.” She makes a vaguely interested noise before turning to the group, still standing in the elevator. 

 

“Hi.” Peter says. “We need your help.” 

 

“With what?” Bucky asks. 

 

MJ and Peter exchange looks before replying. “We want to make one of our classmates shit himself.” They say in unison. 

 

Natasha pauses the movie. Bucky sits upright. “Say more.” 

 

Peter drops down to sit on the carpet, the rest of the AcDec team following. “So, basically, Flash is being a dick again—” 

 

Bucky leans over and whispers into Natasha’s ear. “Little transphobic bastard, Peter’s classmate.” She nods solemnly. 

 

“—and he was making fun of me and Ned for not getting invited to any Halloween parties, I guess? Not really sure. As if he’d know, anyway. But we’re getting really tired of his shit.” Peter continued. 

 

“He laughed at my school paper segment,” Betty added quietly. Abe put a hand on her shoulder and nodded. “She worked really hard on it. He also broke my nitrogen cycle model.”

 

“I was working on an art project during study hall, and we got in an argument so he dumped water all over it.” Cindy said with a frown. “He keeps saying really nasty stuff about how I dress.” Sally recounted next, a little furrow in her brow. Charles crossed his arms. “He mocks my speech impediment. All the time. He tried to get me kicked off the team because I ‘couldn’t properly answer questions’.”

 

“It stopped once I got the administration involved, but he used to grab me all the time. Like, my waist and my hips, and he’d make all these jokes about how he’d do anything to get with me.” Cindy said after a minute. 

 

“He knocks over my lunch tray all the time. Says ‘I don’t need anymore food’.” Sally gritted out. 

 

“The less said about the race jokes he makes about me and Michelle, the better.” Abe said flatly. 

 

“He finally stopped deadnaming me, and telling everyone my ‘real name’ because he got suspended. After that, he switched to calling me Penis Parker.” Peter added. “I don’t even want to get into what he says about my parents. Today, he told me nobody would miss me.”

 

“He bothered me and my homecoming date for weeks about going out with him. When she told him she was a lesbian, he said he’d still fuck a lesbian.” Betty said softly.

 

“And today, he told all of us that we’re pathetic and nobody wants us around.”

 

Bucky and Natasha, who’s eyes had narrowed more with each statement, stood up, something burning in their gazes. “Alright, then.” Natasha replied evenly. “Let’s do something about it.” She looked at Peter. “He was talking about Halloween parties, you said?”

 

 

They went on a recruitment tour. 

 

First thing, up a floor to the labs, where Tony appeared before them covered in grease and holding a blowtorch. He looked at them, lined up outside his door, two Russian ex-assassins and eight teenagers with a grudge, and flipped up his welding mask. 

 

“What are we doing?” 

 

After Peter told him more about Flash, Natasha had to restrain him from sending out the Iron Legion. Eventually, though, he heard them out and gleefully set to work on their plan. “The company can wait. Pepper will support me.” Was all he’d said, stripping off his protective gear. 

 

Next, Bucky, in a definitely illegal move, took them all to a building that Cindy didn’t even know existed. There was no signage outside, not even a building number by the door or on the curb. He led them through all seven insane steps of security before barging into the bullpen. 

 

The first person Cindy recognized was Mal, who she’d gone monster hunting with almost exactly a year ago. She wasn’t dressed like a Furby this time, though, instead in a nice pair of pants and a blouse. Next to her was the woman Cindy vaguely remembered to have gone off with Sally—the two occasionally sent each other Pinterest hairstyles—in a pencil skirt and flats. They both looked up from the computer in front of them. “Hello,” The woman said, surprised. 

 

“Hi, Ms. Bridgette!” Peter chirped. She smiled warmly at him and stood from her desk. “How can I help you?” 

 

“Revenge plot.” Natasha said.

 

Bridgette’s lips parted and her brows raised. Then, she leaned over and pressed a button on the underside of her desk. A door on the far side of the wall swung open. “Lee and Spencer are in the biolab. If you’ll go fetch them, Sergeant Barnes, I’ll get Ross and Dan.” 

 

Bucky nodded and walked down the hall. Bridgette went the opposite direction, disappearing up a set of stairs, leaving the rest of them in the middle of the bullpen with Mal, who gave Cindy a little wave. 

 

An elevator opened to their left, and Bridgette walked out, accompanied by one man in a wheelchair and another holding a giant stack of papers. “Hi, Dan.” Charles said from next to Cindy. Abe, on the other hand, looked at Ross for a long moment. “You finally got the blue dye out.” He noted. Ross gave him a thumbs up, and Dan waved. 

 

Bucky returned to the bullpen a minute later, two people in lab coats with respirators around their necks following him. The first—who Cindy only recognized out of costume due to their sheer height—was pulling off a pair of elbow-length rubber gloves. Next to them, though, was somebody new. 

 

He was wearing a simple tee and brown pants under his coat, and his hair was a striking, deep red. “Uhm,” He said, looking at the assembled group. 

 

“Hi, I’m Peter. These are my friends, Cindy, Abe, Sally, Betty, Charles, Ned, and MJ. We need some help.” The last part was said to the group as a whole. 

 

Mal leaned back precariously in her chair. “How long will it take?”

 

MJ shrugged. “An hour. A couple days. Depends on your commitment to the bit.” 

 

“It’ll help me avoid work?”

 

“Yes.” 

 

“I’m in.” 

 

 

Ross and Dan were immediately on board upon hearing they could put off work, and Bridgette was agreeing upon hearing the reasons they needed help. Lee and the second man—who introduced himself as Spencer—only agreed once they found out the specifics. 

 

“I’ve been waiting to do something like this.” Was all Lee had said. 

 

 

The last place they found themselves was a Target in Hell’s Kitchen. By this point, it was getting late in the evening, the sun dipping low on the horizon. The store was nearing closing hours, patrons slowly emptying out, except for the few camped out in the Starbucks waiting for their seasonal drink. Cindy, Abe, Charles, Cally, and Betty had all immediately drifted off to get in line. 

 

“Guys. The plan.” Ned reminded. 

 

Sally pointed at the blackboard menu. “Pumpkin spice.”

 

“It’s five-thirty.” 

 

She pointed again. “...Drink.”

 

Ned sighed and let himself be dragged away by MJ and Peter. The three of them followed Bucky (Natahsa was lost to the allure of the pumpkin spice) down the aisles to the near back of the store, where two men were standing in the middle of the candle aisle. The first was dressed in a button up and slacks, a tie loose around his neck and his sleeves rolled up to his elbows. He held a cane in his left hand, and a candle with his right. He was gesturing with both to the other man, who was wearing a too-large jacket over a sweater. 

 

“—April Showers is more Spring, though.” The man with the cane said. “And Pineapple Cilantro should burn.” He held up the candle for emphasis. 

 

“Oh, for sure.” He held up two candles for consideration. “Summer Storm and Evergreen Mist.”

 

He received a squint behind red-tinted glasses. “Yeah, you’d like those two.” 

 

“What’s that supposed to mean?”

 

“Nothing. Hello.” The man with the cane turned to the group. Bucky had already abandoned the three of them to make his way to Percy, stopping in front of him and adjusting the collar of his jacket. “Thief.” He said under his breath. Percy just smiled at him.

 

“...What are you guys doing?” Ned finally asked. 

 

Percy held up the two candles he was holding. “Candles.” The man next to him nodded. “Candles.” He repeated. 

 

Bucky looked over at him. “Matt, I’m guessing?” 

 

He received a nod. Then, “Hey, smell these candles.” He thrust out two directly into Bucky’s face. With the hand not resting on Percy’s waist, Bucky took one and smelled it, then handed it back to Matt and repeated with the other. “They’re nice.”

 

Matt hummed. “Yes. That’s what I thought.” 

 

Bucky gave him a strange look, but seemed more occupied with holding Percy, tucked up to his side, than anything. 

 

“Right. So, we need help.” Peter said. “We’ve already got everyone else on board.”

 

“You convinced my employees to skive off work, didn’t you.” Percy deadpanned. 

 

“It was really easy?” Peter said weakly. 

 

Percy sighed, and thunked his forehead into his boyfriend’s chest. 

 

 

They all meet back up at the Tower—including Matt, who, quite honestly, Peter knows nothing about. He just put his candles (Dried Lavender Oak and Ocean Air) back on the shelf and came with them when Percy invited him. “It’s either this or back to the office.” Was all Percy’d said. 

 

Matt was convinced. 

 

There was a small incident where they’d almost forgotten everyone in the Starbucks. Luckily, as they were leaving, Percy had asked why all of Peter’s friends were with Natasha drinking seasonal fall drinks, and they’d quickly doubled back and collected them. 

 

Now, they all sat in a loose circle in the living room. Percy and Bucky were intertwined on an armchair sharing a Pumpkin Spice Latte—well, Percy had no interest in caffeine, and simply ate the whipped cream on top, because Bucky apparently hates whipped cream. Tony, Pepper, and Rhodey were shoulder to shoulder on the loveseat, Peter on the floor leaning against Tony’s legs. MJ and Ned were next to him, and the rest of the AcDec team was scattered around them. Mrs. O’Leary had made an appearance, claiming the couch with Natasha and Matt. 

 

At one point, Rhodey, taking a sip of his frappuccino, wondered aloud, “Do you think we’re going too far?” 

 

Peter’s face was shadowed. “I want to see him regret.” 

 

Pepper leaned over Tony to whisper, “Flash called MJ a bitch today.” Rhodey just nodded. “Rescinded.” 

 

The success in planning was…varied.

 

“Wait, why do you even own that building?”

“I saw it and decided ‘oh, that’s creepy as hell’, and pushed buy.” 

“...Tony, you are the most dramatic person I’ve ever met.” 

“Thank you.”

 

 

“Okay, does anybody have any horrific and traumatic injuries we can use for this part?” 

Five hands went up.

“Fantastic. Thank you.”

 

 

“Wait, wait, why do you have a fake blood recipe memorized?”

“Ugh, God forbid women have hobbies, Abe.” 

“Sorry, Sally. I’ll take the sexist points on that.” 

“Hmmph.” 

 

 

“Are we concerned about him having a heart attack?”

“No.”

“Nope.”
“Not really.”

“That’s the ideal outcome.” 

“Cool.”

 

 

“I can get the actual Reaper here. Scythe and all.”

“I’ll keep that in mind.” 

 

 

“Okay, I checked his Live. He’s going to Ella Mackebon’s party—he thinks showing up on time is for dweebs, so he’ll get there at about 6:30.”

“Based on his home address and the average walking time…plus traffic…he’ll leave his house about 6:15. He won’t drive, the streets will be too busy.” A few clicks. “There are three possible routes he’ll take. We can block off this intersection here, and there’ll be a Youth Group activity scheduled in this park.” Another few clicks. “He’ll walk past this point at exactly 6:23.”

“...We should hang out more often, Dan.” 

“Thanks, Abe.”

 

 

It all went down on Halloween night. It was dark out, a new moon, and the streets were alight with young voices and quick feet. Flash Thompson, dressed and ready in a crisp suit, the exact color match to the one Elon Musk wore at his recent conference, walked down the sidewalk, scrolling past the first couple of stories from Ella’s party. There was a decent amount of people there, so he figured it was time for him to show up. 

 

As he counted the people visible in one of the photos, he glanced upwards at the sidewalk to make sure he didn’t miss the street. There were less and less trick-or-treaters out the further he got, until eventually, he was practically alone.

 

There was somebody standing on the fire escape of the building next to him. Flash jolted, taking an unsure step back as the Devil of Hell’s Kitchen emerged from the shadows. “You shouldn’t be here.”

Flash opened his mouth, then shut it. “I—what?”

 

“It’s dangerous here. Turn back.” 

 

“What? It’s—I’m—” Flash turned to the street sign, ready to point out he wasn’t even in Hell’s Kitchen, but when he looked at the sign, it was blank. He stared, then swiveled back. 

 

“Turn around.” The Man Without Fear intoned. Then, he was gone. 

 

Flash stared at the empty fire escape, then shook his head. It was fine—it was Halloween, people were everywhere. He’d lived in this city his whole life, he knew what places to avoid. This wasn’t even Daredevil’s territory, anyways. He didn’t know what he was talking about.

 

(“...Is it wrong to use revolutionary illusionary technology to fuck with a teenager?”

“Absolutely not, my company, my rules. Outta my way.”)

 

 

(“Holy shit, Mr. Murdock, how did you get Daredevil to do this?”

“...”

“Oh my God.”

“...”

“You’re having sex with Daredevil!” 

“What?”

 

“Don’t worry, Mr. Murdock. They thought I was dating Spider-Man for months.” 

“How is that the same?”

“...”

“...” 

“Holy shit—”

“Wait—”

“You’re, like, twelve!”

“You’re blind!”

 

“...Peter.”

“What, Percy?”

“...”

“Oh.”)

 

Flash spun on his heel, knuckles white on his phone, only to slam directly into somebody else. He staggered back, looking upwards at the looming figure. They stared directly forward, over his head, pale-clear eyes hollow, ringed with bruise-like shadows. They looked like all the color had been drained from their face, from the nigh translucent skin to the ash-blonde hair. The cold October wind snapped at bare arms and through a thin, ragged tee. It was freezing out, but they didn’t seem to notice. 

 

Slowly, they looked down at him. “You shouldn’t be out here alone.” They said with a frown. 

 

“I’m—I’m just on my way to a party.” Flash got out. 

 

They regarded him a moment more before looking upwards at the moonless sky. The movement bared their throat, displaying a wide, deep scar across the base of their neck. “Run, then.” They didn't take their eyes off the sky. “Don’t stay out here.”

 

Flash scrambled backwards.

 

(“Wow, that makeup look is good. You look like a corpse.” 

“I am not wearing makeup.”

“...Jesus.”)

 

(“Aren’t you cold?”

“I grew up in a place so far north that, as a child, we were legally required to carry a rifle to fend off polar bears. No, I am not cold.”

“...Hm.”)

 

Flash rushed to cross the street, his hands trembling as he reached the park. He turned a corner, ears and nose growing numb from the cold, mind racing, unable to get the Devil’s words out of his mind. 

 

Turn back. 

 

He glanced around, looking at street signs. None of them made sense. Some were empty, some had directions for streets he’d never even heard of, some of them didn’t even seem to be in English. A dog barked in the distance. 

 

Why didn’t he recognize any of the buildings? 

 

“You look lost.” 

 

Flash shrieked. 

 

The man who’d spoken, sitting on a bench by the park entrance, was looking up at him. “First time here?” 

 

No, Flash wanted to say. But, for some reason, he couldn’t. It didn’t feel right. More barking, from somewhere in the park behind them. 

 

The man just blinked. “Unfortunate.” Was all he said. The streetlamp above him fizzled on, then out, then on again, illuminating his face. His hair was pulled back, exposing the starburst of scars that resided on his temple and cheek, trailing down his neck. Flash tried not to stare. 

 

He failed. 

 

The man seemed to follow his gaze, his fingers—dark, the tips looked blackened, blue with cold and dark with rot— coming up to touch the side of his face. “Dangerous world out there.” Was all he said. 

 

Turn back, turn back, turn back.

 

How could he turn back if he had no idea which direction he came from?

 

Flash stared down the street, face tight. He went for his phone to try and pull up a map—Jesus, he’d lived in this city his entire life, how did he get so lost— but was faced with nothing but a black screen, no matter how many times he tried to wake it up. “Do you—” 

 

The man was gone. 

 

(“Jesus, Peter, did you have to yank Dan up into a tree?”

“Nah, it was cool. Don’t worry about it.”)

 

Another bark, this time close. A huge mastiff came tearing out of the bushes down the block, fur dark as the night and eyes red. Something dark and sticky coated its maw. It turned to stare at Flash, lips pulling back to reveal long, curved teeth.

 

A low growl reverberated down the street, hair-raising and unnatural. It dropped low, eyes never leaving Flash.

 

He ran. 

 

Flash abandoned all sense of calm, turned on his heel, and ran. 

 

It chased him down the street, tearing after him, massive paws thudding on the sidewalk loud enough to hurt his ears. His breaths came out in sharp pants, lungs burning. Why was there nobody here? It wasn’t that late—there should still be people out. Why wasn’t there? Where had they all gone? 

 

It was gaining on him. 

 

All the buildings were locked up. Every single one he ran past was closed, the lights off and curtains down. His chest started to ache, lungs burning.

 

(“Yes. Run. Let’s see how well that varsity basketball training you love to talk about helps you now.”

“Run faster. Go on.” 

“Yes. Yes.”)

 

The very first one he saw with the door cracked he lunged for, slamming the door shut behind him and leaning up against it. On the other side, heavy, fetid breath sounded, four paws and claws scraping across the concrete outside. Flash wasn’t sure how long he stayed there, pressed up against the door and trying to catch his breath. He could still hear it, the occasional snuffle and low growl when he moved. The dog stayed on the other side of the door, waiting. 

 

(“I’m buying your dog a pizza.”

“Go for it.”)

 

There had to be another exit, right?

 

Turn back, run, then, dangerous world out there—

 

As quietly as he could, Flash stepped away from the door and ventured further into the building. It looked to be some sort of office, or, had been—the furniture was covered in sheets and a thick layer of dust. The windows were dirty and some were shattered, jagged glass edges reflecting the flickering street lamps outside. 

 

“Hey?” Flash called out. There was a chance there was some kind of contractor or cleaner in here—someone he could talk to to find the fire escape or back entrance. The wood groaned under his feet as he walked further into the building, echoing throughout the building. 

 

He slipped, barely catching himself on a door frame, hitting his shoulder on the wall. “Shit,” He muttered, looking down. “Who the fuck spilled—” He cut off as one of the streetlights flickered on, illuminating the puddle under his feet. 

 

Crimson. Half dried and coagulated in places, seeped into the floorboards. 

 

Fuck. 

 

He was frozen, his own heartbeat like a drum in his ears. Then, he heard the footsteps. 

 

Heavy, loud, accompanied by a rasping, dragging noise and the creak of a door, coming from the other side of the building. Flash staggered back against the wall, pressing himself into a corner, then dropping down behind a piece of furniture. It got louder, each step in tune with his racing heart. Flash dove under a sheet-covered table, his cheek pressed to the old floorboards. He caught sight of a heavy pair of boots, heart leaping up into his throat. Another pair of shoes followed—limp, dragging. The first person was pulling the second—unconscious? Dead?— along, to Flash’s horror.

 

They passed the doorway, disappearing down the hall, and Flash squeezed his eyes shut. 

 

Everything halted, silent. 

 

“What’s this?” The voice was low, raspy. Then, a breathy laugh. “Oh.” 

 

He felt like throwing up. 

 

The yell was sudden. “Who’s here?” A beat. “I can see your footprints! Come out!” 

 

Flash stayed, immobile. 

 

A soft thud, something heavy being dropped. “Oh, don’t be like that.” That same voice cooed. “Come on out.” They started moving again, in the opposite direction— thank God—- up the stairs. Searching. 

 

After a minute, he crawled out from under the table, and peered around the corner. 

 

There was a body slumped against the wall. 

 

Flash stared, horror pumping through his veins. Black hair, loose and matted, and an outstretched hand. A pool of blood around the head, and a large, open wound on the side of the face. 

 

The wound pattern looked familiar.

 

Dangerous world out there.

 

No— no. That was stupid. Just a coincidence. There was no way this was the same person. Impossible. Christ, he needed to get out of this fucking building. Flash crept along the wall, ears straining for any sort of footsteps, when he heard the creaking above his head. Slowly, he looked up.

 

Somebody was standing on the floor right above him. And moving, towards the stairwell. There was nowhere for him to hide—Flash looked around, then made a break for the staircase, going down the stairs as quickly as he could without being heard. As he went down, the flight of stairs directly above him groaned and creaked, and he barely avoided being seen. He couldn’t even think straight, his blood roaring in his ears. The basement floor was concrete, quieter than the old floorboards on the ground and second level. Flash went down the empty, unpainted hall, checking over his shoulder every few steps.

 

That’s when he heard the groaning. 

 

There were cages. Metal bars ran from floor to ceiling, sectioning off the far wall. Somebody was curled up on the floor against the bars. A flash of pale hair and skin caught his eye, and he inched forwards. 

 

They were drawn in on themself, as if trying to conserve warmth, but it did little to hide how their neck was split open, ear to ear, blood staining ash-blonde hair and a thin shirt with bare arms. Empty, frozen eyes stared up at the tiny crack in the corner of the ceiling, where a sliver of the moonless sky could be seen. 

 

You shouldn’t be out here alone. Don’t stay out here.

 

Staring up at the empty sky. 

 

Flash clapped his hands over his mouth to keep him from screaming. Daredevil was right, he should have turned around, he should have gone home. 

 

Like a nightmare, following him, the floor began to creak again. The hooded man, heavy boots, dragging. Flash scrambled under the stairs, the only place that could cover him. He crouched low to the concrete, wedging himself as far in as he could.

 

The limp body of the man from the park was tossed into one of the cells, next to the blonde. Then, the man walked further down the hallway and flipped a switch, lights flickering to life and illuminating the hallway, revealing rows and rows of cells. He stopped at the nearest one to Flash, right in front of him. There were two people in it, Flash could now see. Slumped on opposite sides of the wall, curled up defensively against the cold, one with black hair and the other with brown. The hooded man slammed something sharp against the metal bars, the loud, jarring noise stirring the two. Then, he tossed something in the middle of the floor. It clattered against the concrete. 

 

A pair of bleary eyes looked up at him. 

 

“How much do you want to live?”

 

“What?” The more coherent of the two in the cell croaked. 

 

“You’re hungry, aren’t you?”

 

The silence was oppressive, a horrified look shining through the copious amounts of grime and blood on the person’s face. “You— no.” But there was something desperate in their eyes.

 

The man just shrugged and turned away, walking back up the stairs. 

 

Flash watched the two men in the cell stare at whatever had been dropped into the cell. Then, at the same time, they both lunged. The one with brown hair was clearly injured, a hand pressed to his side, movements sluggish and weighted and easily beat. The other man snatched the knife— it was a knife, long and serrated—from the floor. 

 

The brown haired one scrambled back on the floor as the other stood, swaying, fluorescent lighting catching on the blade. “Please—I—-” 

 

The other lunged, falling upon the other man and slamming his head into the concrete with a brutal thud. He raised the knife high and brought it down, again and again, through the screams and weak attempts to push him off. 

 

Four things would forever be ingrained into Flash’s mind.

 

One—the sound of sawing, overlapped by agonized sobs and pleads. 

 

Two—copious amounts of blood flowing freely towards a drain in the corner of the cell from a stump. 

 

Three—ripping, tearing, and chewing.

 

Four—the man, crouched over the body, holding a sawed off arm and blood running down his lips, dripping off his jaw. 

 

Everything was overtaken by a grating static, narrowed down to a pinprick. Flash staggered upwards, out from his hiding spot, overcome by the urge to get away. He couldn’t even think as he ran for the stairs, hearing those screams, again and again and again. 

 

A hand wrapped itself around the back of his neck. 

 

Flash screamed. 

 

“Hiya, Eugene.” Was breathed directly into his ear. “Thought you had a party to go to.” 

 

“Cindy?” He got out. “Jesus, get the fuck off me, you weirdo—” Her hand tightened, and he cut off. 

 

“You really need to learn your manners, Flash.” She tutted. 


“Cindy, let go—I—-I need to—”

 

“No, I don’t think so.” She said quietly. “Honestly, I’m a little surprised. Would’ve thought you’d enjoy some alone time. You’d do anything to get with me, after all.” 

 

“We’re alone because there’s a couple fucking corpses here, Cindy.”  

 

She hums. “Oh, that one’s still alive, actually.” She says, pointing at the man in the cell with the blade. He seems barely coherent, chest heaving, adrenaline fading. “He’s done well so far.” 

 

“He–you—” Flash can’t even speak. 

 

“He’s one of the fun ones.” She continued, hand sliding off his neck as she drifted towards the cell. “Violent.” 

 

Flash tries not to look. The scent of blood is overwhelming, on the floor, the knife, the man’s face, the cooling corpse next to him. 

 

“You did this.” He finally whispers. 

 

She winks at him over her shoulder. “A girl’s gotta have hobbies, you know.” 

 

He takes a step back. “You’re insane.” 

 

“Sanity is fickle.” She dismisses. “You know what isn’t?” Something gleams in her eyes. “Friends.” 

 

Flash whips around, where two people stand right behind him. The first—the hooded man from before— Abe, with Betty next to him. “Let’s go on a trip, Flash.” They each seize one of his arms and begin to drag him down the hall, concrete floors, walls, ceiling, no windows, Cindy trailing behind him. So he can’t run, he realizes. 

 

They take a turn and stop in front of another cell, this one wedged into a corner.

 

(Back in the first cell, one man covered in fake blood, clutching a prop knife, is hunched over another with a prosthetic arm ripped off. 

 

As soon as they're out of earshot, Percy muffles a laugh into his shoulder. Bucky grins up at him. “I love how good you are at pretending to be insane.” 

 

Percy, one knee on either side of his hips, leans down and kisses him. “I love how good you are at pretending to be in complete agony.” He returns. Bucky’s hand comes up to tangle in his hair, pulling him back down when he breaks the kiss. “You taste like corn syrup.” He murmurs against his lips. Percy laughs again.)

 

There’s a man in this one, one wrist cuffed to the metal bars. Flash can’t help but stare—he’s covered in scars, his skin burned and lumpy, pulling tight in some places and disgustingly loose in others. “Acid.” It’s Parker, crouched against the other side of the bars, poking at the half-conscious man. “He’s not much fun these days, though.” 

 

“There are plenty of people for you to test your stuff on, Peter.” Michelle says, leaning against the wall near him. “Yeah, I guess.” He sighs, stands. “Hi, Flash.”

 

“What the fuck is wrong with you people?” Flash screams. 

 

Betty makes a little noise from his left. “Well, you got me thinking. You’re right—my piece for the paper really was—how did you say it?” She snaps. “Right. It really was God-awful boring shit that I couldn’t pay people to read. I decided I needed something…better, to write about.” There’s something shining in her eyes. “Everyone knows that people love tragedies.” 

 

It takes a second for the implication to sink in. “You’re fucking crazy.” He snaps. “All of you.” 

 

He’s shaking. A sudden chill sweeps through the basement, slicing through his clothes like needles, straight into his flesh. 

 

Parker looks at him. “Well, I just figured, since I’m such a useless nobody whose life really isn’t going anywhere, I should at least try and contribute to the chemistry field and test out a few of my ideas before I kick it.”

 

Sally is giving him an off-kilter smile. “You really got me thinking when you informed me that wearing leather suits me—cowskin, and all. I really do like the look of leather, though, but then I realized that the same result can be achieved from…other materials.” She’s staring down at the man in the cell. She’s holding a scalpel. “Curing and tanning it isn’t that different, really.”

 

Something in his stomach rolls, crawling up his throat.

 

“And you were right about the fact that my speech impediment is so embarrassing that I shouldn’t subject people to my talking.” Charles says from the stairs. “I get a live audience to practice my speech therapy exercises, and, afterwards, well…they’re not really around to have to go through it more than once.” 

 

Abe is mindlessly playing with the strings of his hoodie. “When you said I’m a pathetic, weak bitch that can’t even do a push-up, it got me thinking. Moving these guys around has really built up my core strength.” 

 

“And since I’m an unlovable leach that belongs in my mother’s basement, I figured I could spend that time down there doing some planning. Turns out, impersonating somebody and convincing people to meet me places is very easy.” Ned volunteered from behind Charles. 

 

MJ pushes off the wall to stand up straight. “Your point about me being a bossy, stuck-up cunt who’s only joy in life is making other people miserable made me realize it’s more constructive to put that energy elsewhere. These ones do whatever I tell them to.” She muses with a smile, poking the man in the cell with the toe of her sneaker. “Like…sawing someone’s arm off and eating it because they’re just so hungry.” She doesn’t break eye contact with him. He wants to look away, desperately so, but can’t. 

 

Cindy shrugged. “And, really, it’s too easy. They clearly were asking for it.” She says, eyes fixed on Flash’s face. “If they don’t want us to treat them like this, they should really not flaunt themselves so much.” 

 

Flash staggers back. 

 

“All of you are sick.” He spits. “All of you.”

 

Parker frowns. “But, Flash, we just took your suggestions.” He says it so easily, taking a step closer to Flash. “Just because we’re pathetic and nobody wants us around, doesn’t mean we have to take it out on you.” He points out. “I mean, we didn’t involve you at all. You came to us.”

 

“That’s not what I fucking meant, and you know it.”

 

“Well, then,” MJ draws out. “What did you mean?”

 

He opens his mouth, closes it. 

 

They all exchange looks, amused, like this is some sort of game, like it’s funny. 

 

“Do you want us to stop doing this, Flash?” Charles asks. 

 

“Of fucking course I do, you psycho.” He snaps. “The hell kind of question is that?” 

 

Abe hums. “Well, I guess you’re right. It is getting a little boring.” Another moment of silence, another round of shared looks. Then, Abe hands Parker the knife he was holding and walks down the hall. Sally, Betty, and Charles follow him. There’s something light, eager in his voice. “We can do one last test! Number 18 can dissolve bone, yeah?” 

 

A wave of visible excitement ripples over them.

 

“Should do, yeah.” Parker calls back. He opens the cell the burned man sits in and leans over him, studying. 

 

The four come back dragging— Jesus, dragging bodies. The two Flash had already seen, talked to, he thought— and two more. The first, a Hispanic woman in a pencil skirt and blouse, stomach sticky with blood. The second, a red-haired man with a bullet hole between his eyes. 

 

(“Spencer, are you on board?” 

“Can I sleep through it?”

“Absolutely.” 

“Delightful. Sure.”)

 

They leave the four in an uncaring pile in the middle of the hallway. Then they make a second trip and bring back a man, hair matted down with blood, and a woman with a yellow sweater and blue lips. Then the man—fuck, his arm really is gone, sawed off right in front of Flash—from the first cell. 

 

The last one they bring is the one who did it, his mouth and chin still bathed in smeared blood. His hand, once clutching the blade, is slack, his eyes rolled back in his head. 

 

“Is he still alive?” Michelle asks, leaning over to get a look at him. 

 

“Yeah, just out.” 

 

She tuts, snatches Abe’s knife from Peter, strides over, and grabs a fistfull of hair, wrenching his hair back. Michelle slits his throat ear-to-ear in one clear motion, leaning back to avoid the spray of blood that follows. Flash stares, frozen. 

 

(“MJ, you want to be the one to kill me?”

“Swear not to get ‘blood’ on me?”

“Yeah, I can make it avoid you.”

“Sure thing, then.”)

 

Parker seems to have finished staring at the burned man in the last cell, uncuffing him with a key attached to his belt. 

 

“Please,” The man rasps. “Not again.” 

 

Parker just pats him on the side of the face. “Oh, don’t be a baby.” He admonishes, pulling him out of the cell with Ned’s help. Flash gets a closer look at his face, the mottled, deep tissue burns that look absolutely agonizing. 

 

Cindy stabs him. Unlike Michelle, she doesn’t bother to move out of the way, not even blinking as the warm spray hits her dead on. Instead, she just wipes her mouth with the back of her sleeve. The eight of them stand in a circle around the pile, clearly thinking. 

 

Flash, his heart thudding in his ears, skirts around them for the exit. He’s almost made it to the stairs when Sally’s voice stops him cold. “Do you think they’ll believe you?” 

 

He freezes, caught. “What?” 

 

“That we did this.” Abe continues for her. “I mean, us? Eight honor roll students, not a single detention between us? All our teachers love us, we have more community service hours than any other school organization, half of us are on the student council…” 

 

Michelle smiles at him. It’s an ugly smile. “And, really, Eugene—we have Ivy Leagues to get into, perfect records to keep, recommendation letters to get. Did you really think we were going to let you blab?”

 

His heart leaps up into his throat. “What—I—I won’t, I swear—”

 

He blinks, and Parker is right there, reaching out for him, and all the others turn to smile at him, and—

 

Everything goes black. 

 

 


 

 

Giving out candy at Stark Tower is fun. It’s not that late in the night, really—everyone just washed off their makeup and the copious amounts of fake blood staining them all, and changed into their real costumes for the night. 

 

Lee and Dan highfive, and Mal compliments them both on how “extraordinarily unnerving” they were. 

 

“My dream job as a kid was to haunt people.” Lee says, scraping the scar wax off the very real scar across her neck, Dan doing the same with the ones on the side of his face. 

 

(Peter had been concerned, at first, speaking to the two of them and Bucky. 

 

“Are you sure this is alright? I mean, this stuff seems pretty traumatic…”

 

It was Lee, surprisingly, who spoke up. “Yes. I still try not to wear stuff without a high collar. But…doing something fun with it seems nice.” 

 

Bucky and Dan had nodded, and Peter had smiled.)

 

They all met back up at the tower—Peter, MJ, and Ned had all had the separate but identical thought of dressing as Rosalind Franklin, Cindy, Sally, and Charles were the Wonder Pets, Abe was Phineas and Betty was Ferb. 

 

Tony, continuing the theme from last year, was Pepper. She was Rhodey, and Rhodey was him. Natasha was dressed as Hawkeye, and Matt was an avocado. Percy and Bucky showed up dressed as Morticia and Gomez Addams—Bucky in an immaculately tailored suit with a sword by his side, and Percy in a high-necked black shirt and long black skirt, regrettably reporting that he didn’t have the cleavage for the dress. 

 

Abe had to be resuscitated in the corner. 

 

Strange showed up half an hour in. “I didn’t master the Mystic Arts to portal a shithead teenager face-first onto his bed.” 

 

Tony had grinned at him. “You’re a willing accomplice.” Was all he said. 

 

Strange sighed, but didn’t argue. He was, to Peter’s amazement, wearing a cheesy wizard hat. 

 

Wade Wilson also made an appearance. Betty scrambled towards him, peppering him with questions and taking notes on his every word. Once she released him, he spoke with Percy and Bucky for a few moments before taking his leave. “I’ve got a thing.” Was all he said.

 

“Is he going to kill somebody?” Rhodey asked as he entered the elevator. 

 

“Nah. He binges all the Lab Rats Halloween episodes every year with his favorite hot dog vendor.” 

 

“Ah.”

“Thanks for pretending to be a victim to my extreme laboratory malpractice!” Peter called at his retreating back. Wade gave him a thumbs up as the elevator doors shut. 

 

Hordes of kids of all ages came to the tower, seeking out the king sizes Tony bought by the case. Peter and his friends took great joy in handing them out—MJ dumped an entire box of Hershey’s on a girl who recognized their costumes. Matt took his leave to go back to his firm, where Foggy and Karen had already begun to hand out candy. Every time Peter looked back at Bucky and Percy, who were sitting right on the receptionist's desk in the lobby, a few yards away from the front door, Percy was holding another rose stem, the head cut off and laying at his feet. Peter wasn’t sure how Bucky managed it, but he respected the commitment to the costume. 

 

Rhodey and Pepper had, very subtly, made their excuses to go talk to whatever random supervising adult they could find, surreptitiously nudging Tony towards Stephen whenever they had the chance. Natasha caught on halfway through the night, a devilish smirk appearing on her face as she joined in. At one point, she directed a young girl dressed as Bruce Banner to Tony, who immediately crouched down and listened to all her questions with rapt attention. 

 

It was Pepper who got the photo of the fond look on Stephen’s face as Tony told her about the cool stuff Bruce did in the labs here.  It was immediately circulated to everybody, excluding Tony and Stephen, of course. 

 

Once the steady stream of trick-or-treaters fizzled out, the SWORD members left. Peter and his friends ended up taking over the living room and fought over the television remote in a manner reminiscent of a swarm of angry bees with peanut allergies and asthma. 

 

MJ won, obviously. 

 

Also obviously—to Bucky, at least—she caved to Peter’s pleas to watch ParaNorman, furiously ignoring Bucky’s cocked brow. “Go kiss your boyfriend.” She snapped under her breath as she passed by on her way to the kitchen. 

 

“You know what? I think I will. Excuse me.” He stood up, ignoring her horrified look, and walked right over to where Percy was speaking with Tony, draping himself over his back, hands settling over his stomach. “Cara mia.” 

 

Percy leaned back into him. “Mon cher,” He returned. 

 

Bucky pressed his lips to the side of his neck, and, in one smooth motion, he bent over to secure an behind Percy’s knees, and stood, lifting Percy with him. 

 

“Night, Tony.” Was all he said, leaving an absolutely stunned billionaire behind. Stephen, too, looked astonished. “Is that normal?”

 

Tony dropped his head into his hands. “For them? Absolutely.” He looked up at the sorcerer. “You know, when they first got back, both their faces were covered in fake blood.” 

 

Stephen’s brows just about met his hairline. 

 

 

In the living room, Cindy was staring intently at the floor. “I think I just had a sexuality crisis.” 

 

“Cindy, love, you’re already bisexual.” 

 

“I know,” She whispered. “That’s the strange part.” 

 

Peter and MJ shared a look, and she slowly shook her head and simply turned on the movie. “How long until they’ll be normal again?” Peter asked quietly—oh, he was right next to her, okay. MJ shrugged, forcing her eyes forwards to the screen. “Fifteen minutes?” 

 

He huffed out a laugh and she could feel it on her skin. “Probably longer.” 

 

“Well, maybe you need to get your weird, gay, older brother figures under control.” 

 

Peter snorted, reaching up and grabbing a blanket off the back of the couch. “Fat chance,” He said as he unfolded it. “Bucky insists that anything that keeps him more than five feet away from Percy is homophobic, and the only person Percy listens to, other than Bucky, is his mother, and Sally Jackson’s time is far too valuable for such a thing.” He tossed the blanket over his legs, curled up to his chest. “Besides, they’re so mutually obsessed with each other that they probably don’t even notice other people are in the room in the first place. It’s a little romantic, in a strange way.” 

 

“Borderline obsession combined with an unflinching willingness to commit crimes at the drop of a hat for the other?” MJ sighed, looking upwards. “Yeah, a little.” 

 

He grinned and held out the other corner of the blanket to her. “I know, right?” 

 

Suddenly, MJ was tossed back to earlier that week, the rare flash of anger on Peter’s face when Flash was being a dick to her. 

“But sometimes…I really feel like making him regret being such an ass.”, the efficiency with which he’d planned everything. The way he was smiling at her. 

 

Her mouth went dry.

 

She stared at him for a moment too long—his stupid, fluffy hair, the hoodie he was drowning in that she was positive might’ve belonged to Tony, his freckles and his big, brown eyes—

 

“Yeah.” She said lamely, taking the blanket, spreading it over her lap. 

 

He smiled at her once more, and they lapsed into silence. 

 

They stayed like that the rest of the night. 

 

 

 

Meanwhile, a floor above, Percy was curled up against Bucky’s chest, head resting on his collarbone. Bucky was running a hand through his hair, twisting fingers through the subtle curls that had emerged as he had let it grow out. 

 

“Tony’s texting.” 

 

Percy tilted his face up. “Mmh?” 

 

“The urchins all sequestered themselves in the living room, and Pepper—superior being that she is—dragged the rest of them to Tony’s apartment. You know, to give the kids some space.” 

 

“Mm, I’m sure.” Percy drawled. 

 

“It gets better. Rhodey had a work emergency—you know how the Air Force is on Halloween at ten at night—and left. Then Pepper, in a shocking turn of events, needed Natasha’s help and they both had to leave.” 

 

He could feel how Percy’s shoulders shook against him. “Tony and Stephen left alone?” 

 

“Naturally.” 

 

“Gods, I love Pepper.”

 

“Don’t we all?” 

 

Percy made a small noise of agreement before shifting, drawing the blanket—that same crocheted one he’d draped over Bucky, all that time ago, when he was still a stranger in the Tower, fresh out of his first BARF session—high over the two of them. 

 

Bucky stares down at it, and he remembers a reserved, curt Commander who’d been a sole judgment call against killing him, looming like a shadow, always a step behind Tony. The man who could have been his executioner, who’d sat him down and stared him down into eating triangle-cut sandwiches and taking a nap. 

 

Sometimes, Bucky feels so incredibly in love he feels like he’ll drown in it. He’s laying there, squished up on his boyfriend’s couch, in his apartment that’s not really just his anymore, because that’s Bucky’s coat on the rack, that’s his book on the table, half the drawers are his, and though there’s only one indent in the mattress, its wide enough for two, because even in his sleep, Bucky can’t stop reaching out for Percy. 

 

Percy’s head fits right under his chin, his legs right with Bucky’s, his breathing right with his heart. It’s like there's a space; an empty, dulled cavern that's been waiting to be filled for eighty long years. An aching, gasping desert that’s finally been graced with rain, enough to turn the sand into mud, the flood out the dunes, to feed the cacti until they can reach the clouds, but it’s been starved for so long it doesn’t know what to do with itself. 

 

His rainfall, his beautiful storm. 

 

“You know I love you, right?” 

 

Percy’s head rests right over his heart. “How can I not?” Is all he says. 

 

“Just making sure.” 

 

Calloused hands—on the palms from weapons, on the tips of the fingers from music—come up to his face. “You know your pupils dilate when you see somebody you love?” His thumb brushed under his eyes. “It’s how I tell you’re looking at me. Usually, I have to guess with other people. Not you.” Lips brush against his. “Never you.” 

 

His phone buzzes a few more times—probably Tony having a gay stroke, or something—but Bucky ignores it in favor of kissing Percy again. “Love you.” He repeats. Then, “Querida,” He adds. 

 

Percy snorts. “Mon amour.” He returns. 

 


 

Flash wakes up in his Halloween costume, face-down on his bed. 

 

When he looks outside, the sun is slowly beginning to reach upwards over the city. There's a dozen texts messages and missed calls, all from people he’d told he was going to the party. 

 

He sits up in bed, scrolls through them with a frown. What the hell had happened—

 

Oh, God.

 


 

Flash wouldn’t look any of them in the eyes for the next week. 

 

He didn’t even speak to them for two, and certainly said nothing against them for weeks after that.

 

It just might have been the most peaceful period the AcDec team had ever had.

Notes:

*shows up two months late* hi

here's 30 pages of bullying a transphobe/homophobe/creep

the AcDec kids coming to the wildest fucking conclusions just for the drama of it all is my roman empire

peter: i need you to pretend to be the murdered victims of my friends and i
the entire SWORD team: cool

bucky when percy pretends to go completely feral and literally chomp his arm off: i am looking RESPECTFULLY

percy, calling wade: you want to traumatize someone?
wade: getting a plane ticket as we speak

percy bucky as morticia and gomez is healing tbh

tony: ok i need you to teleport this teenager who passed out from fear face-first into his comforter
strange, a simp: yeah ok

happy halloween! be gay do crime!

plumbing baby. goodbye.

Chapter 41: christmas 3: theyre doing WHAT underneath the christmas tree?

Summary:

i have no explanation tbh

Notes:

(See the end of the chapter for notes.)

Chapter Text

The kettle whistled softly, spurts of steam leaking out as Bucky picked it up. He poured it over the bag and settled the lid of his mug over top of it, leaving it to steep. Leaning against the counter, Bucky exhaled, watching the twinkling lights wrapped around the fireplace. He was feeling restless, a little cooped up, which was strange, considering the sheer size of the Tower. 

 

A part of him wanted to go out on a run, but a glance at how heavily it was snowing swiftly changed his mind—he could certainly stand the temperature, but, no matter what he did, the cold still seeped through his skin and settled in his bones, leaving a bitter taste in his mouth and painful whispers at the forefront of his mind. Instead, he wrapped one of the throw blankets around himself and curled up on the couch with the book he had gotten recommended to him by Vision. He wasn’t that far in, yet, but he’d been enjoying it so far. Both of them had been trying to expand their literary horizons, currently delving into a list of horror and fantasy books they’d collected. It was different from what he usually read, but in a good way. 

 

Bucky flipped a page, the sound of the pad of his finger rasping against the paper oddly loud in the deserted common room. Tony was out on a conference in Tokyo and the Parkers were across the city, hunkered down against the storm. Vision, at the encouragement of Tony, had begun to make progress on his bucket list, and was somewhere in Dubai. Natasha…well, Natasha was doing something. Bucky had no idea what, and since she hadn’t shared, he hadn’t tried to find out. 

 

SWORD had gotten a call from the WSC and had been sent out at the last minute, but, after discussing it, had decided to leave some of the team in New York, in case of the repeat of…whatever happened last year. Percy had taken Lee, Mal, and Ross, and left Dan, Spencer, Bridgette and Bucky to man the Hub, after much debate. Bucky wasn’t too worried about it—they were just there to escort a prisoner to trial, and the only reason the SWORD team had been deemed necessary was because very few others had clearance to know about the trial in the first place. Low risk, low stakes, and it would be over soon enough. 

 

It did, however, result in him being alone in the tower for the last couple of days, which…well, Bucky liked solitude, that much was true, but he did miss everyone. He’s not ashamed to admit that mostly meant Percy. He absolutely did miss Tony’s company and talking to Peter, watching movies with Natasha and reading with Vision. The absent half of the SWORD team, too—Ross was funny in a crass way that reminded him of some of the Howling Commandos, Mal was sweet and genuine, Dan was easy going and friendly, and Lee…well, Lee was Lee, and Bucky meant that in a very positive way. He missed them all, but not like he ached for for Percy’s company, his warmth. Most of all, he missed waking up next to him.

 

Bucky always woke up first—at six in the morning, on the dot. And, for thirty minutes, he would do nothing but lay there, wrapped around his boyfriend, who, no matter how or where they fell asleep, always managed to find a way to cozy up to him during the night. Then, Bucky would tear himself away from their warm bed, go on a run with Mrs. O’Leary, and return and shower. The running water would always wake Percy, which Bucky still thought was hilarious, and the demigod would be slightly upright with a scrunched face and bleary eyes when Bucky exited the bathroom. 

 

A single brush of Percy’s fingers instantly dried his hair, and, every time, Bucky would duck down and press a kiss to the crown of his head. And, usually, Percy would grab him and yank him back into bed, reminding Bucky of just how strong his boyfriend was, despite his leaner stature. Bucky never resisted it, falling onto the mattress, or onto Percy directly, with a soft laugh. On a good day, they’d have what seemed like forever to bask in each other's presence. Percy, still soft with sleep and surprisingly clingy, would bury his nose in Bucky’s collar, breathing him in, breath brushing over his skin. Bucky would settle his arms around him, metal and bone uniting to hold Percy, his thumb brushing the nape of his neck. Usually, Percy would fall asleep again like that, enveloped by Bucky, and he would stay perfectly still like that, giving his boyfriend every precious second of rest he could get. 

Everything felt right, like that, their soft mattress and thick blankets, warmed to the core by his space heater of a boyfriend. 

 

Even when gone, Percy made sure to call Bucky at some point during the day, late in the evening when he had hours to talk, if they were lucky, or a quick five minutes in between guard shifts, if they weren’t. Though Bucky loved to hear his voice, it would never be as good as holding him, as waking up next to him. 

 

He sighed and flipped another page. There was an upside to this, though—Peter, Tony, Vision, Natasha, and the SWORD team were usually very distracting (so was Percy, honestly, but in a different and entirely welcome way), and, with their absence, he was making significant progress on his reading list. 

 

The moment something in the air felt different, Bucky snapped to attention. Something cold had drafted in, like a window was open in the middle of the common room, ushering in wind and snow. He stood, backing away from the spot, eyes narrowed. A loud crack sounded, and he pulled out a knife. 

 

There was somebody standing on the coffee table. 

 

Long, white hair was braided with scarlet ribbon, trailing down their back and to their hips. They were dressed for winter, in numerous, thick layers, a dusting of snow still on their shoulders and hood. Long, pointed ears stuck out from the sides of their head, and when they turned to face him, he could see their eyelashes and brows, too, were white.

 

They hopped off the table, boots hitting the carpet and getting snow on the floor. “Hey!” They said excitedly. “Nice to finally meet you!” 

 

Bucky didn’t lower his knife. “What do you want?” 

 

His hostile attitude made them droop slightly. “I’m not here for anything bad, promise.” They brushed off their coat. “I’m actually here to help you out! You did me a big favor last year when you took Klaus down—he was a real douche to us magic users, and it really took the jingle outta my bell, you know? Things are way better now that Nick’s back, and I’ve been waiting forever to thank you, but, like, your world is so weird, I couldn’t get the spell to work until you guys reached a certain point in the year.” They looked out to the snowstorm visible through the window. “Pretty. Maybe the weather is why? Strange. Real strange.” They turned back to him. “My name’s Tinsel, by the way.”

 

Now that he could see them properly, he was struck with how similar they looked to the villagers they’d met last December, the blinding white hair and rosy cheeks. 

 

His stance didn’t waver. “Excuse me?” Is all he said. 

 

Tinsel ( Jesus Christ) bounced up on the balls of their feet. “I’ve been hanging out in this world for a couple of days, and, man, you’re having a bit of a rough time, huh? I mean, I read about the whole Winter Soldier thing you went through, and everything with the Avengers fighting and separating, and the brainwashing and the trial where that guy tried to kill you, and then you got kidnapped and all that, and then I was around here while I was catching up, and you’ve been, like, totally alone!” Tinsel rambled. “You did me, all of us, really, such a huge favor, and so I’m going to pay you back!” 

 

Bucky was stunned silent. He…well, he wouldn’t say he’s had a rougher time of it recently compared to the last eighty years. True, so much has been awful, but he’s finally free of the trigger words, of the Soldier. He has a home, he has people who care about him, and he finally feels like he can atone. But, laid all out like that…

 

He frowns, and Tinsel barrels on. 

 

“Being alone sucks! I can’t imagine having to go through that, and then just being by myself!” 

 

Bucky was beginning to think there may have been a misunderstanding, here. Sure, he’d been alone the last few days, but that was absolutely not an accurate representation of his life—everyone just happened to be out at the same time. Hell, Bridgette, Dan, and Spencer were still in New York, they just hadn’t met up in person in the past few days while Bucky was apparently being stalked by a nosy magician named Tinsel. 

 

He opened his mouth to speak, but they continued on. “So, don’t worry! I’ve got your back! This’ll fix things up, don’t you worry!” 

 

Instant alarm bells. 

 

“What are you going to do?” Bucky asked warily, his fingers tightening around the handle of the blade. 

 

“Christmas magic, of course!” Tinsel enthuses. “You’re not going to be alone this Christmas, not after everything you’ve done for us! You, mister, are going to find love, and I’m going to help you!” 

 

Never before has a statement left Bucky so completely speechless. “I—what? No—” Bucky gets out. Tinsel is already speaking over him. “It’ll be great! You’ll see! Oh, this’ll be so cute!” They enthused. To Bucky’s horror, they were waving their hands around in a way reminiscent of Dr. Strange, and a glowing, plasma-like substance was emitting from their fingertips. Cold wind began to whip around the common room, and snowflakes drifted down onto the carpet beneath their feet. “It’ll feel natural, promise! Once you all snap out of it, you’ll realize just how perfect the two of you would be!” 

 

“What are you talking about?” Bucky demanded, holding up an arm to shield himself from the sudden onslaught of icy wind. 

 

“Well, I’m not having you fall in love with a stranger, of course! All your friends will be there—your subconscious just has to make a choice!” Tinsel chirped. The snow fell heavier, the light spilling from their hands increasing in intensity. 

 

No, no, no, there was clearly some sort of confusion here, some sort of mix-up, but when he tried to explain, he found himself unable to speak, overtaken by a sudden, final burst of cold wind, ice spiraling up from the floor in shining fractals, crawling up his legs and to his torso, spreading outwards to his arms and crawling up his neck, finally encasing his head. Through the crackling ice creeping over his ears, he heard Tinsel’s merry voice. “Have fun! It’ll be great, don’t worry!” He could feel himself begin to be pulled, not in any direction, but a distinct tugging sensation in his gut, pulling somewhere inwards and outwards. 

 

The last thing he heard was Tinsel. “Just follow your heart!” They called out. 

 

Then, everything went dark. 






Westblooms was…different. Bucky didn’t know how else to describe it as he unlocked his front door. Maybe he’d spent so long away from anything like it that he’d become biased. Everyone was just looking at him, all the time. He stuck out, he knew, simply by being an unfamiliar face in a town this small, but it still bothered him, made the hair on the back of his neck stand up. He wasn’t sure if he regretted moving here, per se, fresh start, and all, but it was rough.

 

The town didn’t have much to offer, save for the research center near the outskirts and a small ecological preserve—he’d gotten an earful about both on the cab ride from the airport. 

 

He shouldered the door open, shutting it behind him and dropping his bag on the entryway floor, toeing off his boots. On his way to his room, he checked his phone, clicking on the only text he’d gotten—from his new doctor, confirming their appointment for tomorrow. He replied, then left his phone on the counter to shower. When he was out, he had another—a sole thumbs up emoji. 

 

Bucky went to bed, like usual, and tried to sleep, which resulted in little success, also like usual. He tossed and turned most of the night, chilled to the bone no matter how many blankets he piled atop himself. He caught a few hours, maybe, but it left him feeling no better. Eventually, a bit after the beginning of sunrise, he gave in, and got up. He got dressed, running through the motions like he did every day. He ended up going on a run around the neighborhood, passing houses that, though they all looked different, held the same small town charm that was beginning to grate on his nerves. 

 

Even after completing the loop around the neighborhood a few times, he still felt restless, uneasy—though that wasn’t really unusual for him. He forced himself to clean up, then sit down and read the book that’d been laying on his coffee table for the last few weeks. The librarian had told him, with a sympathetic look in her eyes that God, he was really, really starting to hate, he could keep it for as much as he needed to finish it, when he told her how busy he was and asked about their renewal policy. 

 

His appointment wasn’t in a hospital—rather, a research center near the edge of town. The security was tight, and he ended up being escorted in by a man who’s name tag read Happy, but his face read anything but. 

 

Dr. Anthony Stark was waiting for him, a phone resting in between his shoulder and ear, talking as he worked on something on a tablet. Happy rapped his knuckles on the doorframe, and Dr. Stark nodded, saying a quick goodbye and hanging up. He grinned at the two of them. “Good to meet you, Barnes. Happy been treating you right?”

 

Bucky looked to the side, then back at Dr. Stark. “Yes.” Is all he said. 

 

Dr. Stark ushered him in and sat him on an exam table in the middle of the room. “How’s it been treating you?” He asked as he moved to the computer in the corner. 

 

“It’s fine.” 

 

“Problems moving? Any joints not bending or rotating like they should?” 

 

“No.”

 

“Any problems with the sensitivity? Grip strength too loose or strong? Tactile sense off at all?”

 

“No.” 

 

“Any unexpected pain?” 

 

Unexpected. “No.” 

 

Dr. Stark looked over at him, a brow raised. “Lord, you sure are a talker.” He said dryly. “It does hurt, though, yeah?” 

 

“Yes.” 

 

Dr. Stark rolled his eyes. Then, he finished typing and walked over to Bucky. “Well, not much I can do about that one, I’m afraid. However, what I can do for you is make sure everything is working right, and maybe toss in a flamethrower somewhere.” 

 

Bucky tried to stifle the soft snort. Judging by Dr. Stark’s grin, he didn’t do a very good job. “The thought is appreciated, but I believe my job is to do the opposite.” 

 

The other man pulled up his chair and laid out a set of tools across his knee. “Firefighting, yeah? Very heroic. Continue doing the public service and strip for me. Need to get into your shoulder socket.” 

 

Bucky took off his jacket, along with the sweater and shirt he was wearing underneath. “I’m pretty sure doctors are supposed to be more professional.” He commented as Dr. Stark began to unscrew a nearly invisible opening on his upper arm. 

 

“Ph.D., not M.D., unfortunately for you.” Dr. Stark dismissed. “If you want a decent bedside manner, try Strange.” Bucky blinked. “Neurosurgeon. My consultant on all this.” Dr. Stark elaborated, waving his hand at Bucky’s arm. “Best in the business, little prickly, bit of a self-righteous douche. Actually, maybe don’t go to him.” 

 

He tugged lightly at something in the wiring, and Bucky clenched his jaw. Dr. Stark looked up at him. “That hurt?”

 

“Yes.” Bucky said through gritted teeth. 

 

“Oops.” 

 

Bucky thinks he could have done worse than Dr. Stark. 



Shuri calls him when he gets home. “How was it?” She demands.

 

“Hello to you, too.” 

 

“Piss off, Barnes. How was it?”

 

He shrugs, though she can’t see it. “Stark is weird.” 

 

Bucky can practically picture the little divot on her brow that seems to only appear when she’s talking to him. “Barnes.” 

 

He sighs. “What do you want to hear, Shuri? It’s been a year and I still get pain so bad I can’t breathe in a limb that doesn’t exist? That I can’t stop staring at my mutilated shoulder every time I get the arm removed? It fucking sucks, Shuri. What else is there to say?” 

 

A moment. “It’s only been eight months. Phantom pain is common. I don’t get it, not like you do, but, Barnes…it’ll get better.” She says, uncharacteristically soft. Bucky runs his hand over his face. “I know, I know. I’m sorry for snapping.”

 

“Forgiven.” She brushes off. “You’ll be back on your feet in no time. Stark’s brilliant. You saw what he did with Rhodes.” 

 

Colonel Rhodes’s accident had been horrific. Bucky remembers hearing when his plane went down, the shock that had coursed through him. He’d met the man only a few times, but had liked him, his good nature and strength. The man had lost feeling in both his legs, and, a year later, was back with the Air Force, metal braces around his legs that had given him more grace and balance than their most agile recruits. 

 

“I still can’t believe they’re having him help me.” Bucky admitted after a moment. 

 

Shuri scoffs over the line. “Barnes, after what you did, I’m pretty sure you could demand a solid gold arm, and they’d give it to you.” She pauses. “They’re still talking about you, you know. Calling you a hero.” 

 

Bucky can’t help the way his mouth twitches downwards. “Tell them to knock it off.” It’s not that he…regrets what he did, but he hates how everyone seemed to glorify it. Though lives were saved, he still lost his arm. He may not be grieving for people like he would have been if he hadn’t intervened, but he’s still grieving. 

 

“I’ll punch Rodgers, how’s that?” 

 

That makes him smile, just a little. “Sounds good.” Steve, most of all, had been like that. A hero, Bucky was, he said. Didn’t seem to get how angry Bucky was about it all, how hard it had hit him, how much he had lost, regardless of who he’d saved. “How’s your brother?”

 

Shuri groans, and Bucky sits down on his couch, knowing he’s in for the long haul. 




He goes to the facility to see Dr. Stark, who has now demanded he call him Tony, twice a week. On Tuesdays, he spends the whole session with the man, who pokes and prods at his arm and once made him draw with crayons to get a feeling of the sensitivity of the new model. The following week, he’d almost decked the engineer when he saw the collection of crayon scribbles on the laboratory sample refrigerator the next room over. On Fridays, he went in for a short check-up—Stark seemed to function as his prosthetist, physical and occupational therapist, and mad scientist—and then spent an hour with the psychologist that worked at the research center. She was nice enough. Asked him a lot of questions, about his arm, about the incident itself, about how he felt now, about anxiety (it sucked) and sexual dysfunction (he’s fine) body dysmorphia (he’s fine) and his sleeping habits (they were shit) and his PTSD (also shit). In summary, it was exhausting. 

 

Two months in, enough data had been collected and enough tests had been run, and Bucky, who had gone half out of his mind with restlessness, had joined the local fire department. The chief had come to see Tony during one of their sessions personally, and, after watching Bucky run through all the mobility and strength tests, had only asked one question. “Do you think he can do it?”

 

Tony had rolled his eyes so hard it looked like it hurt. “That is a Targeted Muscle Reinnervation prosthetic made with nanotechnology. It has multi-positional joints and has a melting point higher than any flame can get, in addition to being so well insulated he could stick his hand in a grease fire and grab onto an ice cube and not melt it ten seconds later. Personally, Chief, not hiring him would be a stupid choice.” 

 

The Chief had looked stunned. Once he took in Tony’s words, he had just nodded, and Bucky began training the next week. 

 

It helped. He worked long hours and was busy, and when he went home he was sometimes tired enough to actually sleep. He still woke up screaming some days, and tried to scratch or soothe an arm that was really just a hunk of metal, but it wasn’t as bad. His coworkers were nice, and, besides Cody always asking him to punch open cans for him with his ‘cyborg strength’, they were normal, treated him like any other person. They didn’t thank him for his service and everything he did and insist he was a hero and had done something amazing because they didn’t know, and it was like he could breathe for the first time. 



Bucky leaned back as Tony argued on the phone. Stephen Strange, again, who Bucky had become acquainted with the two times he had dropped in to speak to Bucky about the nerve connections of his arm. Him and Tony seemed to be locked in a constant battle of snark and wits, and Bucky was tempted to either lock them in a closet or tell them to just fuck already, for Christ’s sake. It was in the middle of one the two of them arguing (flirting) that Bucky had met Peter, Tony’s son, who, despite the uncanny resemblance, had been adopted by the man two years prior. The kid was sweet and smart as a whip, bouncing into Tony’s lab with a bright smile to hand over his AP Chemistry test. 

 

Once Strange and Tony were done, Tony had given his kid a hug and pinned his test up next to Bucky’s fucking crayon drawing that Tony refused to take down. 

 

“He’s a nice kid.” Bucky had complimented once Peter had left. 

 

Tony smiled, and it was unlike any other Bucky had seen on him. “Wish I could take credit for it.” He looked up at the paper on the fridge. “Kid deserves the world.” 

 

Bucky, though he didn’t say anything, found himself agreeing. 

 

Peter dropped in occasionally, usually plopping himself down on the floor and launching into long spiels about his day at school. From what Bucky had gathered, he has a best friend named Ned, a not-girlfriend named MJ, (“They have huge crushes on eachother, it’s exhausting,” Tony had commented. Bucky, who had just watched him argue with Strange with their lips about three inches apart, had just raised an eyebrow) and a group of friends on his Academic Decathlon team. 

 

“Menaces, all of them.” Tony had said. “Smart, but horrible little creatures.” 

 

“Hey, you said you forgave Charles and Cindy for the whole fire extinguisher thing.” Peter interjected. 

 

Tony had just sighed. 

 

There was also a guy named Flash. Bucky had said that was a stupid name, and Peter had nodded in agreement so fast Bucky was afraid he’d hurt his neck. “Yeah, he’s super mean to, like, everyone. He used to say all this nasty stuff to me—he’s transphobic—but one of my teachers apparently, like, put the fear of God into him, or something, and he mostly leaves me alone now.” 

 

“Good teacher.” Bucky had said. 

 

Peter nodded again. “He’s great! He might be in the mafia, or something—Cindy thinks the Bratva because she heard him speaking Russian, once, but she doesn’t speak Russian, so it really could have been anything—but he gives us snacks, so, it’s like, whatever.” 

 

Bucky didn’t even ask why one of his friends thought the Bratva would be in Westblooms, Vermont, of all places. Their police force was, like, fifteen people, including the records and administrative assistants. 





Time passed in a blur, and Bucky finished training. He worked strange shifts, but his sleep schedule was messed up anyways, so he didn’t really mind, but it did result in him going to get coffee at three in the afternoon. It was cold out, which he always hated, and he crammed his hands deeper into his pockets. Westblooms was, apparently, a very festive town—it wasn’t even December yet, and every single streetlight had been wrapped with tinsel and adorned with red ribbon. A twenty-foot tree had been put up in the park, and Bucky watched a group of volunteers string lights around it as he walked down the sidewalk. 

 

The collision was sudden and rough. Bucky stayed unmoved and upright, which couldn’t be said for the other person. His arm shot out and, in one smooth motion, he grabbed ahold of them and kept them from hitting the ground. 

 

It took him a second to recognize the cane clutched against their chest and the leash in their hand. A pair of sunglasses had tipped off their face, residing on the pavement next to the paws of an extremely large, black mastiff. He looked down at them, stunned. 

 

Holy shit. 

 

He was pretty. The most breathtaking green eyes he’d ever seen were framed by thick, long lashes, and freckles splattered across the bridge of his nose and his high cheekbones. Black hair, a thick red sweater, and a soft, friendly mouth. 

 

Jesus. 

 

He swallowed, dry. “I’m so sorry.” 

 

The man blinked, parted pink lips curling up slightly in a smile. “Well, you caught me, didn’t you?” He breathed. Bucky’s arms were still around him, still pressing him close and keeping him upright. 

 

“Suppose I did.” He managed, letting go of the man, his hand flexing once back at his side, the warmth already fading from his fingertips. He got down and picked up the man’s sunglasses from the pavement. “Are you alright?” He asked as he inspected them for scratches. 

 

“Just fine.” The other man said, sounding slightly winded. Jesus, did Bucky really hit him that hard? Bucky stood, holding out the glasses. “Here.” 

 

A beat. The man blinked.

 

“Oh, my God. Sorry. Your glasses. I picked them up.” 

 

The man laughed, and holy shit, it was like the air was knocked right out of Bucky. He has dimples. God, he has dimples. “It’s alright, really.” He holds out his hand, and Bucky—he really doesn’t know what possesses him, honestly—instead unfolds the glasses, and slides them right back into their spot on the man’s face. “There.” He says.

 

The man’s face is pink from the cold. “Thank you.” Christ, Bucky must have really hit him hard. Next to him, his dog nudges Bucky’s leg with her nose, curious, pulling slightly on the leash. He settles a hand on the top of her head, which is almost next to his ribs, she’s so tall. 

 

“Sorry—” He reigns her back to his side. “That’s Lea.” The man introduces. “And I’m Percy.”

 

Percy. 

 

Something about the moment feels odd, but in an abstract, distant way. He can’t bring himself to care, enraptured by the man in front of him. If he focuses, he can almost hear music playing in the distance—some soft, instrumental song. He has no idea where it’s coming from, but he doesn’t really care. 

 

“Nice to meet you, Percy. I’m Bucky.” His eyes don’t leave his face. It’s like he’s rooted to the spot, stuck on the sidewalk staring at this man, at Percy. 

 

His eyes crinkle when he smiles. “Bucky? Bit of a strange name.” 

 

Bucky still feels like he’s fighting for breath. His eyes are like the ocean. “How about you give me your number, and I can tell you about it later.” 

 

Percy regards him for a moment longer, something searching and soft on his face. “Get your phone out, then.” He orders.

 

He’s almost late for work. 

 

He doesn’t even care.



[Barnes]: It’s short for Buchanan. 

 

[Unknown Number]: Buchanan, really?

 

[Barnes]: If it helps, it’s my middle name. 

 

[Percy]: What’s your first name, then?

 

[Barnes]: James.

 

[James]: It’s James. 

 

[Percy]: That’s a lovely name, James.



His next appointment with Tony, the man keeps shooting him with odd looks. Ten minutes in, Bucky gives in. “What?”

 

“You’re smiling. It’s weird.” Tony replies, casting him another glance over his shoulder. 

 

Bucky frowns. “I smile.” 

 

Tony says nothing, just looks at him again. 

 

“I smile sometimes.” Bucky amends. 

 

Another directed silence. “When I feel like it.” He tacks on. Tony huffs rolls his chair over, and puts something into Bucky’s metal hand. “Squeeze this as hard as you can.” He obliges, and Tony makes a considering noise. “Any chance you’re interested in additional metal parts?”

 

“I’m sorry?”

 

“Barnes, the average adult male has a grip strength of about seventy pounds, and that scale maxes out at two-hundred pounds.” He looked up. “You maxed it out.” Then back down at his hand. “And then you broke it.” 

 

Bucky unclenches his fist to see warped metal. “Holy shit.”

 

Tony hums. “Might have done my job a little too well.” He shrugs. “Eh.”

 

“Eh?” Bucky repeats incredulously. “Tony, what the fuck?”

 

“I mean, you could already lift, like, at least half a ton with it—” Tony defends.

 

“What?”

 

Tony winces. “Anyways,” He drags out. “Did one of your enemies finally kick it? Seriously, I don’t think I’ve seen you smile this much, like, ever.” He squints. “You on drugs? Please say no. I don’t want to be responsible for a super-cyborg on LSD again.” 

 

“No, I’m not—again? Tony, again? What the actual fuck do you do in this lab when I’m not here?” Bucky shakes his head. “You know what? Don’t answer that. Seriously, don’t. I’m not on drugs. End of discussion.” 

 

Tony doesn’t look remotely satisfied, but doesn’t press further, especially because, not even a minute later, Peter bursts in and announces that Abe has gotten his leg stuck in the vending machine and needs help getting out. 

 

The manic grin that appears on Tony’s face will forever haunt Bucky’s nightmares. “You know, Barnes here can get your friend right out. That thing will definitely crumble under at least 200 pounds of force.” 

 

“No.” 

 

Bucky, surrounded by a group of eight teenages, one who is knee-deep in a vending machine, ends up getting peer pressured into crushing the door of the vending machine until they can free Abe. They erupt in screaming cheers as the metal groans and snaps under his metal fingers. 

 

It’s stupid. 

 

It’s also the best he’s felt about his arm in a very, very long time. 



[James]: What’s Percy short for?

 

[Percy]: …I feel like you’re going to laugh. 

 

[James]: Only if it’s funny. 

 

[Percy]: It’s pretty funny, admittedly. 

 

[Percy]: Perseus. 

 

[Percy]: My mother looked me in my tiny baby eyes, and named me Perseus Achilles. 

 

[James]: Oh.

 

[Percy]: Yeah. you’re laughing, aren’t you?

 

[James]: Only a little, I swear. 

 

[Percy]: I’m not taking this from somebody who willingly goes by Bucky Barnes.

 

[James]: :|

 

[Percy]: That means nothing to me or my text-to-speech.



The station responds to a call, puts out a field fire. Bucky goes back to the library a few more times, does his best to avoid the sad, pitying eyes of that one librarian. He calls Shuri a few more times. Tells her how he’s doing, and she seems glad. 

 

The Chief pulls them in for a meeting. “We’re doing the annual school visits next week.” He announces. “Kelley, Cole, you’re on Fields Elementary, Johnson, Cody, you’re going to Orchard Elementary. Maria, Landen, you’re on the middle school, and Rumlow, Barnes, and Romanoff are on the high school. Teach them about fire codes, what the department does, and what the job is like. Clear?”

 

“Clear.” They chorus. 

 

Romanoff—Natasha Romanoff, her name is—gives him a commiserating glance from the other side of the room. Rumlow, the third in their group is…well, he’s a dick, to put it succinctly. He and Bucky work opposite shifts, but the few times they run into each other, Bucky always leaves with a clenched fist and gritted teeth. He just shrugs helplessly at Romanoff. 

 

They devise a basic plan of what to go over, highlighting certain parts and running through practice speeches in between calls. Well, Bucky and Romanoff do—Rumlow tells them he’ll be doing the local fire code and common violations, then promptly leaves and doesn’t speak to them about it again. They end up deciding that Bucky will give a brief overview of the training to become a firefighter—some of the kids will be graduating soon, and the Chief is always looking for more recruits—Romanoff will talk about what they do in the community, other than the obvious, Rumlow will do his thing, and then they’ll take questions. 

 

It’s during one of their quick meetings that Romanoff sighs, eyes fixed on him. Bucky looks up at her. “What?” 

 

“Oh, you know how I worry.” She says, waving a hand. Bucky blinks. “I’m sorry?”

 

She gives him a pitying look. “You need to get out more, Barnes.” 

 

He says nothing, completely blindsided. They…they barely even know each other—Romanoff knows next to nothing about his social life. “What are you talking about?”

 

Romanoff sighs again, like he hadn’t even said anything. “I don’t want you to end up alone, Barnes. I know you’ve been having a hard time, but you need to learn to open up.” 

 

What the actual fuck?



[Percy]: One of my coworkers just had to be taught how to do his taxes.

 

[Percy]: He is twenty-four.

 

[James]: …Has he been committing tax fraud this entire time?

 

[Percy]: Honestly?

 

[Percy]: Maybe.

 

[Percy]: Very grateful that this is the type of person that is shaping young minds. 

 

[James]: What do you mean?

 

[Percy]: Oh, he’s a teacher

 

[Percy]: I work at the local high school

 

[James]: Really? I’ll be seeing you soon, then.

 

[Percy]: Good for you

 

[James]:

 

[James]: You’re not funny.

 

[Percy]: Yes, I am. 



They swing by the school for the assembly the following week. The students are settled in the bleachers, the teachers lined up against the padded walls of the gym. Bucky can’t help but look around until he spots Percy, cane in hand and Lea sitting patiently at his feet. He’s dressed in nice pants and a sweater vest, quietly talking to the person next to him, and Bucky’s mouth goes dry. The other teachers are either watching the students with narrowed eyes or similarly talking amongst themselves—the tallest person Bucky’s ever seen is leaning down to listen to a Hispanic woman with long, wavy hair. A woman with elaborate braids and a yellow sweater is speaking to a man in a wheelchair, and a spikey-haired man is nodding along to something Percy says. 

 

The presentation goes fine. Though he’s speaking to the students, he can’t help but continuously glance back at Percy, who jolts the second Bucky starts speaking, his lips parting in surprise at the sound of his voice. 

 

It’s probably not unique to him in the slightest, but Bucky can’t help but like that Percy can recognize him by voice alone. 

 

The questions at the end are a little rough. Someone asks why they decided to become firefighters, and Romanoff tells her story about meeting some of their local department members as a teenager and deciding to join up right out of high school. Rumlow tells his, following his father’s footsteps and serving the community—he, too, joined right out of high school. 

 

When it comes to Bucky, a girl in the front asks him why he moved here, of all places. He shouldn’t be surprised—the town is most definitely small enough for them to take note of an unfamiliar face, and he has no doubt that word has spread about the firefighter with a metal arm. 

 

“Originally, I came here because of the Carter research center and their prosthetic work.” He says. “I served in the military beforehand, and never lost my sense of duty, unlike some things” He gestures to his metal arm, and that gets a round of laughs. 

 

“You lost it in the military?” 

 

He shifts, just a little. “I did.” 

 

“Any more questions?” Romanoff intervenes. Bucky exhales slightly, his shoulders losing some of their tension as the discussion shifts. His eyes flick to Percy once more, who is listening with a tilted head and considering look. 

 

Bucky looks down, face tight. 



The assembly was slated for the last period of the day, and the kids trickle out to the parking lot once they’re finished answering questions. The teachers, too, take their leave, back to their classrooms. 

 

Percy sticks around, and Bucky, after a second, makes his way to him. 

 

“You’re a firefighter.” Is the first thing Percy says, his head cocked to the side, ever so slightly. 

 

“You’re a teacher.” Bucky returns. 

 

“You already knew that.” He taps the handle of his cane absentmindedly. “Will you do me a favor?”

 

“Of course.” Bucky doesn’t even think about it before agreeing. 

 

“Walk with me back to my classroom? Kids always leave things around after the assemblies, and Lea, here, can only do so much.” 

 

“It’d be my pleasure.” Bucky says, and he’s completely genuine. The hallways are a mess, like Percy said, and though he mostly avoids most of it with his cane and Lea, Bucky gently intervenes to keep him from stepping in a puddle and later on a notebook. He makes a note to try and find another faculty member—not only is that inconsiderate to the custodial staff, but to Percy. 

 

Percy’s classroom isn’t what Bucky expected. There are no desks, for starters—instead, a rack of chairs and music stands against the wall. There’s a row of shelves in the back, loaded with instrument cases, and a small storage closet to the left for larger instruments. Percy’s office, similarly, has a few cases tucked into the corner. There are also bookshelves—a few textbooks, but also novels, all in different languages.

 

“Music?” 

 

“Orchestra and language.” Percy says. “Weird combination, but,” He shrugs. “It works.” 

 

Bucky hums and sits in the chair against the wall, near Percy’s desk. 

 

It’s silent for a moment while Percy rests his cane against the wall and Lea gets a drink from the bowl in the corner. “A firefighter?” Percy repeats. Bucky ducks his head. “You already knew that.” He parrots. Percy makes a face at him. Then, “Your presentation was nice. The kids seemed to like it.”

 

“A boy in the back was knuckle deep in his nose the whole time.” 

 

“...You can’t win them all?” Percy tries. 

 

Bucky huffs in amusement. “Guess not.” 

 

They lapse into silence. It’s oddly comfortable, the kind Bucky finds with Shuri and Ayo, the kind that comes with familiarity and closeness. It’s odd—he’s only known Percy a few weeks, and they’ve really only seen eachother in person a few times, but it feels incredibly easy, sitting with him like this. 

 

“I’m going to tell you something, and you’re not going to laugh at me.” Percy declares. 

 

Bucky, amused, looks at him. “Am I, now?” 

 

“Yes, you are.” He bites the inside of his cheek. “I didn’t even know you were missing an arm.” Percy admits, cheeks a deep scarlet. 

 

Bucky tries to hold it in. Really, he does, but he can’t help how he barks out a laugh before his hands come up to cover his mouth. “You—how did you not know?” He gasps out. Percy groans, burying his face in his folded arms. “How would I have known?” He complains. Bucky can’t stifle it any more—his shoulders shake and his ribs ache as he laughs. 

 

Later, he would realize that it seems like the first time he’s laughed like that in a very, very long time. 

 

“Stop laughing at me!” Percy demands, muffled into his arms. “How would I have known?”

 

Bucky’s smile is hurting his face. “I thought you would have at least heard about it, I mean, everyone seemed to know me the second I moved here.” 

 

“Sorry for not being a gossip,” Percy mumbles, still slumped over. Bucky laughs again, softer this time, before reaching out and gently taking Percy’s hand with his, uncurling his fingers and placing it on the open palm of his metal hand. At that, Percy sits upright, a curious look on his face. “Can I—” 

 

“Go ahead.” 

 

Percy takes Bucky’s hand in both of his, running his fingertips curiously up and down his fingers, circling his palm, dipping down to his wrist. Bucky resists the urge to shiver—Tony wasn’t joking about the tactile sensitivity. Percy might as well be touching his skin. Bucky barely even breaths as Percy’s fingers skim up his arm, stopping halfway to his elbow. “How far up does it go?” He asks curiously. 

 

It takes Bucky a moment to find his voice. “My shoulder.” He gets out. 

 

Percy hums, and, to Bucky’s disappointment, lets go of his arm. “If it’s any consolation, it feels very pretty.” He says wryly. 

 

“Much appreciated.” And, God help him, he’s not lying. 




[James] Why does one town own so many Christmas lights?

 

[Percy]: Oh, you’re in for a real treat. 

 

[Percy]: Christmas in Westblooms is serious business, James. 

 

[James]: Should I be scared?

 

[Percy]: You’ll be fine.

 

[James]: I feel like you’re lying to me.

 

[Percy]: …Maybe.



“—it’s a protected reserve, they’re never going to get it approved. I don’t know why they don’t just drop it already.” Tony rambles. 

 

Bucky looks up from his phone. “Sorry, what?”

 

Tony suddenly grins. “You textin’ someone, Barnes?” 

 

“No.” He says, you know, like a liar. 

 

Tony sighs. “Barnes, I know you’re tired of hearing this, but you need to get out more.” 

 

Bucky is suddenly hit with an absolutely horrific sense of deja vu. 

 

“I know it’s not easy for you to open up, but you gotta try. I mean, nobody wants to be alone on Christmas, Barnes.” Tony continues, ignoring Bucky’s dropped jaw and incredulous eyes. “We’re getting worried about you.”

 

Bucky looks around. “Who the hell is we?” 

 

The room takes on a somber mood. He swears to every deity out there that someone is sadly playing the violin in the distance. “Just, promise me, alright?” Tony urges once more, completely ignoring him. “This isn’t what your father would have wanted for you.” 

 

…What?



The rest of the day was similarly strange. At work, the Chief and Natasha roped every other person on shift into showing up pictures of their single family members. Half of them invite him out to ‘put himself out there’. Cody starts talking about dating apps, and Bucky flees the scene. 

 

He instead goes for a short walk around town, stopping in the park to watch a group set up part of the annual lightshow. There’s music—something orchestral—coming from the other side of the park, and he finds himself drawn to it. 

 

There’s a stage in the middle of the park—nothing fancy, though it is decorated with an absurd amount of tinsel. Spread out in neat arcs is an orchestra. He recognizes Peter in the far left side of the brass section with his French Horn, talking to Sally, who’s in front of him with a clarinet. 

 

Percy’s there. 

 

Something in Bucky’s chest both tightens and loosens. The man is standing in front of the orchestra, and he’s smiling as he talks to them. Bucky is absolutely entranced, listening with rapt attention as Percy raises his hands, two dozen instruments rising with them. 

 

Carol of the Bells, Bucky realizes after a moment. For a high school, they’re surprisingly good. Really good, actually, though Bucky will admit he pays far more attention to the conductor rather than the orchestra itself. 

 

The song finishes, and Percy waves for them to all go pack up. Lea is waiting at the edge of the stage, and Percy takes his cane out from his inner coat pocket, unfolding it and making his way off the stage. Without thinking (it feels like the most natural thing in the world, and Bucky has absolutely no clue as to why) he calls out to him. “Percy!”

 

He stops, turning towards Bucky. “James?”

 

Bucky makes his way over to him. “Hey. What are you doing out here? They not give you a music room, or something?”

 

Percy huffs out a laugh, his smile wide and practically blinding. “No, they give us a music room. We do a Christmas show every year to raise money for the music program, and it’s coming up. I just want them to get used to the stage and playing outside.”  

 

“When is it?” Bucky asks. 

 

“Oh. Uh, next Friday. At six.” 

 

Bucky nods. “Cool. I’ll be there.” 

 

Something soft overtakes Percy’s face. “Really?”

 

“Of course.” 

 

Percy ducks his head. “That’s real sweet of you, James.” 

 

Bucky just shrugs. Behind them, some of the kids are calling out goodbyes as they head to the parking lot with their instrument cases. Percy responds to each one with a smile. 

 

A quick glance at his watch, and Bucky returns his focus to Percy. “Do you want to get coffee?”

 

Percy blinks. “Now? Not really a great time for coffee.”

 

Bucky shrugs. “It’ll be a great time if you’re there.”

 

He takes great pleasure in how quickly the other man flushes. “I—Okay. Yeah. Coffee.”



Their coffee date goes fantastic. Bucky has no idea what it is about Percy, but every time he so much as speaks, Bucky feels like he’s exactly where he’s supposed to be. Every smile, every laugh, and Bucky is a goner. 

 

They go out for coffee again. Then they get lunch together. Then they take Lea to the park together. Bucky feels like a withering plant and Percy is the fucking sun, like his life depends on soaking up every minute of this man. It’s insane and almost scary and he doesn’t give a single shit. 

 

He goes over to Percy’s and they bake cookies for his classes. Percy’s wearing an incredibly soft looking sweater and a flour-dusted apron, and Bucky wants to do so many things to him.

 

They get lunch again, and they take it to the park and sit on a bench together while Lea runs around. Percy sits next to him, right next to him, and he can feel the warmth emanating from the other man. 

 

It’s only after they’ve said their goodbyes does Bucky realize that Percy left his scarf behind. 

 

[James]: I have a hostage.

 

[Percy]: Oh, shit. 

 

[Percy]: Is it Lina from the bakery on Main? Please tell me it isn’t Lina. Her croissants are the only reason I haven’t moved. 

 

[James]: …It’s your scarf, dumbass.

 

[Percy]: Oh.

 

[Percy]: To clarify, Lina and her croissants are safe, yes?

 

[James]: Yes, Lina and her croissants are safe. 

 

[Percy]: Thank the Gods. Is there a good time I can come by and pick it up?

 

[James]: I just got off work. If you’re not busy, I can drop it off right now.

 

[Percy]: That’s sweet of you, but you don’t need to go out of your way.

 

[James]: I’d do it just to see you, no scarf involved. 

 

[James]: Is now a good time?

 

[Percy]:

 

[Percy]: Yeah. Now would be fantastic. 




Bucky pulls up to the school to find it mostly empty. A quick look at the time confirms that school had let out half an hour ago—it’s mostly just faculty, now. He quickly signs in at the office, and, with a visitor's pass, heads in the direction the secretary had pointed him in. 

 

 He can hear the yelling down the hall. 

 

“How fucking dare you?” A man, slightly raspy and angry.

 

“Mr. Rumlow, please calm down.” It’s Percy, sounding stiff and uncomfortable. “I will not be discussing anything with you until you regain control of your temper.” 

 

Another voice—the tall blonde with a muddled accent. “Mr. Rumlow, I’m going to have to ask you to leave.”

 

Rumlow carries on like they’re not even there. “You suspended my fucking kid, I think I have a right to be pissed.” He spits. “Who the fuck do you think you are, huh? This is going on his record, you know? You’ve fucked up his life.” 

 

Despite how uncomfortable he seems, Percy remains unmoved. “Mr. Rumlow, he did that himself. Your son made his choices, and now he has to live with the consequences. The matter is out of my hands now. If you have a problem, I believe you’ll need to take it up with the police department.” He says icily. 

 

It’s silent. Then, there’s a crash, and Bucky bursts into the room. 

 

There's another teacher,  leaving out the side door, seemingly dragging someone along with them. Right before the door shuts, Bucky meets their eyes, unnervingly clear blue that feels almost familiar. They nod at him once, and the door swings shut behind them. 

 

Percy is standing in the middle of the room, his glasses askew and his cane on the floor at his feet. He’s bleeding.

 

Bucky bends down at his feet, picks up his cane. “Percy?” He prompts softly. Slowly, he reaches a hand out and settles it on his collar, fingers curling over his shoulder. “Are you alright?” 

 

When he pressed the cane into Percy’s hand, he takes it, hand going overtop Bucky’s. He doesn’t let go. “James?” 

 

“Hey, darling.” He confirms, free hand coming up to cup Percy’s jaw, soft skin against his calloused hands. He tilts Percy’s face side to side, taking in the fresh split of his lip and steadily trickling blood from his nose, catching in the seam of his lips and smearing across his cheek. Suddenly, things begin to make a lot more sense. He steps closer, closing enough distance that he can see how Percy’s lashes flutter. “Percy, love, did he hit you?” 

 

He can feel the exhale against his hand. “Some of my students came to me about his son. Kid ended up getting suspended.” A weak smile, pulling painfully at the split lip. “He wasn’t too happy.” 

 

“I’ll fucking kill him.” Bucky breathes. “Who?” 

 

“Doesn’t matter.” Percy shakes his head. “Just some douche.” 

 

Deep breaths, he has to remind himself. Be pissed later. He skims his thumb across Percy’s cheekbone. “Percy…” He shakes his head. “I’m taking you home.” 

 

“You don’t need to do that.” 

 

“Percy.” He repeats gently. “I’m taking you home.” 

 

Percy ducks his head, leaning against Bucky’s hand. “Okay.” He says quietly. 

 

They go out the main entrance, Bucky quickly returning his visitors pass. December air nips at them out on the sidewalk, and Bucky stops Percy with a strong arm. Before Percy can even ask, Bucky holds up the scarf he had forgotten and loops it securely around his neck. “There.” 

 

The look he gets—flushed cheeks, parted lips, wide eyes, almost makes Bucky forget the seething rage now resting inside him. Almost. 

 

It is enough, however, for him to momentarily table it. 

 

Momentarily. 



The next day, he goes into work, and Romanoff is standing by the coffee machine. “Word of advice,” She says as he fills his mug. “Avoid Rumlow if you can.”

 

“Already do that, but continue.”

 

She rolls her eyes. “Apparently, his kid got in some trouble, or some shit. He’s been a bitch all morning.” 

 

Bucky’s hand tightens on his mug, and he’s suddenly very glad he’s not holding it with his metal hand, because it would have undoubtedly shattered. “Hm.” Is all he says.

 

The end of Bucky’s shift, after he finishes his equipment inspection, he catches Rumlow going out into the parking lot. Bucky follows him. It’s dark out, the lot only illuminated by the streetlights overhead. Rumlow doesn’t even see him coming. 

 

“Hey.” 

 

Rumlow whips around. “The fuck do you want, Barnes?”

 

Bucky grabs his hand and yanks it forward, under the light. Rumlow’s knuckles are split. The man tries to pull his hand back, but Bucky’s grip tightens until he cries out. “You think you can just do whatever the fuck you want, huh?” Bucky demands. 

 

“What the hell are you talking about, you psycho? Let me go,” Rumlow snarls. 

 

Bucky hears something in Rumlow’s hand pop. “You think you can just go around taking shit out on whoever you want?” He asks, leaning in. His voice lacks the bark of Rumlow’s, instead coated with something cold and sharp. 

 

“I think you need to mind your own fucking business, pal,” Rumlow hisses. 

 

Bucky is on him before he can even think, fingers twisted in Rumlow’s collar, lifting him off the ground and slamming him against the side of his stupid fucking truck. “Who,” Bucky’s grits out, his voice low, “do you think you are?” Rumlow grabs at his wrists, digging his nails into his flesh in effort to make him let go. 

 

It doesn’t work. 

 

Bucky shakes him, hit head hitting the wall once more, before he abruptly lets go, letting the man fall to the ground. There’s something cold in his words. “Stand up.” 

 

Rumlow, stunned and clutching the back of his head, does nothing. 

 

“Stand up.” Bucky snarls. Rumlow gets to his feet, the veins in his neck bulging and his face taking an ugly shade of purple. The second he’s upright, Bucky hits him, the sound of his knuckles impacting on his jaw brutal and satisfying in equal measures. Rumlow drops.

 

“Yeah, not so fun when it gets dished back, ain’t it?” Bucky gives Rumlow, who looks only half-conscious, one last frozen look. “You go anywhere near Percy again, and I swear to God, Rumlow, I’ll snap your fucking neck.”





The next time he sees Percy, he doesn’t say anything, but Bucky has a feeling that he knows. It’s impossible for him to explain, because, logically, how would Percy know? But…there’s just something about Percy, beyond the inexplicable that swirls in his eyes. He knows, Bucky’s almost certain of it. 

 

But he doesn’t bring it up, so neither does Bucky. 

 

Not until they’re about to split up. Percy tugs Bucky forward—and holy shit, he’s fucking strong— and wraps his arms around Bucky. He’s warm and he smells like the ocean and lavender and Bucky feels so incredibly right like that, wrapped up in his arms. 

 

“Thank you,” Percy breaths into his ear. 

 

Bucky can hear practically nothing but those words, replaying in his head, for the rest of the day. 



Rumlow doesn’t show up for work the following week. Calls out sick. Romanoff seems to enjoy his absence. The entire station does, really. Unfortunately, the good mood they’re in only results in more attempts to set Bucky up on a date. 

 

If he has to hear about one more cousin or nephew or family friend, he swears he’s going to lose it.




The first time Percy comes over to Bucky’s house, he scares the absolute shit out of him. Shuri and Ayo had sent him a new book, and—though he’d told Percy, assured him many times, the door was unlocked and he could just walk right in, his sudden presence made him tense up. The man was stealthy. 

 

“Shit–” Bucky hissed, turning around to see Percy standing a tad awkwardly in his living room.

 

Percy snorted softly, taking in his rigid stance. “You gonna hit me? Should we take this out to the parking lot?”

 

Bucky stood, slipping a bookmark in between the pages and setting his book down on the coffee table. “‘Course not,” He says, coming to stand in front of Percy. He adjusts the scarf from around his neck, relishing in the immediate pink tinge to his face. “I don’t hit pretty teachers who are kind enough to bring me cookies.” 

 

Percy, cheeks still warm, huffs at him and shoves the tupperware into Bucky’s chest. “Ass.” 

 

“I call you pretty, and you’re mean to me?” Bucky’s grin is unrepentant as he puts on his own coat. “I see how it is.” 

 

“I’m glad someone does.” Percy deadpans. That gets him an eye roll as the two walk back outside, setting off for the park, Lea excitedly wagging her tail. Percy lives extremely close to the park, likely for this very reason. They cross the street and head for the park gates. 

 

“You’re not funny.” 

 

“You love me.” Percy dismisses. It…it sounds so normal, so factual, and Bucky suddenly feels like he can’t breathe. The park is full today, but everything seems to go dead quiet around them, like this conversation is the only thing that matters. 

 

“Yeah.” Bucky says, as the world around him narrows to a knife's edge. Suddenly, he's elsewhere, standing on a balcony overlooking the city, missing his arm and staring at a man who had sacrificed so much. “Yeah, I do.”

 

Percy goes still. “James…”

 

Everything is like static around him. All he can see is Percy, his dimples and his freckles and his eyes. “I think I’ve been in love with you for a long time.”

 

“Fuck off.” And then, Percy is surging forward, Bucky’s collar is fisted and he’s yanked down, and Percy’s lips are warm and soft against his. 







Clarity rushes in like water through a broken dam. One hand still gripping Percy’s waist, the other cupping his jaw, Bucky suddenly lets out a choked exhale. He blinks, fully stopping and looking around. 

 

“What,” He breathes. “The fuck.” 

 

Percy, who seems equally utterly lost, is tilting his head to the side, a deep furrow in his brow. “James…” He trails off, blinks. “Is my radar off, or—” 

 

“Where the hell are we?” Bucky breathes out. His grip on his boyfriend—his boyfriend, they’ve been together for a long time, why, how did he think he didn’t even know him—tightening. 

 

“Westblooms, Vermont.” Percy recites automatically, stupefied. “I’m a fucking teacher in Vermont. Oh, my God, all my employees are teachers. Who the fuck let any of them influence children?” 

 

Bucky breaks away from searching around them to stare. “That’s what you’re worried about?”

 

“Yes! Quite frankly, it’s very concerning!” He focuses on Bucky for a moment longer. “Oh, my Gods, you’re a firefighter. And—and a Navy Seal! Why were you in the fucking Navy, James?” 

 

“I–I don’t know!” Bucky defends. “And, not anymore, apparently!” 

 

Percy groans, thunking his head down on Bucky’s chest. “I hate this.” It’s unclear what exactly he’s referring to. 

 

“Magic.” Bucky mutters, taking another look around them, the Christmas tree and the tinsel and the lights and they’re surrounded by inoffensively blank looking couples and families, none of whom seem to be paying them any attention at all, despite how loud they were a moment ago. A cold gust of wind kicks up, and it hits him like a freight. 

 

“Tinsel.” He hisses. 

 

Percy makes a face like he’s accepting that his boyfriend has finally lost his mind. 

 

“There was a fucking elf.” Percy’s soothing, consoling face only deepens. He looks like he’s considering how well Bucky would suit a straightjacket. “No, no—I’m serious. One of the people from the fucking dinosaur place we went last year—Percy, stop laughing, there was an elf in the common room and they kept complaining about my love life—are you even listening?” 

 

“Not really.” Percy wheezes. 

 

“Fuck you. Honestly, fuck you.” 

 

“I don’t think this is that type of movie.” 

 

“See, you act like I’m insane and then you say shit like that. Real manipulative shit, love. Pretty sure this is what Shannon warned me about.” 

 

“No, Shannon told you to stop taking credit for the Zodiac murders.” 

 

“It could have been me.”

 

“But it literally wasn’t.” 

 

“I hate you.” 

 

“Sounds about right.” 

 

Bucky kisses him again. “Movie?”

 

“Tell me this doesn’t scream Hallmark to you.” 

 

He looks around again. It’s snowing, just a little, enough to dust coats and hats. Kids are running around in winter gear that's both perfectly clean and also matching. There’s a stand handing out free hot chocolate at the corner of the park. In this economy? Bucky’s eyes narrow. “Shit.”

 

“Yeah.”

 

“I hate Hallmark movies.” 

 

“You liked that one with the knight.” Percy reminds. 

 

“The Knight Before Christmas is a classic. Shut your whore mouth.” 

 

Bucky said that quite loudly. Not a single person around them, all families with young children, reacted. His eyes narrowed further. 

 

“Shit.” He says again. “What the fuck do we do?”

 

“The movie usually ends a bit after they get together.” Percy offers. “Maybe it’ll end soon? And we’ll…wake up? Get let out? I mean, I’m still definitely supposed to be escorting a dangerous prisoner to trial.” A pause. “It’ll be fine, probably.” 

 

“We’ve already broken the movie, though. I mean, besides us being out of the norm for this type—”

 

“Diversity win! Couple kidnapped and trapped in a Christmas movie hellscape is an interracial, gay, and disabled!” Percy mumbles. Bucky ignores him. “Those movies are rated PG, and we have sworn way too much.” 

 

“You did also beat Rumlow unconscious.”

 

“...Right. I did do that.” 

 

Percy nods. 

 

“Isn’t he dead?”

 

“I am fairly confident in my answer of yes.” 

 

“...Hm.” 

 

“He’s probably not real?”

 

“... Hm.” 

 

“Do you think everyone else knows?” 

 

“Considering I haven’t gotten a million texts from Tony, I’d say no.”

 

“Shit.” They seem to be saying that a lot, recently. 

 

“What do we do now?” 

 

Percy makes a face. Snow is clumping on his lashes, contrasting against his dark hair. His face is flushed, and his lips are still so, so warm. Bucky looks around, the mindless groups wandering around them. He looks back to Percy—his eyes, something that no amount of magic could ever change, swirling and crashing like waves against a rocky coast. He’s chewing on his lower lip as he thinks, the adorable scrunch in his brow present. 

 

Fuck it. Might as well.

 

Bucky’s hand on his waist slides down a little lower to his hip. “Well, I know what I’d like to be doing.” 

 

Bucky didn’t think it was possible, but Percy’s face tinges even darker. Then, after a long moment, “You know what? Sure.” He gently squeezes the side of Bucky’s neck. “Take me home, Jamie.” 





Waking up with Percy in his arms almost makes him forget they’re not home. His head is on Bucky’s chest, curled into his side, an arm wrapped tightly around him. Bucky doesn’t even entertain the notion of trying to get up, more than content to lay there with his boyfriend, his thumb lightly skimming up and down his bare arm. 

 

He’s warm. 

 

This whole time, he’d been confused as to why he’d been so cold. Blankets and layers did nothing, failing to chase away something that lived deeper than his skin. Percy was so close to him it was like they were one, an all-encompassing warmth radiating off of him. 

 

“Finally figured it out.” He whispered aloud. 

 

Percy made a soft sound, face scrunching. “Mmh?” 

 

Bucky presses a kiss to the top of his head. “Nothing, love.” 




The peace doesn’t last. 




“Two people have given me speeches about how I need to open up and get myself out there.” Bucky says the next day, dropping down at Percy’s dining room table.

 

Percy chokes on his cereal. “I’m sorry?”

 

“Last week, Tony looked me in the eyes and told me that this isn’t what my father would have wanted.” 

 

The furrow in his brow makes its grand reappearance. Then, something strikes him—Bucky can almost see the little lightbulb appearing above his head. “James,” He breathes. “James, Jamie, love, you’re the emotionally distant protagonist from the big city.” 

 

Horror. Absolute horror. “No.” He gasps. 

 

Percy, the bastard, is cackling. “You totally are!”

 

“Okay, well, that means you’re the sweet small-town boy who’s been spurned by a past love!” He snips back. “And your small business is failing!” 

 

The color drains from his face. “No, my small business!” A beat. “Wait, I’m a teacher at a public high school. Never mind.” 

 

Bucky just sighs. 



 

They’re washing the dishes when Percy suddenly turns off the tap. “Wait, is this why I keep hearing tender and emotional music whenever we talk?”

 

“Thank fuck, I thought I was just imagining that.”



 

They spend the weekend together. Sunday night, laying in bed, they both agree to continue on with…whatever the fuck is happening. Their best lead at the moment is just trying to finish the movie. Typically, there’s another plot that’s not where the main characters get together, though it usually is a driving force for their relationship, Percy had pointed out. 

 

Bucky had groaned, rolling over to bury his face in Percy’s hair. “I cannot believe your encyclopedic knowledge of shit Christmas movies has actually become useful.” 

 

“Gods forbid I hyperfixate in peace, asshole.” Percy replied, holding James like he was the most important thing in the world. 



 

Thirty minutes of complete silence later, Bucky lets out a muffled scream into his pillow. “Natasha is going to try and get me to open up emotionally.” 

 

Percy, the unfeeling bastard, laughs at him. 



 

The next morning, Natasha keeps mentioning her various family members and friends his age. “She’s nice, I promise. Loves reading, so you’d have something to talk about.” 

 

Bucky, who’s so far beyond the point of caring, just buries his face in his hands. 

 

He misses her calculating look. 

 

At the end of his shift, the Chief calls him in. 

 

He proceeds to tell Bucky about his nephew—a sweet young man, just broke up with his boyfriend, goes to college not far from here—

 

Bucky screams in the middle of the fire station. 



 

Then, he abruptly remembers that Rumlow exists in this world. Bucky goes to his house. He kills Rumlow. 

 

He’s pretty sure this is the kind of stress relief his therapist was talking about. 

 



[Percy]: James this is so fucking weird

 

[Percy]: Dan is grading stuff

 

[Percy]: Mal is writing an email about attendance records

 

[James]: Awful, but not as horrific as what I just went through. 

 

[Percy]: Oh, dear. 



Over dinner, they revisit the topic of how to get out of their festive prison. 

 

“It could have something to do with the B-plot.” Percy suggests again. 

 

“Maybe.” Bucky acknowledges. “But what could that even be? Unless you have a failing small business…” He trails off hopefully. Percy shakes his head regretfully. “Still no. Nor am I a single parent with a child that could get suddenly hurt, sick, or go missing.” 

 

“Damn.” 

 

“Maybe it’ll be over on Christmas day? The movies always end right after Christmas.” 

 

“It could be a social aspect? Especially if we’re right about the character archetypes we fit into—maybe if people actually fucking know we’re together, they’ll leave me alone.” 

 

“Kiss under the mistletoe at the work Christmas party?”

 

Bucky stares at his boyfriend through his fingers. “Love, at this point, I’ll fuck you on the floor under a Christmas tree, if that’s what it takes.” 

 

Percy chokes on his pizza, and Bucky almost has to give him the Heimlich. 




“Hey, Barnes—” Natasha pokes her head into the breakroom. “Have you signed up yet?”

 

He looked up at her. “Signed up?” 

 

“I keep forgetting you’re new here.” She fully enters the room and places a clipboard down on the table across from him. “Every year, for Christmas, the town does a volunteering event down at the preserve—cleaning up trash and weeding out invasive plants. The whole station always goes. There’s usually a group that hands out hot chocolate, too.” She prods. “It’s a good time, Barnes. Do some community service, help out nature…meet some people…” 

 

From behind his sandwich (triangles, cut in triangles, Percy made his lunch) Bucky seethes. “Natasha…” 

 

She puts her hands up. “Fine, fine! Just…come, okay? Please?” 

 

“Maybe.” The second she leaves, he pulls out his phone. 

 

[James]: Did you know about the preserve clean-up?

 

[Percy]: Mal was just talking about it. 

 

[Percy]: Let me guess; your frozen, shriveled heart will be thawed while weeding plants and picking up beer cans and used condoms?

 

[James]: The fact that she genuinely thinks that is extremely upsetting.

 

[James]: I’m sorry, used condoms?

 

[Percy]: I’m still a little unclear of whether or not I had my abilities and just forgot about them, or something, but now I am very, very aware, and, James, I swear to the Gods

 

[Percy]: These kids think they are so fucking stealthy. 

 

[James]: …Are they?

 

[Percy}: Not in the slightest. 

 

[Percy]: It’s not even because I’m blind. They do this to all the fucking teachers, and, James, sometimes it works. 

 

[Percy]: Yesterday two kids asked to ‘go to the bathroom’ and came back, not only covered in hickies, but with Taco Bell. 

 

[Percy]: Dan did not notice. 

 

[James]: …Any chance that’s just the magic?

 

[Percy]: Unfortunately for humanity, both Dan and most teenagers are just like that. 



The clean-up lasted two weeks up until Christmas. In the name of trying to go along with whatever the fuck was happening, Bucky signed up with the rest of the station, and Percy signed up with the rest of the school staff. 

 

“I’m pretty sure they’re going to put me on hot chocolate duty, so…have fun with the trash, love.” 

 

Bucky smiled sweetly at his boyfriend. “You sure you don’t want to echolocate used condoms? For the good of nature?” 

 

The face Percy made in response made Bucky just about keel over laughing. 



The first day, he got paired up with Natasha. The two of them got assigned a sector of the preserve and combed over it with rubber gloves and trash bags. She did most of the talking, but that was typical for them. He listened as he sorted through what could be recycled, adding in short comments about whatever story she had launched into. 

 

At the end of the day, they reported back to the entrance of the preserve, where dumpsters were lined up. True to his prediction, Percy was sitting under a small portable canopy with Bridgette and a woman he didn’t recognize. He must have stared for just a moment too long, because Natasha, not even ten minutes later, cheerily informed him that she had to run some errands tomorrow and he would have to be paired with someone else. 

 

And, wouldn’t you know, the woman from the hot chocolate table had volunteered to stand in for her. 

 

The next day, Bridgette was waiting for him. She introduced herself with a smile, and, when he shook her hand, he could feel the entire station’s eyes on him. He did not give a single one of them the satisfaction of eye contact as he went to grab some garbage bags for the two of them. 

 

It was easier to talk to Bridgette. While she didn’t really remember at the moment, they had spoken before. Gone on dangerous, international missions together. He knew her. She didn’t know him, but she was still Bridgette. 

 

“Don’t get me wrong, I love my wife, but…I cannot mess with bugs.” She was saying with a shiver. “I’m happy for her, don’t get me wrong, but when she volunteered to do the entomology survey…” Bridgette shook her head. “The hot chocolate stand was just calling my name.”

 

He’d laughed at her, just a little, and she’d thrown a crushed soda can at him. 

 

The Chief, Martins, Cody, and Landen are all standing very, very inconspicuously at the dump site. Bucky makes the mistake of smiling at Bridgette as she speaks while they’re in view, and the group breaks out into furious whispers. 

 

He looked them all dead in the eyes as he waves goodbye to Bridgette and politely asks her to give her wife his regards. 

 

He lived through the Great Depression, the second World War, and then became an assassin, and yet he has never seen a group look so utterly devastated. 

 

The third day is, somehow, worse. He gets paired up with Ross, and Percy is visibly holding back a laugh as the two of them shake hands. Don’t get him wrong—he doesn’t hate Ross, not in the slightest, but one can only hear the phrase deez nuts so many times before beginning to fight the urge to return to being an assassin. 

 

By the return, the thought of strangling Ross must have reflected on his face, because Maria, Kelley, and Cole—the ones oh-so-casually waiting near the entrance, lose an alarming amount of color.

 

Thursday, heavy snow results in the clean-up being postponed. The roads are too dangerous to go out, and practically the whole town stops to take a breath, to watch the snowfall from the safety of a heated home. 

 

Bucky spends practically the entire day in bed, having hauled his space-heater boyfriend atop him. Percy, his head on Bucky’s chest and his arms wound around his waist, is more than willing to lay there with him. They switch between quiet words and bouts of comfortable silence. 

 

Percy rubs the side of his face against Bucky like a cat. His breath is warm against his neck. Bucky runs his hand up and down Percy’s bare skin, thumb tracing up and down a scar that goes a few inches up his spine—it’s one of the older ones, a spear that caught Percy when he was sixteen. Bucky feels as if he knows each and every one, the story and the pain and the feel of the mark against his fingertips and his lips. 

 

They spend hours like that, lazing in eachothers arms and exchanging languid, soft kisses. Percy’s hair, the longest it’s ever been since Bucky’s met him, twines around his fingertips as he gently tugs his boyfriend back up to his lips. “Love you.” He murmurs against him. 

 

Percy’s knees rest on either side of his hips. “I know.” He says, ducking down to kiss him once more. “And I love you,” Another kiss. “Enough to fall in love with you twice.” 

 

Bucky’s phone rings shrilly. He groans and grabs for it.

 

“HammerTech.” Tony snarls through the line.

 

Bucky blinks. “...No, this is Bucky.”

 

“Fucking HammerTech, Barnes! They bought the fucking preserve!” 

 

Next to him, Percy’s eyes widen and he sits up. “What?” He whisper yells. 

 

“They bought the preserve?” Bucky repeats. 

 

“Yeah! They’re going to turn it into some fucking rental properties to advertise their piece of shit temperature regulation systems. They’re going to tear down the entire fucking thing!” Tony yells. 

 

“Shit—they can’t do that, can they?”

 

“I didn’t fucking think they could, but here we are.” 

 

Percy, who could clearly hear both ends of the lines, frowned. He moved to get out of bed, but Bucky’s arm around his waist tightened. Percy let out a small huff, but leaned in to him. 

 

“It’s a crock of shit—I’m sorry, Barnes, did I just hear another human being with you? In your home?” 

 

Bucky thunks his head onto his pillow. 

 

“You’re in bed?” Tony shrieks. “Oh, my God, Barnes! You’re in bed with someone!” 

 

Bucky looks at Percy, who’s wearing his sweatshirt and—well, that’s it, actually—in his bed, Bucky’s arm around him. He rubs a small circle into Percy’s hip with his thumb. Then, in the flattest voice he can muster,  “Don’t be an idiot, Tony. Who the fuck would I be with?” He slides his hand a little lower. “I’m going to look into this HammerTech shit. I’ll call you back.” 

 

He drops his phone on his nightstand and hauls Percy into his lap. 

 

“Fall in love with me twice, hm?” Bucky asks, something soft and satisfied and all-consuming on his face. 



Bucky looks into HammerTech, just like he said he would. Just…a few hours later. 

 

“Not that much seems different. Justin Hammer, still a piece of shit. Not a supervillain, but—”

 

“That preserve is one of the most biodiverse green spaces in the whole region. Hundreds of native species rely on it, and it’s home to a dozen endangered and threatened species. Justin Hammer wants to build condos on it. He’s a supervillain.” 

 

“...That’s fair. This Christmas kind of fucking sucks. Last time was better.” 

 

“I did get to fight a dinosaur.” 

 

“You were hot.”

 

“Thank you.” 

 

A beat. Bucky looks up from his computer. “Why don’t we just kill him?”

 

“What?”

 

“I mean, we solved last year’s problem with murder.” 

 

“...We did do that.”

 

“I killed Klaus.”

 

“See you in Jingle Hell. I remember. It went on the list of reasons I’m in love with you.” 

 

“Aw.” Bucky blinks. “So, we’re killing him?”

 

“Oh, most definitely. He’s a dead man walking.”



They decide that it’s more than a two-man job. Especially, the next day, HammerTech surveyors come into town. 

 

The reception they receive is…less than optimal. Kids throw snowballs. They’re made of ice and rocks, but they call them snowballs, and, really, who is Bucky to correct them? They walk by a barista telling one of the surveyors that they’re entirely out of coffee, sorry, as she serves someone else a large cup.

 

“Do we have time?” Bucky mutters as he and Percy walk down the sidewalk. 

 

“A Girl Scout Troop just walked into the site with hardhats and safety glasses on.” He says. “Some of them are in my classes. They love the preserve. Use it all the time.” Percy hums. “They also just got their advanced electrical engineering badges.”

 

At the edge of town, the entire surveying site goes dark.

 

Bucky leads Percy right into Tony’s lab, where the man himself is standing, back to the door. “Hey, Stark!” Bucky yells. Tony turns and does a double take. “Mr. Jackson? Barnes, did you kidnap my kid’s teacher?”

 

“He enjoyed it.” Bucky dismisses. He strides forward, grabs Tony, a burning intensity in his eyes. “Look at me. Tony, none of this is real. All of this is fake. I don’t even think this is a real town. We’re under the influence of a powerful spell casted by an elf named Tinsel.” 

 

Tony very slowly reaches for his phone and nods. “Yes, we are, Barnes. Yeah. Why don’t you take a seat and tell me more about it.” 

 

Bucky does not do that. He lifts Tony clear off the ground. “Tinsel, Tony. Listen to me. Are you listening? I’m done with this Hallmark matchmaking Hell. No town has this much cheer or charm. Do you understand?”

 

Tony looks over Bucky’s shoulder at Percy, who’s clearly not paying attention. “Mr. Jackson?” Tony gets out.

 

Percy looks up. “Yes. Tinsel. Hallmark.” He confirms. 

 

“Barnes,” Tony says slowly. “I’m going to call your psychiatrist, alright? Everything will be fine. Just calm down. Did you take anything? Any pills, did you drink?”

 

“I’m not high, I’ve been involved in a Christmas matchmaking scheme.” Bucky breathes, eyes alight. “Tony, we’re getting out of here. All of us.”

 

Tony’s eyes are wide, face pale. 

 

“We’re grabbing the others, we’re killing Justin Hammer, and we’re leaving.” 

 

“You want to kill Hammer? Jesus, Barnes, why didn’t you just say so? I’ll get the car.” 



The car ride is quite nice, actually. Percy gets passenger. Bucky goes in the back. 

 

“So, have you snapped out of it, or is this just your natural bloodlust overpowering the spell?” Percy asks politely. 

 

Tony, from the driver's seat, is smiling. He hasn’t stopped smiling since the words kill Justin Hammer had been spoken fifteen minutes ago. “I have no idea what you’re talking about.”

 

Percy hums, going silent as he thinks. There has to be something he can say to get Tony to remember—something that doesn’t fit in this world, but is important enough to be unforgettable. Something that gave him the same rush of feeling as Bucky’s lips on his did. Something he cares about. Not just important, but your entire world.  

 

“Spider-Man.” 

 

Tony turns onto the main road. “What about him?”

 

“Who is he?”

 

“I’m sorry?”

 

“Spider-Man.” 

 

“He’s—he—” Tony falters. “He’s a hero.” 

 

“Oh,” Percy relaxes into his seat. “I’ve never really been into comics.” 

 

“No.” Tony’s voice is distant. “He’s real. I—I know him.”

 

“What, in Westblooms, Vermont? He on the PTA?” Bucky says from the back. 

 

“In New York. He lives in New York. So do I. We—” Fortunately, the road is deserted, because Tony slams on the breaks, tires screeching against the road. “What the fuck?” He screeches. “Where am I?”

 

Bucky grins. “Drive to the school. We’ll fill you in on the way.” 



It’s a day off for the students—the only ones there are for a few sports and activities, including AcDec. 

 

Tony walks right into the empty classroom and grabs Peter. All his friends, sitting in a circle on the floor with flashcards, look extremely confused. “Hi, Mr. Jackson.” Cindy says after a second. “And…you’re the firefighter, right? From the assembly? Mr. Barnes?” 

 

Bucky grins. “That would be me.” 

 

Behind them, Tony quietly talks to Peter. “Hey, kid. Can you do me a favor?” 

 

“Sure!” Peter says immediately. “What do you need? Is everything alright?”

 

Tony looks at the kid— his kid— for a moment. “Do you remember your Uncle Ben?”

 

Peter’s face goes somber. “Of course I do.” He says. “Why?”

 

“Think about him for me. About…what happened to him, about what you did after. You don’t have to say anything. Just…think about it.” Tony prompts gently. He watches as Peter stares at the carpet, his brow furrowing. He blinks once, twice. Then, he looks incredibly lost. “What…” 

 

Suddenly, Percy is there. “Spider-Man.” He says. “Spider-Man and…” 

 

“Iron Man.” Peter finishes without even thinking about it. “Spider-Man and Iron Man.” He looks up at them. “What is that? Why do I know that?” 

 

“Where did you meet Tony, kid?” Percy prompts. 

 

“2010. Stark Expo. He saved my life.” Peter says it immediately, the way he recites answers and natural laws, like it’s one of the simplest facts of life. “Iron Man saved my life. He made me want to be a hero.” Then, the boy goes completely still. His head snaps up and he meets Tony’s gaze. “Oh, my God.” He breathes. Then, he barrels into Tony with a hug. 



Meanwhile, on the other side of the room, Bucky looks at the assembled AcDec kids. “So,” He says after a long moment. “We brought you something.” On the nearest desk, he places a drink cooler and a stack of cups. 

 

The kids don’t even question it. Abe shoves Sally with an out of my way, nerd, and fills a cup. Cindy is right behind him. Bless their hearts, they don’t even ask any questions. 

 

“Essential oils.” Cindy says after taking a sip. 

 

“Dried watercolor paint bricks.” Abe corrects after trying it. 

 

“Lunchable pepperoni.” Betty says, something faint in her voice. 

 

“Subway floor.” Ned disagrees. “Rat poison.” He’s staring at his cup. Then at Peter. Then at MJ. 

 

“Laced grape Fanta.” Charles’s voice is soft. 

 

“...Where did we get that?” Sally says quietly. “It…why do we know what that tastes like?”

 

MJ hasn’t even taken a sip. Her knuckles are white around her cup. Her eyes are locked on Peter. 

 

“Okay, while you’re all in this exact state of mind, I want you to look at Mr. Jackson, over there.” Bucky directs them. “Now, imagine you’re in a school. A different one. The building has collapsed. He’s there, covered in blood, and he’s holding up a giant piece of the ceiling with his bare hands. He has just saved your life. And…”

 

Charles drops his cup. “Holy fuck, our teacher is hot.” 

 

“How have we been learning anything?” Sally is already drooling.

 

“We haven’t,” Abe says, dazed. “Because—” 

 

Bucky points at Betty.

 

“Because that’s not our teacher. He’s not a teacher. He’s a government agent. He’s a Commander with powers and he—” She says.

 

“Carried me after Peter beat the shit out of a Rhino man. He’s stacked. It was like being held by Ti-6Al-4V titanium alloy.”  Cindy finishes. 



Bucky leaves them with their Drink. Their cups will probably catch the drool. Ned and MJ have walked over to Peter. The three of them are having a quiet conversation. Peter is nodding along while also draining their cups of Drink.

 

“What did you do?” Tony whispers to Bucky. 

 

“They just kind of came that way.” Bucky replies. 

 

Percy doesn’t even notice. 



The staff is next. 

 

“Mal, where do you work?” 

 

“Certainly not Party City.”

 

“We don’t have a Party City in Westblooms. Why did you deny that so quickly?”

 

“Certainly not because I secretly have been a manager at Party City for the last few years while also maintaining my top secret government agent job.” A beat. “Wait, what?”

 

“Yeah. Also, I really don’t know how you thought you could keep that one from me.”



“Hey, Dan?”

 

“Yes, strange fireman?”

 

“What’s with the tramp stamp?”

 

“How did you know about that?”

 

“I saw it while you were in the hospital—”

 

“—because I got shot in the ass on a mission. Fuck. Forgot about that.” 

 

“...”

 

“Wait—”



“Ross?”

 

“What’s crackin’, Jackson?”

 

“I told you the next time you said that—”

 

“You’re sending me to work in Lee’s creepy morgue, I know.” 

 

“Correct, though that might be preferable, considering you willingly spend seven hours a day surrounded and outnumbered by thirty teenagers.” 

 

Cue horrified screaming. 



“Hello, Bridgette.” 

 

“Hi! Are you with Jackson?”

 

“Yep. But you already know that, because I told you—”

 

“Never repeat that. I told you to never repeat those words. Ever. I get you’re in love, but never say that about my boss to me again.” 

 

“Boss, hm? Thought you were all teachers.” 

 

“He’s the Commander, Barnes, you know this.”

 

“Oh?”

 

“...Hm”




“Lee.”

 

“Jackson.”

 

He puts a single hand on her shoulder. “You pay taxes here.”

 

“Jesus, Mary, and Joseph.” 



“Hey, Spencer. You’re Lee’s TA, right?”

 

“...Yes.”

 

“Right. So, this is all fake, mutants and aliens are real and waiting for us in the real world.” 

 

“...”

 

“Sorry, let me rephrase: you’re a ginger, the world’s most horrific and unnatural phenomenon. Keeping that in mind, do you really think that aliens and Enhanced are out of the question when you look like that?”

 

“...No.” 

 

“Good talk.” 



They all take a seat in the classroom. The AcDec kids still haven’t closed their gaping mouths, but now they’re looking at the newly assembled SWORD members as well as Percy. Bridgette is quietly soothing a distraught Lee— “We can do some civil disobedience to make up for your good citizenship when we get back, baby, don’t worry—”, Ross is staring at the classroom, horrified, Dan is mistrustfully staring at Bucky, and Mal is giving Percy nervous looks, and Spencer just seems resigned. 

 

“—so, we’ve figured out the secondary plot seems to be the destruction of the preserve. We stop it, movie is over, we get to go home, Questions?” Percy briefs. The AcDec team nods in sync without even processing any of his words. Whores. 

 

“How are we going to stop it?” Bridgette asks politely, one hand still rubbing a very distressed Lee’s arm. 

 

“We’re killing Justin Hammer.”

 

Ned raises a hand. “And we’re sure this is all fake? Killing a famous tech CEO would really mess up my college applications.” There’s a murmur of agreement. 

 

“Well,” Bucky says. “Considering I worked with Brock Rumlow, I’m pretty confident in saying that this isn’t real.”

 

“Who?” Cindy whispers to Peter. 

 

“Hydra guy that Percy killed a while back. He sucks.” Peter whispers back.

 

Tony chokes. “Rumlow is here?”

 

“…Was.” Bucky replies.

 

Tony gives him a fantastic impression of the :/ emoticon. 

 

“In my defense, he did hit Percy.” 

 

Tony squints. “ …Alright.” He relents.

 

Ross breaks in. “Okay, but how are we actually going to do it?” 

 

Percy grins. “First, we need to get some more help, I think.” He turns to Tony. “How is Stephen doing, by the way?” 




After some quick rock, paper, scissors—somehow entirely unrelated to the decision, Bucky’s not really sure what it was for—they split up in the same groups as last Christmas. Well, they plan to. They still need Natasha and Strange. 

 

First things first—Natasha. 

 

“How do you plan on breaking her out of it?” Percy asks quietly as they walk into the station. 

 

“Trust me on this one.” Is all Bucky says. 

 

They get a few wide-eyed looks from Bucky’s coworkers as they walk through the bullpen. Bucky definitely catches a shocked “...Is that guy Barnes’s hostage or something?”

 

Rude. 

 

The breakroom is empty except for Natasha. She looks up when they enter, and something delighted curls over her face when she sees Percy. She opens her mouth, probably to make some sort of comment about him finally making friends or putting himself out there, but Bucky beats her to it. “Hey, Romanoff.” Then, he grabs Percy, spins him to face him. A hand on either side of his face, Bucky yanks Percy forwards and kisses him soundly. Automatically, Percy’s hands come up to rest on his chest, even as a muffled, surprised noise escapes him.  His lips are soft and familiar, he tastes like chocolate chip cookies and something uniquely sweet and God, Bucky loves his boyfriend. 

 

“Fuck, Barnes, are you trying to eat him? Jesus Christ.” Natasha finally says. Bucky breaks the kiss and is treated to Percy’s flushed face and slightly gasping breath. He looks at Natasha, hands still cupping Percy’s jaw. “You remember now?”

 

“…That is certainly hard to forget.” She blinks as it all comes back to her. “Why the fuck did I think you needed to be set up?” 

 

He shakes his head solemnly. “I’m just glad you see the light.” 

 

“Yeah, I’m pretty sure Percy did, too. Were you trying to set a record or something? Do you not need air?” Natasha asks incredulously. Bucky grins, unrepentant, as he waves her off. “Come on. We’ve got a murder plan to carry out.”

 

Natasha doesn’t even ask. She’s one of Bucky’s favorite people.

 

Even though she is definitely making a lot of gestures to the gaping firemen as she follows him and Percy out the front doors. 

 

Natasha thinks he can’t see her stick her pointer finger through the connected pointer and thumb of her other hand, right at the Chief, after pointing to him and Percy. 

 

Natasha would be wrong.

 

…He really does enjoy how Cody chokes on his coffee, though. The Chief also might have passed out. Maria and Landen barely catch him. Johnson and Kelley both drop their stacks of paperwork while Cole gives Cody the Heimlich. 



“…That was your plan?” In the parking lot, Percy finally finds his voice, slightly hoarse.

 

“Yep.” 

 

“…Think we can get Tony and Strange to do something similar?”

 

“…In the name of Christmas miracles, maybe.”



Meanwhile, at the research center, Peter Parker kicks open the door labeled Stephen Strange, MD. Fortunately, the man is there at his desk, because, otherwise, that would have been very awkward. “Dr. Strange.”

 

The man’s eyebrows are raised. “Yes, Peter?”

 

“Oh, you know who I am. That’ll make things easier.” Peter strides into the room. 

 

“…Of course I do. T—Dr. Stark never shuts up about you.”

 

Hm. Momentarily tabling those emotions so he doesn’t start crying in the middle of the plan. That would just be embarrassing. “Do you believe in magic?”

 

“…No.”

 

“Hm. That doesn’t make sense, because you totally do.”

 

“I really don’t, kid. Do you actually need something?”

 

“Just for you to admit you believe in magic and that you also do magic.”

 

“Peter, I don’t.”

 

“Yes, you do.”

 

“I do not.”

 

“But you do.”

 

“But I don’t.” Strange’s teeth are gritted.

 

“You totally do,” Peter sings, leaning further into his space.

 

“I. Do. Not.”

 

“Yes. You. Do.”

 

“Kid, I swear to God, I’m trying to work—”

 

“On your wizard stuff, I know. Because you’re a wizard.” 

 

Strange slams a hand on his desk. “I’m a sorcerer, damnit!” 

 

Peter grins, going silent. Strange blinks, then looks around. Peter watches expectantly as the man takes in his surroundings. Then, quietly, “Wong is never going to let me hear the end of this.”

 

Grabbing his hand, Peter drags him out of the office. “Come on, Mr. Dr. Strange! We’ve got things to do! Christmas movies to escape, CEOs to kill, and you’ve still gotta kiss my dad!”

 

“Yeah, okay— what?”

 

“Don’t even worry about it, actually.” 



“Mission success!” Both Peter and Bucky yell as they enter Percy’s home. Strange’s face is bright red, for some reason. Actually, so is Percy’s. Weird. 

 

Lee, still suffering from the knowledge that they had been paying taxes, had helped herself to Percy’s kitchen and had stress baked some snickerdoodles. The AcDec team is spread out on the carpet in front of the fireplace with Mrs. O’Leary, SWORD team members scattered on the couches and in the kitchen. Tony is helping wash dishes, sleeves rolled up. Strange makes a noise like a dying animal, and Tony looks up. He smiles as the sorcerer. “Hey, Stephen.” 

 

He clears his throat. “Tony.” He acknowledges. Natasha gives Bucky a look, and he nods. She grins.  

 

Well, as long as he’s not her victim anymore. 

 

They stand around Percy’s kitchen, cramped shoulder-to-shoulder. Peter and Natasha, with creepily similar smiles, end up nudging Tony and Stephen to stand next to each other. Percy is pressed up against Bucky’s front, Bucky’s arm around his waist and chin on his shoulder. Lee is supporting both Dan and Bridgette. Peter is holding Ned, bridal-style. Cindy has Charles on her back. 

 

“There’s a survey team—twelve, out in the preserve. Not sure where they’re staying. The inn refused them any rooms, so,” Percy shrugged. “They have a base out on the edge. Nothing big.” 

 

“But,” Bucky continued for him. “Go big or go home, and we can’t really go home at the moment. Thanks to the efforts of our local PTA, Girl Scout Troop, and Native Plant Society, Hammer himself is coming to Westblooms for a press conference about the development.” 

 

Charles, staunch birdwatcher, nods solemnly. “He will not make it home.”



They split up into two. 

 

Tony, Stephen, Natasha, Percy, Bucky, MJ, Ned, and Peter go in one direction, and the SWORD team, plus the remaining loose teens, head for the preserve. Cindy and Charles delegate them Team Silly Goose and Team Serious Goose. None of them really have the heart to argue. 

 

Team Silly Goose—consisting of the SWORD team, Sally, Cindy, Betty, Charles, and Abe, loads up in Lee’s truck and Mal’s Volkswagen. Mal’s car only really fits four, so her, Bridgette, Mal, and Ross get in. Lee drives her truck, Dan in passenger, and Spencer, Sally, and Cindy get in the back. She puts Abe and Betty in the truck bed. 

 

First stop, Bass Pro Shop.

 

The only other person in the store, a large, bearded man in a camouflage jacket, gives them some strange looks. Lee, whom he had to crane his neck to make eye contact with, just nodded at him. He nodded back.

 

Loaded with their bags, they then head out to the preserve, passing some very, very triumphant looking Girl Scouts in hardhats and neon vests on the way. Lee and Mal park on the side of the dirt road, hidden behind a bend. It’s barely four o’clock, but the sun is already dipping low on the horizon, casting long shadows about the trees. They kill their lights, sitting patiently in the darkness. It’s dead silent out, save for the distant rustling of wildlife in the foliage surrounding them. They wait for almost fifteen minutes before the road comes to life, a short procession of trucks speeding past them, going in the opposite direction. 

 

“Jackpot.” Ross whispers. “Alright, everyone out.”

 

The frozen grass crunches quietly under their feet as they creep up the side of the road, approaching distant, blinding lights. Charles makes some very angry, vulgar comments about light pollution and bird migration. 

 

The surveying site is a hastily constructed camp, a circle of trailers and a few canopies. There’s already construction equipment parked nearby. Mal pulls out a flashlight from her Bass Pro Shop bag. “Not everyone left,” She whispers, shining it across the gravel pathway. One of the trailers still has lights on. 

 

“Here, take these Cobra PX650 Pro Business 2W 6-Pack FRS 2-Way Radios with Charging Port.” Ross replies, handing out the radios. 

 

Cindy pokes at hers, experimentally turning it on and off. “Wow, this is a really cool Cobra PX650 Pro Business 2W 6-Pack FRS 2-Way Radios with Charging Port.” 

 

“Right?”

 

“Are we sponsored?”

 

“...No.” 

 

Armed with their radios, they spread out. Dan heads for the largest trailer, a bundle of cords and a USB in his hand, and Charles trails along after him. Mal and Cindy go for the occupied one. Bridgette and Betty go for the nearest abandoned one. Lee and Sally head off to the side, towards the construction equipment lined up against the gravel. Abe, Ross, and Spencer grab another Bass Pro bag and head for the back of the trailers. 

 

“Three, two, one—” Mal whispers through their Cobra PX650 Pro Business 2W 6-Pack FRS 2-Way Radios with Charging Port. Bridgette grabs a rock and smashes the lock of the empty one. Betty stares at her, open mouthed, and the woman grins, tossing the heavy stone in her hands. Charles, hyped up on candy canes, rams his shoulder into the door of another until it gives and grants him and Dan entry. Mal and Cindy just open the door of the occupied one, walking right inside and ignoring the surprised shouts of the person inside. 

 

Dan and Charles head straight for the computer inside the large trailer. Dan pulls out a computer from—well, Charles has no idea where—and connects it to the desktop. Then, to Charles, “Fuck up the rest of the trailer while I do this.” He commands. Charles, constructed of many complex allergies and delicate, pale skin, grabs a sledgehammer and proceeds to have the time of his life. 

 

One trailer over, Betty and Bridgette first go for the cabinets and take every canned good they can find. Then, Bridgette does Betty’s hair in a beautiful braid. Lastly, they crack open the cans with a large meat cleaver and begin to make artwork out of the contents. 

 

In the last trailer, a terrified scientist scrambles back against the wall. “Hey, there.” Mal says, a wild grin on her and Cindy’s faces. 

 

Meanwhile, outside—

 

“Is this enough?” Abe asks. 

 

Ross looks down consideringly. “Eh. A little more won’t hurt.”

 

They look to Spencer, who is asleep in a grass patch a few feet away.

 

Abe pours more fertilizer. 

 

The plants will take over the trailers soon enough.

 

Muffled screaming sounds from the middle of the small trailer circle. Abe dumps the rest of his supplies into the ground and follows Ross towards the commotion. Cindy and Mal are very determinedly restraining a terrified man with wrapping paper. Cindy gags him with a length of candy-striped ribbon. Through mad laughter, Mal calls out to them. “You guys ready to leave?”

 

“We are!” Charles yells, appearing in the doorway of his and Dan’s trailer with a flushed face and wild look. He’s holding a sledgehammer. It’s dented.

 

Betty and Bridgette emerge as well. They have matching hairstyles and their hands are covered in all sorts of tinned foods, similar to kindergarteners after a lengthy finger-painting session. “We’re leaving?”

 

Across the site, there’s the deafening roar of an engine. They all whip around, and are suddenly blinded by an enormous pair of headlights. It’s massive, at least thirty feet tall, and they crane their necks up to stare at the cab. Sally pokes her head out, waving crazily. “Look what we got!” She screams down to them. 

 

“Holy shit,” Ross breathes. “Lee, you crazy motherfucker.” 

 

Lee revs the engine of the construction hydraulic shovel. “Hop in.”

 

They don’t all fit in the cab, but it’s not even a problem, because the majority of them get into a fight about which of them get to ride in the shovel itself, until Lee patiently tells them that it can hold over a hundred tons, and that they can all fit in the hydraulic shovel. 

 

Spencer wanders over, face scrunched with sleep. He pokes his head through the broken window of the trailer Betty and Bridgette were in. “Who broke the window with a can of green beans?” He wonders aloud. Then, “Oh, shit, is that a baked bean and canned corn recreation of René Magritte’s Son of Man?”

 

“Yep!” Betty replies proudly. 

 

He looks around for a second before his eyes land on the giant excavator in the middle of the site. “Oh.” He scales the side of the machinery and slides into the shovel with the rest of them. Then, he looks over to see an unfamiliar, scared shitless man restrained with snowman wrapping paper. “Hey, who’s the new guy?”

 

 


 

 

Justin Hammer steps out of his hotel—the next town over, to his annoyance, because, apparently, every single inn was completely full in Westblooms—to see his limousine waiting for him. The chauffeur steps out and opens the door for him, and he wordlessly gets in. 

 

He pulls out his phone and makes a call to the team lead, telling him to gather everyone and head into town for the press conference. Then, he speaks to his assistant, going over last minute details and practicing the speech he’d had her write for him. 

 

By the time he can relax, they’re already at the edge of Westblooms. His chauffeur takes him through the main road, up to the town’s only public park, where a large stage sits. It’s usually made for community theater and music performances, but it’ll have to do. He’s driven into a side parking lot, and the car is put into park. After a few long minutes, Justin looks up from his phone for the first time. “What’s the problem? I have a schedule to keep.” He demands. 

 

His chauffeur turns around from the front seat to look at him and—it’s a teenage girl. The passenger seat is also occupied, by a boy who looks her age. “Sorry about that, Mr. Hammer.” The girl says, sickly sweet. “We’ll get right on that.” 

 

She gets out of the car. The boy follows and opens the door for Justin. He steps out, giving them a long, annoyed look. God, this is the best this shithole town can do? Two fucking teenagers? He was certain he told his assistant to have his own people brought into town with him, but apparently she’s just as useless as he thought. 

 

The girl pops the trunk. 

 

To Justin’s mild horror, a third person crawls out—another boy, curly brown hair and freckles. “Hey, Mr. Hammer!” He says with a wide smile. 

 

Justin takes a step back from the trio. It’s only then he realizes that they’re not wearing the uniforms for his limousine company. He doesn’t recognize the car, either. He turns, and—his bodyguards aren’t here. 

 

“Come on, then! We can’t be late!” The freckled boy from the trunk chirps, grabbing Justin by the arm and pulling him into the park with a surprising strength. The two other teenagers follow calmly. 

 

The entire town seems to be packed up against the stage, every single one of them in festive sweaters. He can almost smell the holiday cheer emitting from the mass. Justin pulls against the arm tugging him along, but to no avail. Sitting on the edge of the stage, a redheaded woman and a man in a thick green sweater talk quietly. 

 

“Hey!” The girl standing next to him calls. “We got him!” 

 

Suddenly, the crowd is silent, thousands of eyes turning to rest on Justin and his teenage kidnappers. He stops dead, but the boy drags him on further, through the crowd that parts like the Red Sea. 

 

“Is that the preserve douche?” Someone from the crowd yells. 

 

“Excuse me?” Justin exclaims before he can even think twice. “My name is Justin Hammer, CEO of HammerTech!” He says indignantly. 

 

A little girl up front boos him. 

 

“Hey!” He exclaims. 

 

The two at the edge of the stage stand up to accompany the three teens to the center. Another man, broad shouldered and brunet, also joins them. “It’s the emotionally closed off fireman who needs to learn to love!” Someone from the crowd yells again. 

 

The man ignores that last part with a surprising amount of grace. The yells of preserve douche continue. 

 

A group of Girl Scouts at the front of the crowd are practically frothing at the mouth. A cluster of elderly with binoculars around their necks are clutching their canes aggressively. 

 

“So,” A voice next to him says. “You want to chop down the preserve, displace all the natural, endangered wildlife, and turn it into a bunch of cash-grab condos?” 

 

Justin splutters, turning to look at the man. Percy just raises an eyebrow at him. 

 

The crowd begins to jeer. 

 

Justin scrambles for the speech his assistant had written. “Removal of the wildlife will be done cautiously and with minimal harm—” 

 

“What right do you have?” Another voice screams out. “Who are you to take their land?” 

 

“We don’t want you here!” A tiny Girl Scout screams. A group of PTA mothers is scowling at him. 

 

Justin looks around frantically and catches the eye of a man on the edge of the offstage right. “Stark?” He exclaims. “What the fuck?”

 

Tony Stark gives him a mock salute from where he’s reclining against the wall. Next to him, renowned neurosurgeon Stephen Strange is also there, for some fucking reason. 

 

“Show some respect to Dr. Stark!” A grandmother yells, waving her cane. “He is a very nice man!” 

 

Tony goes bright red, and Strange gives him a shit-eating grin. 

 

“This guy is an asshole!” A teenager from the crowd announces. Yells of agreement follow. 

 

“Wants to take our fucking preserve!” 

 

“Ugly fucking condos!” 

 

“Natural wildlife is important, dickhead!”

 

“Viva la native plants!”

 

Justin stammers. “It—the land has been bought. I bought that land.” His voice rises. “It’s my fucking land, now! Get used to it!” 

 

A moment of silence, and then the crowd bursts, anger boiling up and out. Screams overlap each other, accusations and insults hurled from every direction. 

 

MJ, a horrific little instigator. “Should we hit him with the wizard?” 

 

“Wizard!” Someone screeches. 

 

Justin Hammer looks absolutely horrified as the chant picks up. “Wizard! Wizard! Wizard! Hit him with the Wizard!”

 

“Send this fool to the shadow realm!” 

 

“Banish this loser!” 

 

Tony shoved Strange up to the front of the stage. He, too, is chanting. 

 

“…I do not think this is what happens in Christmas movies.” Strange hisses to Tony. Tony just shrugs. 

 

They hear the sudden crash from all around. Westblooms takes a momentary pause from their mob justice to watch as a 30 foot, 500 ton hydraulic powered excavator rolls into the park, a shovel full of screaming teenagers and almost the entire staff of Westblooms High School. With surprising ease and dexterity, the operator lowers the shovel and the occupants hop out. One of them is dragging a man restrained in wrapping paper. 

 

It's silent for a moment before the man in wrapping paper spits out a bright red bow. “He’s an awful boss! Hit him with the wizard!” 

 

Screaming cheers rise up once more. 

 

Stephen Strange sighs, and Justin Hammer is picked up by a glowing tendril of magic and dumped in the excavator shovel. Inside the cab, Lee slowly swivels the excavator, and then presses full throttle on one of the controls. 

 

And that is the story of how Justin Hammer is flung to New Jersey by a 6’9 Norwegian in a Santa Hat. 






“Well,” One of the PTA mothers says. “That was nice. See you all tomorrow?” 

 

Murmured agreement as the crowd begins to disperse. 

 

Then—

 

“Wait!” It’s the Chief. He’s pointing at Bucky. “But did you open your heart for true love?” 

 

“Oh, yeah! Hey! Random guy! Did you fall in love?”

 

“I almost forgot about that! Did you finally break down all those emotional barriers and let someone into your cold heart?”

 

The audible smack of Bucky’s hand to his forehead is heard around the world. “That is so not what this is about!” He yells. 

 

“Uh, it kind of is.” 

 

“Just a little.” 

 

“I mean, that's why I’m here.”

 

“Same.”



Bucky appears to be doing breathing exercises. Then, overtop the crowd,

 

“Hey, Jamie!” 

 

Bucky turns to Percy and is abruptly grabbed around the waist, and, in front of the entire town, dipped and kissed. Thoroughly. 

 

The exploding cheers are overlaid by end credit music. 




 




 

Bucky opened his eyes.

 

Slowly, he pushed himself up. He was sitting on the couch in the common room, his book still on the coffee table.

 

His mug of tea was still steaming.

 

Slowly, Bucky stood, blinking a few times to try and dispel the grogginess. 

 

“That was adorable.” 

 

Bucky whipped around. Fucking Tinsel was still standing there, beaming at him. “I mean, a little insane that you still beat the shit out of that guy before you remembered you were a super soldier assassin, but, still! So cute!”

 

They must see how entirely unamused he looks because Tinsel gives him a sheepish smile. “It worked, didn’t it? You guys are totally in love! You just needed a little push.” 

 

…Fuck. Bucky’s so fucking tired. 

 

He sighs dramatically. “He’s not here, so it doesn’t even matter.” Does he feel bad, manipulating the Christmas spirit? Not at all. 

 

Tinsel claps their hands together. “I can fix that!” 

 

A rush of snow, and Percy in unceremoniously dropped onto the couch. “What the fuck?”

 

Tinsel is bouncing up and down. “There! Now you just gotta show him how you feel!” 

 

Bucky looks at his boyfriend. “Yeah. Yeah, I’ll show him. Later, Tinsel.” He grabs Percy by the waist, hauls him over his shoulder, and walks to the elevator. “Thanks for the help.” 

 

As the elevator door closes, he can hear their voice. “...Well, damn. Wish they were all that upfront.” 

 

Inside the elevator, still slung over his shoulder, Percy blinks. “James, love, what the fuck?”

 

Bucky gives his lower back a pat. “Don’t worry about it, darling. Merry Christmas, by the way.”

 

“...Merry Christmas.”

Notes:

i think i got possessed by mike perry, ceo of hallamark, and also a violent toddler on shrooms
thats the only feasible explanation for all of this

anyways guys meet tinsel

welcome to 60-ish pages of bucky being an absolute fucking simp

i hope you guys know during the scene where bucky and percy meet and i use the words 'his hand flexing once back at his side' i mean like in the 2005 pride and prejudice movie

one of the reasons i really excited to write this is that when bucky and percy actually met there was too much trauma and shit going on for bucky to properly flirt with percy like he so desperately wanted to

bucky: so my name-
percy: I Will Call You James
bucky:
bucky: :)

tony and peter <3 <3 <3

did i put rumlow in here just to kill him again? yes. yes, i did.

bucky, the closed-off emotionally distant guy from the city, and percy, the small town christmas lover who's been burned by love before (lea stole his garlic bread when he trusted her to watch his plate while he went to the bathroom)

i love natasha, the little meddler. shes one of my favorite little guys

bucky and percy being so gay and violent that they break out of the genre

this is also The Knight Before Christmas propoganda. its on netflix. watch it.

"i love you, enough to fall in love with you twice" is my christmas gift to you all

TONY AND PETER IM AFHDSAGHKJDSQHGK

and YES i brought back the Drink from the end of The Lost Soldiers, it has so much power that it elicited the EXACT same reactions from them
bucky is such a shit i love him
SWORD is also little shits and i love them too

bucky just wants to kiss his boyfriend yall pray for him

peter tony bucky and percy all got snapped out of it because of people they love. natasha snapped out because of her matchmaking scheme dedication, and strange out of pure annoyance. love that for them.

i am not sponsored by Cobra PX650 Pro Business 2W 6-Pack FRS 2-Way Radios with Charging Port, for the record

christmas spirit is being gay doing crime and saving native wildlife

lee is not only forklift certified, but can drive pretty much anything with an engine. bridgette always tells her she doesn't need all these certifications. but lee showed her. this was her big day.

spencer just wanted to nap :(

justin 'preserve douche' hammer

for the record, eveyone DOES remember...all this. they just agree to never speak of it.

lastly, MERRY CHRISTMAS AND HAPPY HOLIDAYS! i love you all, and you amaze me constantly! have a great day :)

plumbing baby. goodbye

Chapter 42: lady of the lake? i think you mean leo in the lake

Notes:

(See the end of the chapter for notes.)

Chapter Text

drinking groundwater is good for the soul

 

teletubblees: you need to get dan into protective custody before we all kill him.

 

pj masks: …i need a bit more information to do that, i’m afraid.

 

teletubblees: tell your boytoy to check twitter.

pj masks: dan got twitter?

 

pj masks: i thought we all agreed he couldn’t do that.

 

teletubblees: and yet.

 

 

 

annlis @anli

we need more autistic cunt representation

 

dan @barbielaptop

@user1563632 lol

 

lee @user1563632 

run.

 

 

dan @barbielaptop

caught bridgette jiménez lehey kissing another girl today at 9:34:21 AM

 

bridgette! @lavendarmenaced

Dan, are you referring to my wife?

 

dan @barbielaptop

#exposed

 

bridgette! @lavendarmenaced

You literally cried at our wedding.

 

 

dan @barbielaptop

‘ohhhh my computer has malware’ you mean your free friend????? you’re calling me and complaining about the free tamagotchi????? fuck you @mothmanass

 

mal(practice) @mothmanass

excuse me???

 

 

dan @barbielaptop

i may be an ugly and unlovable bastard in human terms but in gargoyle terms? lets just say i’d be at the top of the cathedral. @rossBOOMni, on the other hand, has a face that demands to be smashed with a sledgehammer in either terms.

 

ross (NOT the one from friends) @rossBOOMni 

i have never felt more violent in my entire life

 

 

dan @barbielaptop 

yo mr white drive me to barnes and noble i need to pick up the newest warrior cats book bitch

 

dan @barbielaptop 

@spencer.st.james

 

spencer :) @spencer.st.james 

what is this supposed to mean?

 

 

 

dan @barbielaptop 

not arguing with a man with a fat ass, like whatever you say cake boss

 

Lee @user1563632 

we all know who this is about, and the fact that you didn’t even try to @ him further lowers my opinion of you. i’ve told him about your account, by the way.

 

dan @barbielaptop

WHAT THE FUCK NO

 

dan @barbielaptop

wait he hates twitter

 

dan @barbielaptop

whats he gonna do lol

 

bridgette! @lavendarmenaced

I don't even feel bad for you.

 

dan @barbielaptop

???? bridgette ????

 

bridgette! @lavendarmenaced

You sent me 37 text messages that just said “girlkisser”

 

bridgette! @lavendarmenaced

Oh, 38, actually. I’m going to speed up the process.

 

bridgette! @lavendarmenaced

@jbarnes

 

dan @barbielaptop

oh.

 

scientists hate this local new yorker @jbarnes

hello, daniel.

 

 

 

centenarian, 30 ton hell puppy, toph from avatar = blended family

 

pb&j: so what did dan do?

 

jamie <3: dont worry about it, love

 

jamie <3: its been dealt with :)

 

pb&j: yeah alright

 

 

 

our family tree is a wreath

 

framk: hey so somebody shoved leo in the lake

 

sparky: oh my god why?? thats so mean

 

RARA: good.

 

pied piper: lmao

 

framk: …you guys are a very odd throuple.

 

pied piper: we prefer to be called an MLM, actually

 

framk: …right. hazel?

 

horse girl: @furbyslayer

 

pied piper: why’d you have hazel do it lazy ass

 

framk: pretty sure that nico and hazel are the only ones he has notifications on for

 

furby slayer: not true

 

pied piper: percy loves us all equally <3

 

furby slayer: i have them on for you as well, frank

 

pied piper:

 

framk: aw

 

furby slayer: i do love you all, but, piper, you send so many fucking memes and they dont even make sense to me

 

pied piper: ok its not my fault you’re like a year older than me but act like you’re EIGHTY

 

furby slayer:

 

framk: hey piper

 

framk: is the idea of eminem throwing a crab funny

 

pied piper: like at someone?? not really??

 

framk: is this picture funny

its eminem throwing a crab, if you cant see this im so sorry but the whole point is that somehow the image is funnier than the description

 

 

pied piper: yeah lmao

 

framk: mhm….

 

pied piper: what

 

RARA: babe…

 

pied piper:

 

pied piper: !!

 

pied piper: so what im hearing is, i need to make my shitposting more accessible 

 

pied piper: got it

 

pied piper: percy love of my life :( why didn't you tell me sooner??

 

furby slayer:

 

sparky: be nice

 

furby slayer: im finding it

 

sparky: percy…

 

furby slayer: my disability was the only thing saving me from your shitty fucking memes for the past couple years and i didnt want to disrupt my peace

 

sparky: PERCY

 

furby slayer: i didnt find it.

 

sparky: yeah no SHIT

 

pied piper: sobbing a little

 

furby slayer: cope.

 

pied piper: still sobbing but now im a little turned on

 

horse girl: piper??????

 

pied piper: what??? god forbid women do anything smh

 

furby slayer: frank, hazel, what did you need?

 

sparky: obsessed with how he’s just ignoring that

 

pied piper: ok mankisser

 

sparky: im sorry?

 

framk: is there anything we need to be worried about in the lake?

 

framk: leo’s just floating in the center and hazel and I need to know whether or not to leave him there

 

furby slayer: he should be fine.

 

pied piper: you heard me you whore

 

sparky: WHORE???

 

pied piper: two girlfriends and you’re still obsessed with another man. WHORE

 

sparky: you have a girlfriend and a boyfriend and you’re still making thirst comments about another man????

 

pied piper: oh so you’re gonna slut shame me?? Huh????

 

RARA: he will not.

 

pied piper: HA

 

RARA: jason is far too sweet to do that. I, however, am a bitch.

 

RARA: and you are a whore. 

 

pied piper: REYNA???

 

pied piper: THATS IT

 

pied piper: OPENING APPLICATIONS FOR NEW PARTNERS

 

pied piper:

 

pied piper: heyyyyyyyy percy

 

furby slayer: do not.

 

horse girl: why are you harassing him

 

pied piper: idk its not my fault hes the ultimate package

 

sparky: wow.

 

pied piper: why are you booing me im right

 

pied piper: pretty eyes, cute dog, always warm and wears soft clothing, strong enough to hold me, can bake, and he’s literally royalty???

 

RARA: 

 

sparky:

 

sparky: heyyyyyyyy percy

 

furby slayer: hi, this is bucky. percy gave me his phone and told me he didn’t want to deal with you people anymore. 

 

furby slayer: frank, hazel, he says you two are the exception and he is very excited to get brunch with you both this weekend. 

 

horse girl: hi bucky! we’re excited to see you two as well :)

 

pied piper: revolting.

 

furby slayer: hi, piper.

 

sparky: please ignore her, she’s normally better behaved than this

 

furby slayer: jason, i admire your optimism, but we both know that is a lie

 

furby slayer: oh?

 

furby slayer: hm.

 

furby slayer: excuse me. 

 

furby slayer: goodbye.

 

mcshizzle: hes so strange

 

mcshizzle: no wonder he and percy work well together

 

horse girl: LEO!!! YOU GOT OUT OF THE LAKE!!!

 

 

 

centenarian, 30 ton hell puppy, toph from avatar = blended family

 

pb&j: why did you give this horrid thing back to me

 

jamie <3: lea is napping and i didn’t want to wake her up but we need to TALK

 

jamie <3: also i muted the chat for you because piper jason and leo started shrieking about something

 

pb&j: i love you so much

 

jamie <3: and yet you didnt tell me you were ROYALTY

 

pb&j: very technically, i suppose?

 

pb&j:  its not like im going to inherit anything so i didnt see why it was important

 

pb&j: sorry

 

jamie <3: dont be sorry

 

jamie <3: this is fantastic

 

pb&j: …why?

 

jamie <3: because shuri keeps winning arguments by calling me a peasant and telling me royalty is always right

 

jamie <3: but now i can tell her that shes the princess of one country, sure, but my boyfriend is the prince of the fucking OCEAN

 

pb&j: i knew you were just using me for my status

 

jamie <3: dont forget your ass <3

 

jamie <3: STEVE ALSO OWES ME MONEY

 

pb&j: babe what

 

jamie <3: we made a bet on whether or not i would be able to seduce royalty one day

 

pb&j: …when was this?

 

jamie <3: 1933

 

pb&j:

 

pb&j: the implication that you seduced me is very bold

 

jamie <3: whats that supposed to mean

 

pb&j: i mean you just had the aura of a sad damp cat in a box in an alleyway and i was like ‘ooh’ and picked you up and took you

 

jamie <3: thats not how i remember that

 

pb&j: yeah?

 

jamie <3: pretty sure my variety of traumas and dashing good looks swept you off your feet and you immediately became obsessed with me

 

pb&j: ill call tony and tell him that you’re still having memory problems again <3

 

jamie <3: fuck you

 

pb&j: see this is why i dont feel very seduced

 

pb&j: you’re kinda mean

 

jamie <3: where are you

 

pb&j: and now you’re threatening me

 

jamie <3: answer the question

 

pb&j: our room

 

pb&j: if you try and attack me i swear to god

 

jamie <3: SWORD has the day off

 

pb&j: is this you trying to make me not call tony about your dementia

 

jamie <3: it is not

 

jamie <3: you don’t have anything to do today, right?

 

pb&j: a meeting at 4, why?

 

jamie <3: cancel it

 

pb&j: ???

 

jamie <3: you said you didn’t feel seduced. cancel your meeting

 

pb&j: jamie its not even noon, my meeting is at 4

 

jamie <3: im very thorough. cancel the meeting.

 

pb&j: ...oh

 

pb&j: canceling the meeting

Notes:

hot take: lee...doesnt really know buckys name. whenever percy talks about him he always calls him either 'jamie' or 'dickhead', some people call him 'barnes' some people call him 'bucky' and she just...never really asked. she didn't learn about american war heroes, okay? she can tell you all about norweigan ones, but shes not entirely sure what exactly sergeant james barnes...did. so she just kind of goes 'your man' or something and percys like 'yeah :)' and it works out for everyone

also the vast majority of these tweets are from SOMEWHERE but for the life of me i cant find the originals, if any of you happen to know where theyre from please dont hesitate to tell me

rip dan

leo in the lake...what will he do...

shuri screaming PEASANT at bucky and he just starts muttering under his breath about socialism

percy: hey so i need to cancel the meeting
hanover: why?
percy: ...
percy: listen...

also can anybody see the image description i put in for the eminem crab picture?? just wondering

plumbing baby. goodbye

Chapter 43: your honor hes literally just a teenage girl

Notes:

(See the end of the chapter for notes.)

Chapter Text

bucky’s victims and also percy’s bimbos

 

moonmoon: [Video Attachment: A girl filming her boyfriend, who’s hair she has tied up in many pink ribbons.]

 

moonmoon: want to do this to him

 

avril lavigne: cindy what

 

tungsten dioxide whats this: im scared to ask who

 

murphy’s law: cindy i thought we talked about this

 

moonmoon: abraham lincoln <3

 

president lincoln: hello?

 

moonmoon: the 6’4 hunk with the on point hat game

 

moonmoon: not you, great value brand abe

 

president lincoln: what the fuck man

 

president lincoln: he wouldn't let you do that anyway

 

moonmoon: YOU DON'T KNOW

 

moonmoon: YOU WEREN'T THERE

 

The News(™): yeah…cindy i don't think the 16th president of the united states would let you tie a little pink bow around him

 

moonmoon: no he totally would you guys just don't see the vision

 

moonmoon: within ten minutes of meeting me he’d have a bow on his hat and he’d be telling andrew johnson how coquette he is

 

The News(™): cindy he was fighting a war

 

moonmoon: you are a WOMAN why are you hating like a MAN

 

moonmoon: betty i am literally just a teenage girl don't take this from me

 

moonmoon: ill siphon your gas

 

The News(™): :/

 

terminator: what are you people yapping about

 

nedleedle: abe

 

terminator: ?

 

nedleedle: the hot one

 

terminator: oh rip 💔

 

terminator: definitely one of the assassinations i regret the most

 

president lincoln: there is a great hatred festering in my heart

 

president lincoln: wait

 

avril lavigne: uhhhhhh

 

Scary Captain: …should you have said that?

 

terminator: what

 

tungsten dioxide whats this: sergeant…did you

 

tungsten dioxide whats this: did you kill abraham lincoln?

 

terminator: probably

 

moonmoon: 💔

 

terminator: sorry cindy

 

tungsten dioxide whats this: I Do Not Think You Were Supposed To Say That

 

terminator: eh

 

Scary Captain: you might want to tell pj that one

 

terminator: ugh i guess

 

murphy’s law: abe are you feeling unsafe rn

 

president lincoln: fuck all of you

 

nedleedle: omg you whore

 

president lincoln: those in glass houses shouldn't throw stones, nedward

 

president lincoln: coughSLUTcough

 

nedleedle: 😦

 

nedleedle: peter come defend me

 

tungsten dioxide whats this: 

 

tungsten dioxide whats this:

 

tungsten dioxide whats this: h

 

nedleedle: peter…

 

tungsten dioxide whats this: ned…

 

tungsten dioxide whats this: i cant tell lies…im a civil servant of the people…

 

avril lavigne: didnt you like blow up a building yesterday

 

tungsten dioxide whats this: first off NO that was not my fault and second off that building had it coming anyway >:(

 

terminator: [Audio Message: “Are all of you fucking stupid? What the actual fuck is wrong with you kids? You go to one of the best schools in the Godsdamned state. Abraham Lincoln died in 1865. James wasn’t even born until 1917. What is wrong with all of you? You’re on an Academic Decathalon team, for fuck’s sake. Are you stupid? Is that it? He didn’t fucking kill Abraham Lincoln. Jesus Christ. Fuck.” ]

 

terminator: so percy says hi

 

The News(™): hhhnng

 

murphy’s law: just moaned a little

 

moonmoon: nothing like an aggravated manhattan accent to kickstart your day and i mean that in the most sincere way possible

 

avril lavigne: yeah so on second thought we definitely skipped a couple decades

 

nedleedle: indeed we did

 

moonmoon: so bucky hasn’t killed any presidents

 

moonmoon: that's good i guess

 

terminator: mmmm no i definitely have

 

terminator: it wasn't abe though i guess

 

terminator: his name was jim or something i think

 

The News(™): bucky did you interfere in foreign elections

 

terminator: yeah all the time lol

 

terminator: pretty sure this one was in america though

 

terminator: everyone spoke english

 

murphy’s law: i don't think we’ve ever had any presidents named jim though

 

terminator: well my memory is pretty solid these days and there was definitely a lot of red white and blue involved

 

terminator: his name was like jim k fonnedy or something idk

 

terminator: maybe he was australian

 

president lincoln: ooh maybe

 

tungsten dioxide whats this: maybe you should tell pj and he should like contact australia or something about it

 

terminator: if australia hasn't said anything, how important could it really be

 

terminator: besides hes busy right now and it looks important

 

 

 

our family tree is a wreath

 

pied piper: ass of tits?

 

my chemical ron weasley: peanus

 

furby slayer: id just like people to stop trying to kill us

 

furby slayer: peaceful retirement? home ownership? raising our 30 ton fluffy daughter? a boyfriend who isn’t easily convinced by a group of teenagers that he killed abraham lincoln?

 

sparky: percy…

 

sparky: lets have reasonable expectations here

 

furby slayer: 

 

furby slayer: peanus

 

 

 

ethically sourced sluts

 

vintage bi: i don't like that look on your face

 

antique gay: rude

 

vintage bi: you have a distinct plotting expression

 

vintage bi: listen i barely smoothed things over with the POTUS facebook account after the last time you had that look

 

vintage bi: are you going to make dumb decisions on the internet again

 

antique gay: i like it when the strangers on twitter validate me, tony

 

vintage bi: attention whore

 

antique gay: really?? ‘I am iron man’ ??? bitch ???

 

vintage bi: yes but i accept and embrace mine

 

vintage bi: please don’t do anything stupid

 

antique gay: im literally just a teenage girl tony

 

vintage bi: …you are a 101 year old man

 

vintage bi: who taught you to say that

 

antique gay: cindy :)

 

vintage bi: dear lord

 

 

 

scientists hate this local new yorker @jbarnes

i believe this is the ‘coquette’ that i have been hearing about

 

[Video: Though the face is cut off, you can see a man standing in front of the camera in a tee and basketball shorts. “What are you doing?” He asks softly.

 

The camera swivels to the left, revealing James Barnes cutting a piece of pink ribbon. “Don’t even worry about it.” 

 

“See, now I’m gonna worry about it.” The man says, but obligingly sticks out his leg when Barnes approaches. Barnes ties the ribbon around his thigh and makes a neat bow. Behind the camera, a teenage girl giggles quietly. 

 

The man just stands there with the bow tied around his leg. “...”

 

“Okay, now just like…flex.” 

 

After another moment, the man does. The ribbon snaps and falls to the ground. Unfortunately, the camerawoman does as well.]

 

You Know Who I Am @TonyStark

I am going to block you one of these days

 

You Know Who I Am @TonyStark

How did you even get him to do that

 

scientists hate this local new yorker @jbarnes

he likes me so he does things when i ask, tony

 

scientists hate this local new yorker @jbarnes

also he's still a little bit in shock about the whole abe lincoln thing

 

You Know Who I Am @TonyStark

The whole what thing?

 

scientists hate this local new yorker @jbarnes

nvm 

 

 

piru @pirepiro

HNNFDSFGDFAHBDSDH

 

annlis @anli

what the fuck what the fuck what the fuck

 

james @jimmyjammy

james barnes i Understand You

 

mimi @wheresmybeans

kicking my feet and giggling my god what the hell

 

bearbi @bearbi3 

biting at the walls of my enclosure

 

Ferris wheel fighter @ihatecarnivals

respectfully 👀

 

 

our family tree is a wreath

 

horse girl: percy? you there?

 

furby slayer: yeah sorry

 

furby slayer: james and those teenagers i was telling you about just wanted me to do something really quick

 

pied piper: ?

 

sparky: odd

 

furby slayer: yeah they were giggling about something idk but then cindy passed out

 

furby slayer: she does that a lot actually

 

framk: does she have like a condition or

 

furby slayer: shes definitely got something

 

furby slayer: shes weird

 

furby slayer: all of peter’s friends are

 

furby slayer: tbh im more concerned about their influence on james than potential hydra plants in the WSC

 

mcshizzle: honestly that seems fair

 

mcshizzle: those children are fucking weird

 

my chemical ron weasley: very much so

 

my chemical ron weasley: also we’re still on for the bird call/voodoo contest today right

 

pied piper: of course

 

sparky: obviously

 

RARA: I will be there.

 

furby slayer: already got time off work

Notes:

unstoppable force (cindy and her undying lust for abraham lincoln) vs immovable object (bucky being convinced he killed him)

bucky, standing trial for everything he did while he was the winter soldier: your honor im literally just a teenage girl
hanover: you're so right. free of all charges

percy, a history guy, vs the acdec kids, stem people

jim k fonnedy

buckys so coquette omg <3

listen...percy has some fucking THIGHS okay. send tweet

percy: so...potential hydra plants could kidnap him and try to bring the soldier back.
percy: these fucking teenagers, on the other hand, are worse.

plumbing baby. goodbye

Chapter 44: the 𝓰𝓲𝓷𝓰𝓮𝓻

Notes:

(See the end of the chapter for notes.)

Chapter Text

SSEA

 

[Tony Stank has added Natasha Romanoff to the chat]

 

Tony Stank: oh i know you did not just laugh out loud

 

Natasha Romanoff: 100% no mr. stank you must be hearing things

 

Tony Stank: i should have left you in wakanda where i found you

 

baby avenger: but ya DIDNT

 

Natasha Romanoff: im shaking a little who named you that

 

percenary: :)

 

Natasha Romanoff: will you consider a marriage proposal

 

skrunkly raccoon: i will rip your transverse cervical nerves out with my teeth

 

Natasha Romanoff: intriguing

 

[percenary has changed Natasha Romanoff’s name to ‘the 𝓰𝓲𝓷𝓰𝓮𝓻’]

 

Tony Stank: he strikes again

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: wh

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: i???

 

skrunkly raccoon: hey guys big life update

 

Tony Stank: oh god

 

skrunkly raccoon: i have decided that i am healed now and should ⋆✮🎀𝓆𝓊𝒾𝓉 𝓉𝒽𝑒𝓇𝒶𝓅𝓎🎀✮⋆

 

Tony Stank: hey how about lets not???

 

percenary: is this about the

 

skrunkly raccoon: YES

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: what

 

percenary: still???

 

skrunkly raccoon: ITS WORSE NOW

 

skrunkly raccoon: STOP LAUGHING I CAN HEAR YOU

 

Tony Stank: some context would be nice

 

skrunkly raccoon: 

 

percenary: ok so basically

 

skrunkly raccoon: do not

 

percenary: the therapist james has to meet with every now and then from the WSC (not linda, linda is great) 

 

skrunkly raccoon: stop

 

percenary: is a Certain Way

 

skrunkly raccoon: perseus achilles jackson i am warning you

 

percenary: and is CONVINCED that bucky is still brainwashed because he keeps saying the minimum wage should be raised

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: im fucking sobbing

 

Tony Stark: oh my god

 

baby avenger: just lasdguhedd so harfdd i hit a buildijgn

 

nedleedle: why did MJ just hit the ground wheezing

 

nedleedle: OH DSJGFJKSHAKJHFKS

 

skrunkly raccoon: thats IT

 

Tony Stank: oh i just heard percy scream

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: yikes

 

baby avenger: damnb

 

Tony Stank: peter are you concussed again

 

baby avenger:

 

baby avenger: mno

 

mindiana jones: as soon as i stop laughing my ass off ill go get him

 

Tony Stank: thank you

 

Tony Stank: kid you have got to stop doing stuff like this

 

baby avenger: i font jnoiw wjhat yorure tlaking abooiut

 

Tony Stank: jesus christ

 

baby avenger: iim doijng famtasdtic

 

nedleedle: ok every time mj stops laughing peter sends another text and it gets her started again and its beginning to scare me

 

nedleedle: she laughs like the joker mr stark sir

 

nedleedle: I Think I Am Going To Go Find Peter Now

 

 

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: should i check on percy? its been a couple minutes now and i can't hear anything

 

Tony Stank: uhhhhhh i mean

 

Tony Stank: be prepared to be scarred for life because every time they get in any sort of altercation, there's a slight chance it ends with them

 

Tony Stank: well

 

mindiana jones: they might be fuckin

 

Tony Stank: they might be yes

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: hm

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: ill take that risk only because i really want to know the rest of that story

 

Tony Stank: godspeed, soldier

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: 🫡

 

nedleedle: i have retrieved the boy

 

nedleelde: [Photo attachment: Peter is laying face down on his bed. Ned has put a blanket over him and is giving a thumbs up]

 

Tony Stank: ned you're the only bitch in this house i respect

 

nedleelde: thank you

 

nedleedle: completely unrelated i am now sobbing

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: mission: accomplished

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: my eyes: not in need of replacement

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: [Video attachment: Bucky is standing on one side of the common room, Percy on the other, a couch in between them. They seem to be having some sort of stand-off. 

 

Percy: Stay away from me, you horrible man.

 

Suddenly, Bucky lunges, clearing the couch, and Percy screeches, backing away. Unfortunately, he does not make it in time, and Bucky pins him, proceeding to dig his fingers into Percy’s ribs. The wheezing, yelping laughter Percy lets out makes Natasha’s shoulder shake with silent laughter. ]

 

Tony Stank: rip percy

 

nedleedle: rip 😞

 

baby avenger: hr wull br missedd

 

Tony Stank: GET OFF YOUR PHONE

 

 

 

spidey @spidey-official 

dude i will never forgive craigslist for banning me after i wrote a post seeking a sworn nemesis. whoever reported that is obviously my nemesis but i was so pissed.

 

spidey @spidey-official 

2k likes for me to go to craigslist headquarters with a mission

 

spidey @spidey-official 

actually, putting that on hold because bucky barnes just laughed in my face and called me a loser for turning to craigslist instead of picking fights in the streets and waiting for one to stick

 

spidey @spidey-official 

he’s not my nemesis but he’s up there now

 

spidey @spidey-official 

and now, to extract my justice, avenge my honor, and fulfill a dying man’s (his boyfriend) wish im going to tell a little story to you all

 

spidey @spidey-official 

Bucky, who spent most of his life helping his best friend get by with his 900 disabilities and illnesses: we don't have universal healthcare by now?

his therapist, making a note that he is still a russian communist:

 

scientists hate this local new yorker @jbarnes

count your fucking days

 

spidey @spidey-official 

what are you gonna do? huh? go after me? a silly sticky little guy? gonna track me down for having a laugh? take your eyes off your revenge seeking boyfriend for a moment and see where it gets you

 

Avengers!!!! @superherostan

SCREAMING

 

piru @pirepiro

Spidey 😭

 

annlis @anli

taking no shit and no prisoners my god

 

james @jimmyjammy

HIS THERAPIST THINKS HES STILL A FUCKING COMMIE DEAR LORD

 

mimi @wheresmybeans

Leftist king

 

bearbi @bearbi3 

im still not over spideys craiglist ad???? what???

 

iron man <3 @starkswife

not the universal healthcare backlash

 

Bblimm @blooo

thats sad but also im dying holy shit

 

Ferris wheel fighter @ihatecarnivals

dfdshjgHDSLKgj;lfkhjsljDFA

 

tony stark stan account @ilovehim

i love it here

 

 

 

our family tree is a wreath

 

furby slayer: opening new boyfriend applications

 

pied piper: OUTTA MY WAY GAYBOY IM BOUTTA GET IT

 

horse girl: what happened

 

furby slayer: i TRUSTED HIM and he TOOK ADVANTAGE of my WEAKNESSES

 

framk: …he found out you’re extremely ticklish?

 

furby slayer: >:(

 

furby slayer: im going to send him back to the shelter

 

sparky: 💀

 

my chemical ron weasley: not the fucking shelter—

 

sparky: he is still alive though right

 

furby slayer: yes 🙄

 

sparky: dont 🙄 me last time thalia tried to tickle you, you bodyslammed her into the bottom of the canoe lake

 

furby slayer: she had it coming

 

horse girl: to clarify, though, you have not harmed your boyfriend?

 

furby slayer: no but im thinking about it

 

furby slayer: as soon as i get free he's dead

 

framk: free??

 

furby slayer: i have been restrained by multiple fluffy blankets and also him

 

pied piper: percy

 

pied piper: percy is he with you

 

furby slayer: yes

 

pied piper: you literally use text to speech??? he can hear all this???

 

furby slayer: yep

 

furby slayer: i want this smug asshole to know what's coming

 

framk: your relationship astounds me

 

furby slayer: tbh he might not even be listening, he’s on his phone

 

furby slayer: hey whats that supposed to mean

 

framk: love you to death, you have very strange taste

 

furby slayer: rude

 

framk: wade wilson, percy??

 

furby slayer: not seeing the problem

 

sparky: percy’s type is Person With A Blade

 

horse girl: thats not true!!

 

furby slayer: i mean

 

furby slayer: my standards are apparently MUCH LOWER THAN I THOUGHT THEY WERE

 

my chemical ron weasley: did you yell that last part at him

 

furby slayer: yes

 

furby slayer: bastard is ignoring me

 

 

 

 

scientists hate this local new yorker @jbarnes

my boyfriend doesn't use pet names as much as i do, which is very funny because i will crack my little gay knuckles and say some shit like “good morning my world, my life, my darling love and my whole heart” and mean it with my chest and he will reply “hello james”  i love him so much

 

 

our family tree is a wreath

 

furby slayer: hes tweeting nice things about me again

 

furby slayer: fucking asshole

Notes:

percys main weakness 😔

shout out to mj's joker laugh

breaking: local teen seen dragging spider-man off the pavement; "he'll be fine guys i swear"

free my man percy, forcibly burrito-ed in three very soft blankets and being held by his boyfriend (he's in time out)

percy, dictating each threat outloud to his phone: >:(
bucky, holding him with one arm and tweeting with the other: kicking my feet and giggling

 

credits to the people who's posts i have appropriated:
thecyndimistuff on tumblr
shock on tumblr
literalyaflame on tumblr

plumbing baby. goodbye

Chapter 45: pribe ❤️🏳️🌈

Notes:

(See the end of the chapter for notes.)

Chapter Text

NYC Pride @pridenyc

The annual NYC pride event will be held today, starting at 11:00! Vendors list and performance schedule linked in bio! We hope to see you there!

 

bider-man @spidey-official

some friends and i will be keeping an eye out to ensure the safety of everyone attending! happy pride :) 

 

bearbi @bearbi3 

no cops at pride just spidey :)

 

mimi @wheresmybeans

and maybe the avengers????

 

tony stark stan account @ilovehim

begging for another tony stark body glitter era appearance

 

 

SSEA

 

Tony Stank: are you guys all ready?

 

skrunkly raccoon: yes

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: yep

 

baby avenger: yessir!! i am crouching menacingly above the streets!!! i have a cape now!!!

 

gitc: its true we took pictures he looks pretty sick

 

mindiana jones: its a sick ass cape

 

Tony Stank: percy? 

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: is the sword team with you?

 

skrunkly raccoon: he was lured in by an ice cream cart

 

skrunkly raccoon: he’s food motivated <3

 

skrunkly raccoon: wait this’ll be easier for everyone

 

 

James Barnes has added Tony Stark, PJ, Natasha Romanoff, Peter Parker, Ned Leeds, Michelle Jones, Lee Van Keppel, Bridgette Lehey, Daniel Wén-Campbell, Ross Bunmi, Mal Tanuk, and Spencer St. James to the group.

 

]James Barnes has changed James Barnes’ name to ‘ bucky’]

]James Barnes has changed PJ’s name to ‘percy’ ]

]James Barnes has changed Peter Parker’s name to ‘webs’ ]

]James Barnes has changed Natasha Romanoff’s name to ‘nat’ ]

[Bridgette Lehey has changed Daniel Wén-Campbell’s name to ‘dan’ ]

[See more…]

 

[Mal has changed the group name to ‘chappel roan fans here to attack people’]

 

Tony: is everyone here?

 

lee: yes.

 

webs: so ominous!

 

bridgette: lee and spencer are at an emergency med station with the red cross, dan and mal are sitting on the patio of one of the bars lining the main street, and ross and i are in the crowd :)

 

nat: in the crowd as well

 

bucky: so are percy and i

 

ned: mj and i are taking pictures by the park

 

Tony: you better get a cute one of me

 

mj: the rainbow accents of the suit are very visually compelling, i’ll give you that

 

Tony: thank you

 

 

 

Avengers!!!! @superherostan

RAINBOW IRON MAN SUIT! I REPEAT, RAINBOW IRON MAN SUIT

 

piru @pirepiro

SPIDEY GOT A CAPE!!!!!

 

annlis @anli

dropped my water bottle and the BLACK WIDOW picked it up and handed it to me. I need immediate medical attention. Oh my fucking god. She's so fucking fine guys. Oh my god.

 

 

 

 

chappel roan fans here to attack people

 

webs: i have a gun now!

 

Tony: WHAT

 

webs: took it from an angry man :)

 

ned: peter that was a police officer ❤️

 

webs: i don't care ❤️

 

Tony: pete i swear to fucking god

 

webs: mr stark!!! he was being a little bitch!!! he kept being mean to the others!!!

 

webs: he was harassing this one store owner and when i stepped in he started yelling at me and said my cape was ugly :(

 

bucky: so hes mean AND a liar

 

webs: and then he kept telling me that it was his job to be here even though he was trying to shove his way into a privately owned queer business that was literally just vibing

 

webs: and i told him it wasn't his job to be here, and he said it was, and when i asked him if he was a boykisser like me he got real mad

 

Tony: and then you took his gun?

 

webs: and then i took his gun ❤️

 

dan: checked with the local PD and yeah that guy was absolutely not supposed to be there lol

 

dan: congrats on the free gun spidey

 

webs: thank you!!

 

 

 

bearbi @bearbi3 

spidey if you’re seeing this you have unlimited free cupcakes from my bakery now. you're doing great sweetie. have fun with the gun

 

iron man <3 @starkswife

everyones real brave till spidey gets armed

 

bearbi @bearbi3 

update he took the bullets out and started throwing them at people

 

Bblimm @blooo

its called being innovative

 

bearbi @bearbi3 

he ran out of ammo 

 

bearbi @bearbi3 

he threw the gun

 

bearbi @bearbi3 

someone caught the gun??

 

bearbi @bearbi3 

HOLY FUCK ITS DEADPOOL

 

bearbi @bearbi3 

HE TRADED SPIDEY A SWORD FOR THE EMPTY GUN HE CAUGHT

 

 

 

 

chappel roan fans here to attack people

[bucky has added wade to the chat]

 

mal: omg????

 

mal: deadpool at pride?????

 

bucky: you’re surprised?

 

mal: ok sorry that infamous mercenary deadpool hasn’t made his position on homosexuality clear???

 

percy: his position on homosexuality was in my bed.

 

percy: hello, wade

 

wade: percy!!!!!!

 

ross: 

 

bridgette: 

 

dan: 

 

wade: we were just close like that 🥰

 

Tony: 

 

Tony: wait.

 

Tony: percy…

 

mj: holy mother of god

 

Tony: you said you were friends with deadpool.

 

Tony: friends.

 

ross: WHAT THE FUCK WHAT THE FUCK WHAT THE FUCK

 

wade: 🍆

 

 

 

Ferris wheel fighter @ihatecarnivals

just saw tony stark walk into a lamp post lol

 

tony stark stan account @ilovehim

thank god for that suit protecting his beautiful face

 

 

 

chappel roan fans here to attack people

 

ross: BARNES???

 

bucky: nice to see you again, wade

 

wade: ♥️ hello you fine specimen of a man

 

dan: ?!???!??!!???!!!!?!?!?!?!!!!?!!

 

lee: evil pansexual

 

wade: omg how did you know!!

 

lee: smart

 

wade: 🤩

 

Tony: …did you just use a stolen gun as a bookmark in One Hundred Years of Solitude???

 

wade: 💁

 

 

 

minions(™)

 

malpractice: guys

 

malpractice: deadpool then barnes. both assassin/merc types with a penchant for weapons, literature, and a brutal sense of justice

 

danimals: oh my god

 

danimals: does this mean jackson has a type?

 

malpractice: i think it means much worse

 

malpractice: i think it means THEY have a type.

 

ross lynch, specifically in teen beach movie: fuck.

 

danimals: so what im hearing is we need to keep all these other freaks away from him

 

malpractice: absolutely yes

 

malpractice: barnes buys us mcdonalds after missions, there is no way we can let any potential competition anywhere NEAR jackson

 

 

 

 

mandy @mandapanda

attention all wlw in the area, i think i just met god

 

mandy @mandapanda

so im at @pridenyc and someone next to me tripped and dropped their drink and long story short i got cut by some glass

 

mandy @mandapanda

walked over to one of the med tents to get a bandaid and holy shit guys

 

mandy @mandapanda

this really nice guy led me into the tent and had me sit down, and thank god he did because i would’ve folded so fast

 

mandy @mandapanda

God herself came in. at least 6’7, guys. biceps as thick as my leg. gayest little shag haircut i've ever seen. pulled glass shards out of my leg and i didn’t even complain even though i'm a little bitch who cries when i get flu shots

 

mandy @mandapanda

after she finished she bandaged it and pat my head and told me i did good and hhhhhhghdsjghhooooooly god you guys

 

mandy @mandapanda

stuck around long enough for her to take off her flannel and she had sick fucking tats and those BACK MUSCLES too oh my god

 

mandy @mandapanda

the other guy at the tent definitely noticed my lesbian revelations. so. got laughed at by a ginger. worth it though.

 

 

 

chappel roan fans here to attack people

 

Tony: everyone doing alright?

 

webs: got a churro :)

 

bucky: i am with wade now

 

spencer: our med tent is getting really swamped for some reason that i totally don't know

 

spencer: on a completely unrelated note, bridgette you should come find your wife

 

bridgette: omg i love my wife sure

 

natasha: beat a college GSA in a drinking contest by the park

 

ned: met a dog wearing a pride bandanna

 

ned: petition to put him in the friend group

 

webs: agreed!!

 

Mj: obviously

 

webs: hey there's a guy on my rooftop im gonna go kick his ass

 

Tony: WHAT

 

ned: i think he's high on queer solidarity

 

mj: TOO MUCH TRANS EMPOWERMENT PETER STOP

 

Tony: PERCY STOP HIM

 

Tony: PERCY

 

Tony: FUCK

 

[webs has added dd to the chat]

 

wade: like the boobs?!

 

dd: no. 

 

dd: what?

 

dd: no.

 

webs: it was just daredevil lol

 

dd: stark your child is insane

 

Tony: yeah

 

dd: good cape though

 

webs: 😎

 

 

 

 

 

minions(™)

 

danimals: SOUND THE ALARMS WE HAVE A POTENTIAL INCOMING

 

malpractice: SHIT

 

 

 

piru @pirepiro

went to find lesbian jesus like @mandapanda mentioned and maybe the prettiest femme ive ever seen walked up to her and kissed her and called her corazón

 

piru @pirepiro

some gay people are really out here winning

 

annlis @anli

hhhherfbgjdkabdsHBQVRWADH

 

mimi @wheresmybeans

went to make my pilgrimage and got distracted by a butterfly out front of the tent and the femme one saw it and got excited and it started to fly away so LESBIAN JESUS LIFTED HER ONTO HER SHOULDERS SO SHE COULD SEE THE BUTTERFLY BETTER

 

james @jimmyjammy

and while all the useless lesbians were drooling i took it upon myself to flirt with the ginger twink that was also working there

 

piru @pirepiro

gay excellency at its finest

 

james @jimmyjammy

he also wanted to see the butterfly, lesbian jesus shifted her girlfriend(?) onto one shoulder and put the twink on her other one

 

james @jimmyjammy

in other news im experiencing a brief bout of heterosexuality

 

 

chappel roan fans here to attack people

 

mal: heyyyyy mr daredevil

 

mal: would you say your job is beating people up

 

mal: for no particular reason

 

dd: no. i have an actual job.

 

 

 

 

minions(™)

 

danimals: thank god

 

 

 

 

chappel roan fans here to attack people

 

web: the fact that your unquenchable thirst for justice bleeds into your day job is one of my favorite things about you!!

 

 

 

minions(™)

 

ross lynch, specifically in teen beach movie: FUCK

 

 

 

 

chappel roan fans here to attack people

 

dan: cool cool cool 

 

dan: uh

 

dan: …what are your hobbies?

 

dd: why are you asking me these questions

 

ross: uhhhhh

 

ross: HE THINKS YOURE CUTE

 

 

 

 

minions(™)

 

danimals: WHY WOULD YOU SAY THAT

 

 

 

 

chappel roan fans here to attack people

 

dd: thank you. i will not be giving away any of my personal information.

 

 

 

 

minions(™)

 

malpractice: HE HAS THE BRUSQUE AND STANDOFFISH BUT POLITE MANNER DOWN

 

danimals: LEE BRIDGETTE SPENCER WE NEED BACKUP

 

 

 

 

 

chappel roan fans here to attack people

 

dan: 👍

 

Tony: …okay

 

Tony: hows everyone else?

 

webs: got more churros and my tummy hurts

 

mj: he ate 29

 

Tony: oh

 

ned: it was awesome

 

spencer: med tent good

 

bucky: dd met up with wade and i

 

bucky: he has strong opinions on thurgood marshall’s works

 

 

 

 

minions(™)

 

malpractice: FUCKING SHIT

 

danimals: WE NEED TO KEEP HIM AWAY FROM JACKSON

 

ross lynch, specifically in teen beach movie: he’ll fall in love with jackson so fast oh my god

 

ross lynch, specifically in teen beach movie: we cannot lose our boss to this man

 

danimals: oh god what if he and barnes start fighting

 

malpractice: what if deadpool joins in????

 

danimals: our boss is simply too easy to fall in love with

 

 

 

 

chappel roan fans here to attack people

 

dan: me mal and ross are great

 

nat: won three more drinking contests

 

nat: but i think the important question is

 

nat: how are YOU, tony

 

nat: i see you made a friend

 

Tony: what?

 

Tony: stephen just dropped by for a minute

 

nat: mmmmhm

 

Tony: moving on haha

 

Tony: percy?

 

webs: ruh roh

 

Tony: percy????

 

nat: now that i think about it he hasn’t messaged in like a while

 

nat: like, a long while

 

Tony: this may actually be the worse case scenario

 

Tony: barnes can you please go collect your freak of a man. hes doing things

 

barnes: no i set him loose on purpose he needs enrichment

 

Tony: goddamnit

 

Tony: i asked stephen to do magic to track him down but he said he ‘doesn’t want to go anywhere near that nutcase’ and he ‘doesn’t want rabies’ 🙄

 

mj: found him

 

mj: hey barnes i think you don’t have a boyfriend anymore

 

bucky: goddamnit

 

mj: the drag queens got him like an hour and a half ago

 

mj: i think they want to steal his cheekbones

 

wade: they’re very nice cheekbones, to be fair

 

bucky: shit they are

 

mj: but his eyeliner…its flawless…

 

Tony: barnes just tore off so fucking fast wtf

 

webs: tracking percy down through boyfriend senses alone

 

webs: amazing

 

ned: he is going…very fast

 

webs: spidey sense if it was an ally

 

nat: i feel like keeping you from getting shot makes it an ally

 

webs: oh yeah

 

mj: oh shit he found him

 

mj: DFHEQWKDJBGKJQRBE

 

ned: mj keysmashing?????

 

mj: he absolutely BODIED him

 

mj: full tackle, right around the middle, any linebacker would be jealous, extra points for putting a hand behind his head so he didn't get a concussion, 14/10

 

mj: he is now squishing percys cheeks and telling him he looks pretty

 

mj: drag queens are losing their shit

 

mj: IS THAT KATYA????

 

mj: fuck i love it here

 

dan: to be clear, daredevil is nowhere near him, right?

 

mj: what

 

dan: nothing

Notes:

happy pride im back and ready to ruin your lives 🏳️🌈 (cue thunder)

spidey got a cape and gun. trans rights.

wade being an avid reader is something that is so important to me

sword: jackson is simply too loveable EVERYONE BUT BARNES STAY BACK
bucky is their emotional support parental figure <3

lee and bridgette are the ultimate femme/masc couple. they are so powerful
spencer watching a horde of lesbians drool over his sort of boss is so fucking funny to me
and then him getting flirted with also and escaping to lee because he's a very not functional gay and was turning a concerning shade of pink

nat is just here to vibe and drink. her mere presence keeps people from starting shit

shout out to OwO_Jackolantern for the 'can you please go collect your freak of a man' bit

matt time!! wade time!! stephen time!! everyones here

anyways do i post percybucky smut as a seprate work this pride month yes or no

happy pride everyone! be gay and do crime!!

plumbing baby. goodbye.

Chapter 46: stickers

Notes:

(See the end of the chapter for notes.)

Chapter Text

[James Barnes has been added to the chat]

 

areyoushuriaboutthat: barnes you little bitch

 

areyoushuriaboutthat: what the fuck

 

[James Barnes has changed their name to ‘Bucky’]

 

Bucky: ???

 

Bucky: shuri???

 

areyoushuriaboutthat: i had to find out ON TWITTER

 

Bucky: huh

 

areyoushuriaboutthat: YOU HAVE A BOYFRIEND??? YOU LITTLE FUCKER THIS IS WHY IM HOMOPHOBIC

 

Bucky: you are gay

 

areyoushuriaboutthat: irrelevant! how could you do this to me

 

Bucky: i really thought t’challa would have told you

 

areyoushuriaboutthat:

 

areyoushuriaboutthat: T’CHALLA KNOWS??? YOU TOLD MY FUCKING BROTHER AND NOT ME??????????

 

Bucky: ok well in my defense, he asked like, months ago

 

Bucky: and you’ve been knee deep in off the grid vibranium mines

 

areyoushuriaboutthat: not my fault your shitty phone couldn’t reach me

 

areyoushuriaboutthat: plus you should have figured out how to send me a message via dreams and you know it

 

Bucky: :/

 

areyoushuriaboutthat: so!! tell me everything!

 

Bucky: define everything

 

areyoushuriaboutthat: well a name would be a good place to start dipshit

 

Bucky: you?? dont know???

 

Bucky: the great shuri????

 

areyoushuriaboutthat: stoooop >:(

 

areyoushuriaboutthat: he literally doesn’t exist digitally

 

areyoushuriaboutthat: you're dating a CAVEMAN

 

Bucky: 🥰 yeah 🥰 

 

Bucky: i can put him in here?

 

areyoushuriaboutthat: sure!!!

 

[Bucky has added ‘PJ’ to the chat]

 

areyoushuriaboutthat:: HELLO

 

PJ: hi

 

areyoushuriaboutthat: NICE TO MEET YOU

 

PJ: we’ve already met, actually

 

areyoushuriaboutthat: ????

 

areyoushuriaboutthat: when?

 

PJ: well, to your credit, the first time wasn’t in person

 

PJ: and the second time, you were preoccupied

 

Bucky: please stop being cryptic babe

 

PJ: :(

 

PJ: it was on that video call a while back when you guys were first implementing BARF

 

PJ: and then again when you came to the tower for the first session

 

areyoushuriaboutthat:

 

areyoushuriaboutthat: oh my fucking god

 

areyoushuriaboutthat: BARNES

 

areyoushuriaboutthat: WHAT THE FUCK

 

areyoushuriaboutthat: YOU HOOKED UP WITH YOUR POTENTIAL ASSASSIN???

 

Bucky: listen,,,...,

 

PJ: i didnt do it 🙄

 

areyoushuriaboutthat: YOU ALMOST MADE T’CHALLA PISS HIS PANTS

 

PJ: just him?

 

areyoushuriaboutthat:

 

areyoushuriaboutthat: OK MAYBE NOT JUST HIM BUT

 

PJ: 🥰

 

Bucky: babe???

 

PJ: hehe

 

[PJ has left the group]

 

areyoushuriaboutthat: barnes you are insane

 

Barnes: shuri i feel like you don’t understand

 

Barnes: [Image Attachment: It’s a photo of Percy, stretched out on their bed, early in the morning. Sun from the gap in the blinds rests on his face, casting his skin in a soft glow. He’s smiling softly in the camera’s direction]

 

Barnes: [Image Attachment: Another photo of Percy, this time working out. He’s shirtless. He’s sweaty. It’s a whole thing.]

 

Barnes: i see this and i’m expected to just?? not???

 

areyoushuriaboutthat: ok damn ig

 

areyoushuriaboutthat: …you managed to rizz up the guy who was literally the failsafe to kill you

 

areyoushuriaboutthat: barnes i was a little familiar but not fully familiar with your game

 

 

 

robert <3

 

local milf: lee said ‘i would like to be a clam. i want to be reincarnated as a clam’ and i said ‘i’d still date you if you were a clam’ and she went ‘i dont think i'd be concerned about such matters. i’d be a clam’ and then made clam sounds

 

certified monster fucker: need me a freak like that

 

egg: can you stop being a desperate slut for like. a few minutes

 

certified monster fucker: im going to be so honest with you mal

 

certified monster fucker: i honestly dont think i can

 

class traitor: thats some real bold words from you, mal

 

class traitor: being real critical considering you left for your bathroom break 45 minutes ago

 

class traitor: you’re working at that fucking party city again aren’t you

 

egg: i have no idea what you’re talking about

 

class traitor: you know what

 

class traitor: @supremeoverlordjackson

 

class traitor: permission to use my powers for evil

 

supreme overlord jackson: i’m busy.

 

supreme overlord jackson: granted as long as i don't have to do paperwork. 

 

class traitor: 🫡

 

egg: [Audio recording: “I’m terribly sorry, sir, but for the last time, no, you cannot pay us in stickers. I don’t care how many stickers you have. This is a Party City and—holy shit that’s a lot of stickers. Okay, just…give me those and you’re free to go—don’t tell anyone about this.”]

 

local milf: MAL???

 

thor understudy: that does not seem like a good business practice

 

egg: What

 

egg: HUH

 

egg: i didnt fucking record that

 

egg: DANIEL

 

class traitor: stickers?? really dude???

 

egg: i am going to find you and beat the shit out of you

 

class traitor: shiver me timbers 😧

 

 

 

 

trusted with scalpels

 

doc mcstuffins: lee?

 

doc mcstuffins: how long until they realize i’m in the chat

 

doogie howser, i guess: spencer…

 

doogie howser, i guess: they’re so fucking stupid

 

doogie howser, i guess: you really need to grasp this

 

doc mcstuffins: trust me, the chat is helping

 

 

 

 

robert <3

 

certified monster fucker: im bored now :(

 

class traitor: our father has left us to fend for ourselves 😞

 

local milf: our BOSS is literally doing work at the WSC

 

local milf: you'll live

 

certified monster fucker: no i think i need to do something irresponsible now

 

certified monster fucker: lee!! 

 

thor understudy: bwoah?

 

certified monster fucker: you should bring me a bottle of that evil homebrew shit you make 

 

thor understudy: 👍

 

certified monster fucker: hell yeah

 

certified monster fucker: you guys in?

 

class traitor: duh

 

egg: sure

 

certified monster fucker: bridgette?

 

local milf: …that stuff is like. really strong

 

egg: but lee will be there to supervise

 

local milf: well maybe lee wants to participate

 

class traitor: bffr she used to take that shit to class in a water bottle

 

local milf: ok fair im in

 

egg: omg just had a brain moment

 

 

 

[Mal Tanuk and James Barnes]

 

Mal Tanuk: do you want to come drink with us

 

James Barnes: ?

 

Mal Tanuk: jackson’s gone and i'm betting you’re bored

 

Mal Tanuk: drunk dan and ross are really funny

 

Mal Tanuk: same with bridgette, every fucking time she falls to the ground sobbing about how much she loves her wife

 

James Barnes: sounds wonderful, im in

 

 

 

 

trusted with scalpels

 

doc mcstuffins: this seems like an awful idea???

 

doogie howser, i guess: let it happen

 

doogie howser, i guess: you need credits for your toxicology lab, yeah?

 

doc mcstuffins: oh you are so unethical

 

doogie howser, i guess: i think you mean efficient

 

 

 

 

banned from lithuania :(

 

jello slut: wade i need to bite that man and shake him around with my teeth like a rabid dog

 

(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: oh ?

 

jello slut: hnnnnnngbsfjakjbkv

 

(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: ur little boyfriend ?? or are we talking about spanish formula one ferrari driver carlos sainz again?

 

jello slut: ok first off don't bring carlos into this

 

jello slut: second, little??? that man is not little??

 

(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: i can say that

 

(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: im literally taller than him

 

jello slut: what does height have to do with this

 

(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: 

 

(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: whore

 

jello slut: didnt you literally spend two months catfishing hydra agents

 

(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: and?

 

jello slut: right

 

(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: anyway are you going to have a homosexual seizure or

 

jello slut: he’s so fdehjsgjehgkj i cant help it

 

(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: i mean im not going to disagree due to the fact that i am a person with eyes

 

(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: mans got hella shoulders

 

jello slut: yeah he does

 

(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: did he do something or were you just thinking about him real hard

 

jello slut: oh i left him unsupervised with SWORD

 

jello slut: they got him drunk and

 

(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: supersoldiers can get drunk???

 

jello slut: pretty sure lee fed him the paint thinner moonshine they make, so, as it turns out, they can

 

(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: i would trust lee with my life

 

jello slut: please never talk to lee i dont think it would end well

 

jello slut: [Screenshot attached]

                 jamie <3: freckles u are a very freak and straange. iam deeplu in love with u

 

(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: damn

 

(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: gay people are insane

 

jello slut: wade be so fucking fr you literally texted me while sucking dick the other day

 

(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: oh dont worry im including myself in that

Notes:

shuri and bucky being odd friends is so silly to me

shoutout to that moment in TLS where percy menaces the wakandan royal family for hurting tony's feelings

shuri: gay people truly know no bounds. inspirational

spencer the ultimate chat lurker

'trusted with scalpels' is spencer and lee btw. spencer is doc mcstuffins :)
'banned from lithuania :(' is wade and percy

in case any of you were wondering, this is spanish formula one driver carlos sainz
https://pin.it/2wYGfxPIP
https://pin.it/6EbYLw28F

wade catfishes hydra agents. its canon now

bucky calling percy 'freckles' :)

plumbing baby. goodbye

Chapter 47: halloweenie 3: BIG pumpkin

Notes:

(See the end of the chapter for notes.)

Chapter Text

“Who washed dishes?” Tony’s voice called down the hall. 

 

Bucky looked up from his book. “What?”

 

Tony comes into view, holding two forks in a clenched fist. “All the fucking forks are gone!”

 

“You’re holding two.” 

 

Tony gives him a look. “Yeah, and these are the only two in the whole kitchen. Where are the rest of them?”

 

Bucky shrugs, returning to his book. “I didn’t wash dishes.” 

 

With a dramatic huff, Tony turns on his heel and returns to the kitchen. After ten minutes of pettily loud clanking around, Bucky sighs, slides his bookmark between his pages, and stands up. “You can buy more forks, billionaire!” 

 

“Fuck you!”

 

Bucky snorts and heads to the elevator to let Tony stew in peace. 



Ten minutes later, he finds himself sitting in his and Percy’s apartment, using Mrs. O’Leary’s massive head on his lap as a table. He made it fifteen minutes before he was disturbed. Both his and Mrs. O’Leary’s heads snapped upwards towards the ceiling at the sound of a loud thump from the floor above. A moment later, Bucky heard the elevator stop at his floor—based on how light the footsteps where, it was Peter who stepped out and walked up to his front door. “Bucky?” The boy called.

 

“Come in!” He called back. 

 

Peter, looking disgruntled, walked into the living room. “It’s cold,” He complained. “I was trying to do my homework, and the vents turned on, and I got a tad spooked. Fell right off the ceiling,” He said sadly. Bucky disguised a huff of laughter, then patted the cushion next to him. Peter squeezed between the cushion and Mrs. O’Leary, leaning into her warmth as he balanced a notebook on his knee. “Thank you,” He mumbled into his sweater, half-focused already on his work. 

 

“‘Course, kid.” Bucky said warmly. “I’ll ask Fri about the vents, later.” 



A few rooms away and a couple hours later, Natasha stood in the center of her room, frowning. Her hair was tied up in a claw clip, away from her face, as she surveyed her shelves. “I swear to God…” She said quietly as she scanned each nook and cranny. 

 

She next wandered to her nightstand, where she’d set her phone to charge an hour beforehand. Natasha opened the drawer where she’d put it, and her brow furrowed. There was only junk there—a few of her discarded pens and some change. 

 

“Shit,” She whispered, shutting the drawer and turning to the rest of her room. She had 2048 to play, damnit.




Midafternoon the next day, Percy dropped down face-first onto his mattress with a low groan. It took him a few minutes to move, but when he did, he wiggled under the blankets, smashing his face into a pillow. He had an alarm set to go off in ninety minutes—a damn good amount of sleep, for him. 

 

His eyes slipped shut, and just as he was about to drop off into sleep, someone turned on the shower a floor above him. Percy jolted, then sighed. He must be more tired than he thought, not to realize somebody had been walking around above him. 

 

Usually, stuff like that didn’t bother him. There was always water moving around, in some fashion—if that kept him up, he would have died from exhaustion years ago. It was only big stuff—turning on showers or baths, typically, but even that was the equivalent of Travis Stoll’s annoying habit of sneaking up on people and breathing down the back of their neck. Annoying, yes, but you shivered a little (punched Travis) and moved on. 

 

When he was on the brink of sleep, though, it was enough to break him out of it.

 

He was familiar with everyone's routines to have a vague idea of when they were going to shower, and it typically didn’t overlap with when he tried to sleep, so it was never an issue. He wasn’t going to make it one now, either. 

 

Percy curled onto his side, determined to at least get a few minutes. Also, there was a coin in the sheets, for some reason.



 

Later that night, Bucky leaned forward, squinting at the screen in front of him. He pondered for a moment before making his move. To Craig’s (his Words with Friends nemesis) ‘versemen’, he added on to make ‘bouleversements’. 

 

“Ha,” Bucky said under his breath. “Suck my dick, Craig.” 

 

He closed the computer—Craig was a slow ass bitch, it’d take him a while to respond and take his turn. As he reached up, something bright caught his eye. Bucky rotated his arm. Stuck to the back of his tricep was a small magnet that looked like an apple.

 

Bucky squinted at it, then at the closed computer. “I don’t know how you did this,” He whispered to Craig, “But I was trained by the KGB. I’ll find you.” 




Down in the labs, Tony hunched over a prototype widow bite. He’d been shocked about six times already, but, like, whatever. He was wearing gloves. 

 

He was only on his second cup of coffee—he had one more before Fri snitched and set Percy on him. Tony repressed a shiver. Never again. 

 

Above him, his music abruptly cut off. He paused, looking up, expectant. When Fri didn’t say anything, he called out, “Everything good?”

 

“Fine, Boss.” She said, “Apologies.” 

 

The music resumed, the current song ending with a loud, drawn out note. Then—

 

Crashin', hit a wall—

 

Tony looked up. “What the fuck?” He looked down. "Why is there a penny here?"




Natasha methodically began to put every single item back in the fridge. She’d literally gone to get the vatrushka that morning, and though all her friends were assholes, none of them would eat it when they knew how far out of her way she’d gone to pick it up. 

 

But it wasn’t in the fucking fridge. 

 

Slowly, she glanced at the pantry. 

 

Maybe…




Peter curled up in a ball, knees tucked up to his chest under his hoodie. Well, Percy’s hoodie, but Peter had…appropriated it. It was soft, purple and with a faded design on the front. He pulled out his phone, resting it on his knees. 

 

He scrolled aimlessly for a few minutes, occasionally sending things to his friends. He sent Ned a little dog named Crumpet and then MJ a video of a small child getting hit by a beachball. 

 

Equally enthusiastic responses were received. 

 

A sudden wave of cold hit and Peter screeched. He jumped up—or, well, tried, but his legs were trapped under his hoodie, so he actually just ended up face planting directly onto the floor. 

 

Thank God it was carpet, at least. 

 

Hey, a penny!




Bucky looked down. Letter magnets on his arm. Why were there letter magnets on his arm. 

 

Hoe it read. 

 

“Not polite.”




Percy yawned, leaning over his desk. 

 

“You good?” Mal asked from where she was sitting, perched on his desk with her papers balancing on one of Lee’s books as a makeshift clipboard. 

 

He leaned back in his chair. “Fine,” He waved her off. “Appreciate the concern, though.”

 

Mal hummed and kicked her feet as she continued her paperwork. 

 

His employees were like raccoons, or something. Mal was productive when she sat in odd places, though, so he let it slide. 

 

Later, he tried to take a nap on the couch in his office, but one of his employees must have been having some serious issues, because, holy shit, the toilet flushed like nine times. 

 

“I swear to the Gods,” He whispered. If he had to remind Dan that he’s lactose intolerant, again, he was going to be very upset. 



“Hello?” 

 

“Hi, this is Miranda calling from the God’s Truth Foundation. I’m just following up on your interest form you submitted last week. Do you have a moment?”

 

“Uh, I’m sorry, but I think you have the wrong person.” 

 

“Oh! My apologies. Thank you for your time. Have a blessed day.” 

 

She hung up, and Bucky stared down at his phone. He was fairly sure his number was, like, classified, or something. 

 

Huh.

 

Bucky kicked a penny as he stomped to the next room. 




Tony stared at the top of his mini fridge. He’d sworn he’d brought some cutlery down with the prepped lunch he’d made the other day.

He crouched to take a quick look under the table, then behind the mini fridge. He found some change, but nothing else. He squinted at the tupperware. 




Natasha stared at her bed.

 

Her pillowless mattress stared back.

 

“What the fuck.” Then, “Mrs. O’Leary?”




Peter paced up and down the hallway, eyeing the vents every time he passed one. 

 

“Unacceptable,” He mumbled. “Unacceptable, unacceptable, unacceptable.” He shivered a little bit. 

 

...

 

"Hey, another penny!"



 

Percy dug the butt of his palms into his eyes. “Who is having a bath,” He whispered aloud, “At three in the morning?”

 

Next to him, James slept soundly, despite his phone having gone off at least six times during the night. 




 

“Hello?”

 

“Hi, this is Rhonda from the official church of scientology. We—”

 

“Wrong. Number.” 

 

“Are you sure? Sorry, but it says right here—”

 

Bucky hangs up.





‘I need ya, I need ya, I need you right now

Yeah, I need you right now

So don't let me, don't let me, don't let me down’

 

Tony throws a screwdriver against the wall. “FRIDAY!” A penny rolled across the lab.




 

Her nightstand was gone. 

 

Her nightstand was gone.




 

Peter pulled on his sixth sweater. This one was Bucky’s. He scooched away from the vents.





Percy stepped into the shower. He reached a hand out to turn it on, then paused. “Something feels odd.” He declared.




“Hi, is this James? I’m calling about your car’s extended warranty—”

 

“I don’t own a car!” 






“Okay, something’s wrong.” Tony declared, hands on his hips. “I’ve asked every single person in this damn tower, including Fri, and nobody has any goddamn clue where all our forks went! We have three sets, and I only have the two that were in the sink!” 

 

“They’re just forks, Tony.” Nat said. “The real issue is who the fuck has been moving my shit.” 

 

“What shit?”

 

“Not relevant.” 

 

“I’m sorry?”

 

Another loud thump. “WHY IS THIS TOWER SO COLD?” Screamed Peter, two rooms over. 

 

“Natasha, what are you stashing in my tower?”

 

“Shouldn’t you know?”

 

“Excuse me?”

 

“FUCK ASS BOB?” Bucky read aloud, staring down at his arm. “What is a fuck ass bob?”

 

From the floor, Peter’s muffled voice, “Your old haircut.” 

 

“Okay, that was not my choice—” 

 

Natasha turns to him, points, and says, “Okay, but you still had one,” Then, back to Tony, “You’d know, because you’re the one moving shit!” She accused vehemently. 

 

“I am not!” Tony defended, aghast. “You take that back!”

 

“Oh, yeah? Where have you been all day, then?” She challenges. 

 

Tony stomps into the kitchen and yanks open a drawer, staring at Natasha the entire time. “I’ve been looking,” He slowly enunciates, “for these fucking—” Tony looks down at the drawer. “PENNIES?”

 

Bucky’s head snaps up. “Did you just say pennies?” 

 

“Yes, fucking pennies!” 

 

“Fucking pennies!” 

 

“Who gives a shit about pennies? Where’s my stuff?” Natasha cuts in. 

 

“I don’t have it!” Tony insists at the same time Bucky goes “Wait, what stuff?”

 

“My stuff!” 

 

The elevator door opens with a pleasant ding. 

 

Percy Jackson, soaking wet and with an absolutely foul look on his face, steps out. Natasha, Bucky, and Tony all go dead silent as they stare at him. Reflexively, Bucky wrinkles his nose, sniffing the air. Percy stops in between them and the elevator. 

 

Softly, he says, “I don’t know who did this,” His voice is measured carefully, “But I am not in the fucking mood.”

 

“Is that…” Bucky ventures. “...chicken stock?”

 

“Yes.” Percy says. “Yes, it is, because somebody here thought it would be funny to put chicken bouillon cubes in our showerhead.” 

 

Tony sucks in air through his teeth, and Natasha bites the inside of her cheek. 

 

“I am going to skin someone alive. I smell like chicken.” He hisses, and, wow, he actually looks pretty pissed. Natasha gives Percy a critical look, brow furrowed. “Is everything else alright?” She asks carefully. 

 

Percy flexes his fingers, curling into fists. “I have been trying to take a nap for about three days now,” He says pleasantly. “But I swear to the fucking Gods, every time I’m about to fall asleep, somebody turns on a tap or a shower or flushes the fucking toilet!” Behind them, in the kitchen, an ominous creaking sounds. Percy takes a deep breath and pinches the bridge of his nose. “Jamie, what the Hell is on your arm?”

 

Bucky looks down. “It says fuck ass bob.” He reports. 

 

“And why,” Percy grits out, “do you have magnets that spell out fuck ass bob on your arm?”

 

That gets a scowl out of Bucky, who casts a glare at Natasha. “Great question, because I only know two people capable of sneaking them on without me noticing, and one of them has been busy fighting the plumbing.” He snaps. 

 

Another muffled thump from down the hall. 

 

“Or… three people.” Bucky hisses. 

 

“You better not mean Pete,” Tony says.

 

“Are you really going to pretend this isn’t something he’d do?” Natasha asks. Tony winces. “Peter!” He calls. 

 

A very disgruntled teenager enters the room a moment later, rubbing his shoulder. “Hi,” He grumbles. 

 

“Took a fall?” Natasha asks. 

 

“More like six,” Peter sighs. “Somethings up with the ventilation, I swear, because I keep getting assaulted by freezing wind when I’m trying to relax.” 

 

“On the ceiling?” Tony confirms. 

 

“Yeah, on the ceiling. Where else?”

 

A shrill ringing interrupts them. Bucky yanks his phone out of his pocket and holds it up to his ear. “What? No! No, I, I don’t—I’m not a scientologist! Why do you keep calling me?” He yells into it. Then, he hangs up and stuffs his phone back into his pocket. “What?” He snaps at them. “This isn’t even about me! Peter, sweet, kind child, have you been putting magnets on my arms?”

 

Peter tilts his head to the side. “No? I mean, not to my knowledge.” 

 

“The fuck? Not to your knowledge?”

 

“I be getting into situations.” Peter says with a delicate shrug. “Oh, but now that you’re all here, what’s up with all the glitter?” He asks. “I mean, I love pizzaz, don’t get me wrong, but seriously, I got glitter in my socks! I needed those!”

 

“Wait, needed? Past tense, needed? Why don’t you need socks anymore? What did you do?” Percy interjects. 

 

“Glitter? Seriously?” Tony asks. “Shit, I hate cleaning up glitter.” 

 

“Oh, like you clean,” Natasha says, rolling her eyes.

 

“Well, I’ve sure been cleaning up a lot of pennies recently! Pennies!” 

 

“Oh, my Gods,” Percy says. “There were also pennies in the fucking shower.” 

 

“But my stuff wasn’t?” Natasha tosses her hands up. “Because, at this point, I’d take that.”

 

“What stuff?” Percy and Peter ask at the same time. 

 

“My stuff! It’s missing!” 

 

“Natasha, you do not need cyanide pills right now!” Bucky says, ignoring his buzzing phone in his pocket. 

 

“CYANIDE PILLS?” Tony shrieks. “Natasha! What  the everloving fuck? Why? What are you doing?”

 

A pause. Then, levelly, she responds, “I be getting into situations.” 

 

The buzzing continues. Bucky picks it up, screams wordlessly into it, then hangs up. When he pulls his hand out of his pocket, he’s holding a penny. This time, Percy and Tony scream, one out of rage and the other out of fear. 

 

“Ooh, a penny!” Peter plucks it from Bucky’s hand. “I’ve found twenty six already!” 

 

“Wait, wait,” Percy says, “You know how many there are?”

 

“Huh? No, of course not. I just like pennies. My friends and I are going to melt them down to make a lifesize statue of Mr. Harrington. Cindy will finally stop giving me shit for not contributing enough! This means I get to stop being the group roach!” 

 

“I’m sorry?”

 

“Me too, honestly. It’s a very unfortunate position to be in.” 

 

In the distance, a toilet flushes. Percy clenches his fist so hard his knuckles crack. 

 

“Okay!” Bucky says loudly. “Clearly, something’s up. How about we all take a breather and meet back in an hour.” 

 

“An hour?” Tony repeats. “Barnes, we have two fucking forks in this house and every second that passes my AC/DC is being replaced with the fucking Chainsmokers!”

 

“An hour,” Bucky gritted, “Because I think if somebody doesn’t get some sleep, the tower will get blown up.” 

 

Simultaneously, the group looks at Percy—pissed off, sleep deprived, and smelling faintly like chicken noodle soup—and nods. 

 

“...You can use my shower.” Natasha offers in lieu of agreement. 

 

“Thank you.” Percy says tightly.



Bucky does manage to get Percy to sleep for a total of 45 minutes—accomplished by calling in Mrs. O’Leary and using their combined weights to squish him into the mattress until he fell asleep. 

 

In the meantime, nobody does much, unwilling to risk causing a disturbance and incurring both Percy and Bucky’s wrath. 

 

A sleep-deprived demigod and a protective super soldier was probably the only way this situation could get worse. 

 

Tony sat in the kitchen, elbows resting on his knees, lips pursed and eyes locked on the silverware drawer. Natasha, on the other hand, laid on her floor, surrounded by the rubble of her torn apart room. Peter sat in a pile of pennies. 



They reconvene in the common room. 

 

“We’re establishing alibis.” Tony declares. 

 

“For the last three days?” Percy asked with a frown. 

 

“Last week,” Natasha corrected. “That’s when my phone first went missing.”

 

“I got my first call ten days ago.” 

 

“A fork went missing two weeks ago, too.”

 

They sat in silence for a bit. “Okay, solemn oath time.” Percy says intently. “I swear that I, to my knowledge, haven’t been sneaking pennies into places, magnets onto Jamie’s arm, stealing forks, moving Natasha’s stuff, or fucking with the ventilation. I didn’t put glitter anywhere, mess with Tony’s playlists, sign Jamie up for every fucking call list possible, or fuck with myself via the plumbing. I swear all that on the Styx.” Outside, thunder boomed. Tony’s brows shot up. “Uh, is that the one that—”

 

“If you lied, fate worse than death, blah, blah, blah—I told you I’m not fucking around.”

 

“...Right.” Tony cleared his throat. “I swear all that on the Styx, too, I guess.” 

 

“I swear it on the Styx.” Natasha, Bucky, and Peter all repeated. When none of them instantly died a horrifically agonizing death, they moved on. 

 

“Pepper and Rhodey haven’t been here every day this has happened, and Vision’s been gone the last three weeks.” Tony said. “So they’re out.” 

 

“SWORD hasn’t been here in months,” Percy added.

 

“Neither have my friends.” Peter finished. 

 

“Okay…so we’re looking for someone who can get into the top of the Tower without any of us noticing, including Mr. Radar over there,” Tony said, nodding towards Percy. “Someone who can sneak up on and mess with a supersoldier assassin’s arm, break into a superspy’s room, get into my mainframes, and not set off Peter’s spidey-sense.” 

 

“...”

 

“Well, damn,” Natasha said, leaning back. 

 

Percy’s eyes were narrowed. “Call Strange.”

 

“Stephen?” Tony blinked. 

 

“Yes, you gay bitch, Stephen Strange. Do you know any other Stranges? Call him.”

 

As Tony pulled his phone out, he cast Percy a glance over it. “I don’t think I like you very much when you don’t take naps.” He muttered. 





“You’re being haunted.” 

 

Strange gets five, horrifically identical looks, not dissimilar to how Wong’s iPod looks when it glitches out from all the Beyonce he has downloaded. 

 

“Haunted.” Tony is the first one to speak.

 

“Yeah, haunted.” He confirms. 

 

Wordlessly, Bucky hands Percy a throw pillow. The demigod holds it up to his face, screams into it, and demurely sets it back down on the couch. “Okay.” 

 

“Okay?”

 

“Okay.” 

 

Then, he stands up, phone in hand. Only Bucky and Percy’s sharp ears can hear the conversation that follows. 

 

“Hey, Mal. Can you—yeah—could you get everyone into the bullpen? No, it’s—I’m fine, Mal, thank you for asking. Yes, this is a bit urgent. Thank you.” 

 

“How come he’s all polite now, but when it’s us, he’s making us do death oaths and calling me names,” Tony complained, leaning into the couch cushion. 

 

“Because I’m cultivating a safe and supportive work environment,” Percy says blandly as he returns. “They’re gonna call through Fri in a second.” 

 

Sure enough, a moment later, FRIDAY transfers a video call to the television screen in front of them. The SWORD members gather around the webcam—Dan sitting directly in front, Ross sitting on the desk on the far left, Mal spinning around in her office chair a bit back from the space between them, Bridgette in a chair pulled up to the right, with Lee and Spencer standing behind them all. “What’s crackin’?” Ross asks, popping his gum. 

 

“Tower’s haunted.” 

 

“What?”

 

“Tower’s haunted.” 

 

They all stare for a second. 

 

“Have you perhaps moved any boundary stones recently?” Lee asked. “Messed with the city zoning plans?” 

 

“What? No!” Tony exclaimed. “Why would you even ask that?”

 

“Deildegast.” Lee did not elaborate further. 

 

Stephen takes over. “If I’m right,” He says, “It’s just a plain, old ghost. I don’t know why it's chosen to haunt here, but what you described is the trademark of a fairly weak ghost. Pranks, mostly, that slowly escalate as they settle into their haunt.” 

 

“Can they move around at all?” Bridgette asked. 

 

“Well, a bit, but they usually stay attached to a specific set of people. Why?” Stephen asked.

 

Bridgette shrugged. “All our ‘m’ and ‘n’ keys keep getting mixed up with each other. It’s been pretty frustrating.” 

 

Percy raised a brow, and Dan flushed. “We were just kinda…waiting for you to notice.” He admitted.

 

“I’m blind and dyslexic, why and how would I notice?”

 

Ross raises his hand. “And what is the genitals situation on this ghost?”

 

Tony has to hold Stephen back from opening a portal and jumping the profiler. 

 

“But how do we stop it?” Percy grits out. Stephen, who’s still, and probably always will be, a little wary of Percy, winces. “Well, you’ve gotta find the body, salt, and burn it.” 

 

“You’re fucking kidding me.” Natasha says.

 

“Unfortunately, no.” 

 

Percy wordlessly presses the heels of his palms into his eyes. “And how do we find the body?”

 

“There’s a spell I can cast; it’ll point you in the right direction, but I’ll need something the ghost has interacted with,” Strange mused. “Perhaps—”

 

Peter stuck his hands in his pockets and pulled out a giant fistfull of pennies. 

 

Strange stared. 

 

Peter blinked. “Do you need more? I have more.” To prove it, he stuck his hand in his other pocket, and—yeah, okay, another fistfull of pennies. 

 

“...”

 

“I have some in my room, too.” 




The spell required the penny pile, a few candles (they used the scented ones Percy had picked up on his Target trip with Matt Murdock the prior Halloween), and some borax.

 

“Body finding spell, no borax, no glue,” Mal mumbled as they watched Strange set it up. He drew some funny little shapes with the borax, lit the candles, and did a few hand motions that, to Bucky, seemed similar to finger knitting, only, you know, without the string. 

 

The borax jumped up, swirled in the air a few times, before disappearing in a cloud of hot pink dust. The candles blew out on their own. The pennies remained unaffected (to the untrained eye, for no mortal could describe how those pennies had internally transformed). 

 

“Alright,” Stephen said. “You smell…” He picked up the candle on the left. “Evergreen Mist, and you’re heading in the right direction. Smell…Summer Storm, and you’re going the wrong way. Got it?”

 

“Just to clarify; we’re sniffing out a body?”

 

“The body, and yes, you are. Good luck.” That last part seemed to be mostly directed to Tony. “I’ll be seeing you later.” 

 

“Wait, you’re leaving us to find the ghost?” Peter asked incredulously. “I haven’t watched Ghost Files or Buzzfeed Unsolved in forever! I’m not qualified!” He lamented. 

 

“And you won’t be for at least two years. Body searching is for adults and search dogs, and you are neither.” Tony said sternly. Peter just sighed.

 

“Fuck it,” Natasha muttered. “Let’s just go. Percy, you on sniffer dog duty?” 

 

He sighed. “Well, Mrs. O’Leary is certainly busy, so I guess. How long will this take?” 

 

Stephen shrugged. “Depends how good at sniffing you are. A few hours, probably.” 

 

“I’ll get the shovels,” Bucky groaned. He pointed at Stephen. “We better be back in time for our Halloween party.”

 

“...I suggest you go in costume, then, to save time.”

 

“Oh, fuck you.” 



“Wait, what should I do while you’re gone?” Peter asked. 

 

“I don’t know—penny hunt? Hang out with your friends? Whatever you want, kid, as long as it follows the Code.” 

 

“No significant property damage, no people lost, no people acquired, no toxic substances, no Drink, and no more marsupials.” Peter recited. Tony gave him an approving nod and a head pat.



Fifteen minutes later, all dressed and carrying their tools, they set out. They didn’t get many strange looks, thankfully—it was Halloween in New York, after all. The sun was just beginning to dip towards the horizon, bathing the city in a soft orange glow that matched the color of the trees lining the streets. 

 

Percy led them, taking twists and turns seemingly at random, occasionally stopping or doubling back. Thirty minutes later found them standing in front of a large, wrought iron fence. 

 

“...It’s better than digging one out of a river, I guess,” Tony offered. 

 

“I don’t think it is.” Percy replied flatly.

 

“...Right.” 




“RISE!” Peter screamed. “RISE, MY SON!”

 

“Our son,” MJ corrected mildly as she flipped down her welding mask. “We all contributed to the penny pile.”

 

“Yeah, but Peter brought the ghost pennies,” Abe breathed. “Ghost pennies, MJ.” 

 

Off to the side, Ned feeds a blindfolded Charles an unwrapped Twix bar. 

 

“Left,” Charles announces after a second. Betty, behind him, nods and marks it on a clipboard. 38 consecutive correct guesses. 

 

“FUCK!” Sally screamed. Charles slipped off his blindfold. MJ flipped up her welding mask.

 

“Yes?” Abe asked politely.

 

“My Temu costume was supposed to come today, but apparently, some dipshit decided to stuff cocaine in between my packages, so border control seized it!” Sally waved her phone at them.

 

“Yikes.”

 

“Damn.” 

 

“L.”

 

“Not radical, I fear.”

 

“Oh,” Peter said. “Unfortunate. Penny?” 

 

She took the penny. “Thank you, Peter. You’re the only bitch in this house I respect.” 

 

Ned unwrapped another Twix. “We could run to Spirit Halloween,” He offered. 

 

Sally stood up. “Ned, you’re the other bitch in this house I respect. You and Peter should have respectable babies together.” 

 

“We’re trying to focus on ourselves for a bit,” Ned said cordially. “Anyways. Who wants to come?” 

 

Obviously, the answer was all of them



However, none of them could drive. Cindy was the only one bothering to get a license at the moment, and after she rammed into that preschool soccer field, she wasn’t allowed to be at the wheel for six months. 

 

“We need a responsible chaperone,” Peter said, forlorn. 

 

From the couch, Mrs. O’Leary yawned. 

 

Slowly, the eight teenagers turned to her.

“She seems quite responsible,” Commented Abe. 

 

“Respectable, even.” Added Sally. 

 

They all smiled.






There was something awfully eerie about this whole thing. Which, like, duh, they’re standing in the biggest cemetery in the country, under a full moon, on Halloween, with two shovels and a tarp. 

 

“Well,” Tony said, voice pitched low. “Who wants to go first? Because it’s not me.” 

 

Bucky gave him a nasty look. “Why the fuck are you wearing a suit?”

 

Tony shrugged delicately. “We do have somewhere to be after this. Won’t have time to change.” 

 

“Okay,” Percy said, quiet as the rest of them, picking up one of the shovels. He tested its weight in his hands, rolling the long shaft in his palms by curling his fingers. “But what are you supposed to be?” 

 

“Well, Pep and Rhodey and I have already all been eachother, so we all decided to be Happy.” 

 

“Bet he loved that,” Natasha commented idly, picking up the other shovel. Her gloved hands flexed as she stuck the tip of the shovel into the dirt, using her heel to leverage it down deeper into the earth. Percy followed, beginning to dig on the opposite side of the marked grave. The pale moonlight washed him out, turning the stark crimson of his scarf, once the color of fresh, free-running blood, to a desaturated pale. 

 

“He will.” Tony said, lips twitching upwards in the dim lighting. 

 

Bucky craned his neck to look around, eyes skimming over the rows of gravemarkers; crosses, headstones, and bevel markers, all in uniform rows, the exact same distance apart from the next. A faint breeze blew in, rustling the almost-bare trees and mowed grass. Bucky ducked his chin down a little bit into the rich red fabric of his cloak, hands tucked under his armpits.

 

Natasha huffed, digging out a small rock in the loosened soil. “I could be tipsy by now.” She muttered. “But no.” 

 

“You can get tipsy?” Percy asked sardonically, dropping a shovelful of dirt on his other side. 

 

“I can if that lamppost of yours holds up her end of the bargain.” Natasha snipped back.

 

Percy rolled his eyes. “Lee is not a lamppost, Nat.” 

 

“I’m pretty sure she’s taller than Thor. Thor, Percy.” 

 

He snickered quietly. “Yeah,” Then he muttered something about lame, fake-ass gods and a loser pantheon, all while continuing to dig. 

 

As the minutes ticked by, fog slowly rolled in, clinging to the ground in thick curtains. Bucky cast another look around the cemetery, scanning over the distant fences. Other than the sounds of Percy and Natasha digging, it was almost entirely quiet. 

 

“Gods, this is kind of boring.” Tony whispered, dark eyes reflecting nothing but moonlight. “Graveyards are boring.” 

 

Natasha pointedly dug the sharp tip of her shovel into the dirt, and Tony held his hands up. 

 

“Cemetery.” Percy corrected. “Graveyards are typically attached to churches.” 

 

That got him a few raised eyebrows. He shrugged as much as he could while still moving earth. “Nico.” Was all he offered. 





“Ma’am, I’m sorry, but you can’t take your…uh, what is this?” The manager asked, staring at Mrs. O’Leary with a not insignificant amount of fear. 

 

“Her name is Lea, and she’s my cousin.” Betty deadpanned. 

 

The manager stared. “I…kid, seriously—” 

 

“She has a disorder.” Charles jumped in. “Don’t be rude.” 

 

That got them a tired glare. “Kids, I’m going to have to ask you to leave—”

 

“We’ll sue.” MJ blurted out. 

 

“For what?”

 

“Discrimination…” Peter said slowly. “Against…uh…our aunt…who is…Enhanced? Yeah. Our Enhanced aunt. There’s laws against that, you know.” 

 

“She’s all of your aunt?” The manager repeated. “I’m sorry, Enhanced? You’re telling me this is a person with an enhancement?”

 

Mrs. O’Leary nodded. 

 

The manager stuttered out an apology and backed away. 





Natasha grunted, hauling out another clump. She hauled herself out of the pit they’d dug—about three feet deep. “Alright, I’m tapping out. Supersoldier, you’re up.” She said, tossing Bucky the shovel. He caught it without blinking and took her place, opposite of Percy. 

 

Bucky digs in silence with his boyfriend. He’s been on worse dates, he’s pretty sure. Definitely done worse work—it’s cold, but it’s not Yakutsk, and the digging isn’t wonderful, but this time he’s digging up a body and not hiding one. 

 

“So,” He says, tossing up a shovelful of soil onto the tarp laid over the grass. “What are we doing for Thanksgiving?”

 

Percy’s currently rather short temper is no match for Bucky’s little smile. “You want to brave my family get-togethers this year?” He asks, digging the tip of the shovel into the hard earth. 

 

“‘Course,” Bucky grunts, removing a hard clump of rocks. “Tell me about ‘em?”

 

“Well,” Another shovelful, “My dad’s side—you’ve met some of my cousins. Nico and Hazel like you already, which is a great starting point. Frank and Will like who Hazel and Nico like, so that’s easy. Jason thinks you’re cool purely because I told him you have a first edition copy of the Hobbit—” Getting that back from the Smithsonian was a bitch, by the way, “—and he’s a nerd. Piper is jealous of your hair, so, uh, maybe be careful around her, because she genuinely might try and shave it off in the night to make a wig. Reyna’s a bit tougher, but she respects you, and that’s further than most people get.” Percy says. “Leo tells bad jokes. Don’t laugh at them, please. The Stolls might try and fuck with you, but I’m confident you can handle it. Fight Clarisse if she asks.” He pauses in his digging, dimples flashing as he smiles. “Lea likes you, so that’ll get you further than pretty much anything.” 

 

“Fuck yeah,” Bucky mutters. “What about the other side?”

 

“Surprisingly, that’s the worse side. Paul’s a great guy, but damn, some of the people in his extended family are awful. He’s got two sisters and a brother—the youngest sister’s cool, the other two suck. His dad’s alright, his mom’s…complicated. His uncle is racist as shit, and last year, we told him if he comes back to our house, we were gonna cut his hands off with a meat cleaver.” Percy shrugs. “His grandma’s awesome, though. I think you’d like her. Everyone else is just alright, or I haven’t really talked to them much.” 

 

“Huh,” Bucky says. They’re about five feet deep, now, getting closer to six. It’s been over two hours, the moon having crawled further up into the sky. “Is it at your place this year?”

 

“Fuck no, Mom said she wasn’t hosting ever again. Paul supports her completely on that. It’s at his aunt’s, I think? Not sure yet.” 

 

“Am I allowed to terrorize people?”

 

“Encouraged, meu dengo.” He replied easily. 

 

Bucky laughs quietly, conscious of their surroundings. “Looking forward to it.” 




“I don’t think that was a very politically correct thing to do,” Betty whispered as they wandered into the store. “Isn’t that taking advantage of laws surrounding minority groups? Like claiming your pet is a service animal?”

 

Peter pondered this for a moment. “Well, she is a service dog. Just not mine.”

 

“That’s not the important part, Peter,” Said Abe. “We could get canceled.” 

 

“I think it’s okay. I’m Enhanced and I said it, so…” 

 

“Can’t argue with that, I guess.” 

 

“Sounds right to me.” 

 

“Cool, because I cannot afford to be canceled again.” Betty said.

 

“Betty, you sent Elon Musk messages telling him to go to space so he could die there.” 

 

“...And?”



“Hey, wait—why didn’t we just say she was our service animal?”

 

“All of ours? Our collective service animal?”

 

“What, like that’s worse than all of our aunt?”

 

“...Touche.” 






The clang of the shovel reverberated through the pit as Percy struck something hard. He leaned down, brushing away dirt with a gloved hand. “Coffin,” He reported. 

 

“Thank God,” Natasha muttered. They’d been there for about two hours already, and, even through the arduous task, Bucky was still feeling the late autumn chill, exacerbated by the foggy night. Together, they got the dirt off of the lid, and Bucky pried it open with a deft hand. 

 

The remains were mostly decomposed—thank God, considering how sensitive Percy’s nose was. Pearly white bones stared back at them, gleaming and unassuming. 

 

“Bastard.” Bucky spat at them.

 

Percy leaned down, toeing at a femur. “Thin coffin,” He remarked. “It’s already mostly rotted away on the bottom.” 

 

“Shit, let's just get this over with,” Bucky grunted. “Salt?” 

 

Above ground, Tony hummed. “Two minutes.”

 

“I’m sorry?”

 

“Justin will be here with the salt and the kerosene in two minutes.” 

 

“Who the fuck is Justin?” Percy asked incredulously. Tony shrugged and held up his phone. “I don’t know, but he’s got good reviews, so…” 

 

The cemetery had never been more silent. 

 

Then, suddenly, Percy screams and launches himself at the opposite side of the pit, towards Tony. His fingers dig into the dirt as he begins to haul himself out. “Do you think this is a joke?” Bucky catches him around the middle, holding him back from jumping their friend. ”I’ll fucking kill you!”

 

“Someone’s cranky,” Natasha muttered, leaning on a discarded shovel, eyes on the front gate in the distance. 

 

Percy screamed wordlessly and Bucky tightened his arms. “Hey, let’s not antagonize him, please?” He begged overtop Percy’s rage. 




They went aisle by aisle. Ned got scared by an animatronic and Cindy carried him for ten minutes until he regained consciousness. While Abe was messing with a ouija board on display, MJ came behind him and blew cold air on his neck. He freaked out and hit his head on the corner of a shelf. They had to go to the checkout counter to get a bandaid. 

 

“Uh…” The teenage cashier looked hesitant. “That’s a lot of blood, guys. I…I think I should call an ambulance.”

 

“Don’t you dare!” Betty said cheerily. “We can’t afford that!” 

 

“No, no, he’s—Oh, my God, I think he passed out. I’m calling an ambulance.” 

 

“I will send a bomb to your house.” Abe slurred. 

 

MJ waved a hand. “We’ll lay him down under the animatronic display. The jumpscares will keep him conscious ‘till he stops bleeding like a little bitch,” That last part was said quite pointedly. 

 

Abe groaned, slumped over Peter’s back. “Scratch and sniff my ass,” 





The sudden glow of headlights hit them. Tony covered his eyes, looking away, and Natasha hissed. Long, rounded shadows cast across the grass from the headstones. A car door opened, then, after a long pause, shut. 

 

“Gate’s unlocked!” Tony called out. Picked, more like, but, whatever. The gate creaked hesitantly, and distant footfalls grew closer. Haloed by the left on headlights, a thin, lanky figure approached, a plastic grocery bag in hand. 

 

Justin. Their savior. 

 

The man—barely, really, he couldn’t be older than twenty—stopped about twenty feet from them. “What the hell, man?” He asked, voice drawn out and slow. 

 

Tony shrugged. From the pit, Percy, who’d gone limp in Bucky’s arms, tried to slam his head into the pile of dirt. 

 

Natasha sighed, slinging her shovel over her shoulder and striding towards the unfortunate college student. She held her hand out expectantly, and, delayed, Justin handed over the bag. Natasha peeked inside, and, apparently satisfied, asked, “How much do we owe you?” 

 

Justin’s eyes were tinted red. “Uh,” He drawled out as he thought. “Nothing, my man. Paid in the app.” 

 

Natasha hummed and went for pocket anyway. Out of a fine, leather wallet, she handed the guy a couple bills. She patted him on the chest. “Tip.” Was all she offered. 

 

He gave a lazy thumbs up. “Thanks, man.” He squinted. “You Kim Possible?” 

 

“Sure am,” Natasha called over her shoulder as she strode back to the pit. “And that’s Merlin and Arthur in the grave.” Tony made a noise in the back of his throat, and she tacked on, “Happy Hogan, as well.” 

 

Justin nodded. “Sick. Thanks for the tip.” He gave them an almost incomprehensible salute before trudging back to his car. 

 

Natasha handed Tony his wallet as she walked past him to hand off the bag to Bucky. “Wh—when did you get that?” He asked.

 

She just shrugged. 

 

Tony sighed. “Did you at least grab the small bills? They’re easier to use.” 

 

“Yeah. I’m pretty sure private citizens can’t legally hold $100,000 bills, by the way.” 

 

Tony waved her off. 

 

Natasha leaned over the pit. “You guys doing okay?” 

 

Bucky released Percy, who just sighed and leaned into the dirt wall. “Whatever. Give me the bag.” 

 

She shared a look with Bucky, and then identical shrugs, and dropped the bag. Percy dug his nail into the top of the bag— food grade sea salt, it was labeled—and grabbed a giant fistfull. Unceremoniously, he dumped it atop the ribcage. Bucky soon joined him, eventually just dumping the entire bag into the grave. 

 

Then, they grabbed the kerosene. 

 

Bucky took control of that one. He loved Percy with his entire soul, but with the mood he was in, Bucky didn’t particularly want him to be in control of the fire. He soaked the remains entirely, mixing with the salt in small, coagulating puddles at the bottom of the open grave. 



Back in the costume aisles, Charles was holding up options.

 

“Ghost?”

 

“Lame.”

 

“Witch?”

 

“My sister’s doing that.”

 

“Cher from Clueless?”

 

“Eh. Yellow isn’t my color.”

 

“Pirate?”

 

“I eat way too many grapefruits to have scurvy energy.”

 

“True. It’s a concerning amount. Uh…Flamin’ Hot Cheeto?”

 

“What? No. What?”

 

“Okay, I tried.”





“Alright,” He called up. “I think we’re good!” He turns to Percy and gestures to the top of the pit. “If you please,” Percy sighs and lifts himself up out of the pit. Bucky certainly does not look at his ass as he does it. 

 

Tony hands Bucky a matchbook as soon as he’s on the grass. Bucky strikes one with a special sort of vindictiveness and watches it catch. He drops it into the open grave. For a second, nothing happens, and Bucky’s worried that Tony’s going to have to call some other stoner to go on a Walmart run for them, and Percy’s actually going to kill Tony, which would be a significant downer—especially because Tony’s petty as shit, and would certainly begin to haunt them, which would start this whole issue over again. 

 

The body goes up startlingly fast and sudden—one second there’s just a pit, and the next, a roaring blaze explodes in the open grave. It’s hot, pricklingly so, even from where Bucky’s standing, a few feet away. 

 

They all stand there and watch it burn—Tony thinking about his forks and playlists, Bucky about his arm, Percy about chicken bouillon and naps, Natasha about her stuff, and all of them about glitter and pennies. 

 

Flames lick up the side of the grave, but don’t escape, hissing and spitting and crackling as they consume. 

 

The world around them goes silent, overtaken by the whisper of fire.

 

Bucky sticks out his hands, warming stiff fingers. Eventually, Tony joins him, taking his hands out of his suit pockets and rubbing them together. The moon above casts everything a desaturated blue, but right there, in that little moment, everything is bathed in gold. 

 



Abe, splayed out on the ground, tilted his head to the side, cheek cold against the tile. 

 

A small child holding a Lightning McQueen costume stood at the end of the aisle, staring down at him. 

 

Abe tossed a hand up in a sluggish wave. “And a skibidi greetings to you, young one.” 

 

The child approached. 



“Sally.”

 

“Yes?”

 

Charles wordlessly held up a costume bag. 

 

“...I’m going to kiss you on the mouth. Right now. Come here.” 



“Costume, secured!” Sally exclaimed after the cashier handed back her change. The cashier refused to make eye contact. It was a different one from the one Abe had threatened. Perhaps, for some reason, the original one had gone on break. 

 

Charles bounced on the balls of his feet as their group coagulated near the doors. Peter and Betty both had scorch marks on their faces. MJ, Ned, and Cindy all had a distinctly haunted look in their eyes as they approached from the direction of the bathrooms. 

 

“Where’s Abe?” Peter asked. “I’m assuming he stopped bleeding eventually. Cindy?”

 

“What?” 

 

“...You were watching Abe.” 

 

Cindy threw her hands up. “God, can’t I have a moment to myself! This is the shit Linda was talking about, guys. Boundaries.”

 

“Sorry, Cindy,” They all chorused. 

 

“Thank you.” A pause. “Yeah, I have no idea where Abe is.” 





“Well,” Natasha says, watching the dying bonfire. “Back home, anyone?” 

 

Percy yawned. 

 

“I’m hungry,” Bucky shrugged. 

 

“Yeah, I could eat.” 

 

Together, they grabbed a hold of the edge of the tarps surrounding the open, smoldering pit, and lifted, sending six feet of dirt tumbling back into the hole. It smothered the remaining embers, and, dusting off their hands, the four picked up their shovels and left the site. 

 

As Tony held open the gate for them all to pass through, he paused. “Hey, what’s Pete up to?”







They found him holding hands with a small child, leading him down the aisles. “Oh, hey guys.” He said.

 

“Were there always two of them?” Cindy whispered to Ned.

 

“Don’t think so,” He whispered back. “But I can’t give a definitive no.”

 

“What’s with the pet?” MJ asked. 

 

“This is my son, Carl.” Abe said. “He found me in the plastic swords aisle.” 

 

“Oh, cool. I’m your Aunt Sally,” Sally told the small child. 

 

“Jag vill döda ett stort antal människor,” Carl replied. 

 

“He doesn’t speak English.” Abe explained. “Come along, son. We’re going to a Halloween party.” 



Mrs. O’Leary chaperoned them back to the tower. 





They missed the trick or treaters. By a couple hours.

 

Pepper and Rhodey, in suits identical to Tony’s, were waiting for them. The common room had been decorated; there was a massive skeleton in the corner, mysterious smoke coated the floor, and the whole place was covered in cobwebs. 

 

Stephen sat with the two at the bar, all three holding a colorful drink and, based on how they were leaning in, were having an absolutely insane gossip session. 

 

The elevator opened, and out stepped Tony, Percy, Bucky, and Natasha—three of whom were covered in dirt, and one pristinely clean. Percy’s eyes were half shut. 

 

Stephen took a sip of his cocktail. “Have fun?” He asked languidly.

 

Bucky’s hand clapped down firmly on Percy’s collar. “No.” He said, and he wasn’t talking to Strange. Percy took a deep, meditative breath. 

 

Tony shrugged and went to sit next to Stephen. Without even looking at the other man, he swiped his drink and drank half, then sliding it back to him. “What have you guys been up to?”

 

Stephen’s face now held a distinctly pink tinge as he replied. “Just handed out candy.” Same as last year, he was wearing a cheesy wizard hat—this one, however, was a bright blue with stars, as opposed to last year’s plain black. 

 

Natasha checked her watch as Percy wordlessly pointed to the couch. Bucky huffed, but there was no hiding the slightly pleased look on his face. He sat at the edge, back against the arm of the couch, with one leg stretched across the cushions and the other foot on the floor. As soon as he sat, Percy dropped down next to him, leaned his head on his armored chest, and promptly closed his eyes. Bucky ran a hand through his hair, then draped his discarded cloak over Percy as a makeshift blanket. 

 

Natasha checked her watch again. 

 

The elevator dinged, and Mrs. O’Leary trotted out, followed by Peter and his friends. Abe was in a fireman’s carry over Betty’s shoulder, but was followed by a small child in a Lightning McQueen costume. She deposited Abe on the couch opposite of Bucky and Percy, glancing at them as she did so. “BBC Arthur and Merlin?” She noted.

 

Bucky nodded.

 

“Homos.” 

 

“That’s the plan.” 

 

“Who’s the child?

 

“Carl.”

 

“Jag har en kniv,” Carl said. Bucky blinked. 

 

Peter adjusts his ascot. “I’m Fred!” He chirps. “Charles is Scooby, MJ is Hot Dog Water, Cindy is Daphne, Betty is Velma, and, well, Abe got voted to be Ronald Reagan, to match Sally, but he refused to get into costume, for some reason.”

 

Abe, muffled by Betty’s yellow turtleneck, said, “Ma…pa… just swallered a little lego feller…and I aint feelin’ so good…” 

 

Natasha ignored all of that. “What’s Sally, then?”

 

Sally sighed. “I was going to be Scrappy Doo, because I lost the sudoku tournament we did, but the stuff I ordered is in an FBI warehouse somewhere.” She explained. “But Charles found this for me, which is way better, so,” Sally is wearing a shirt that says ‘If she don’t hawk tua, I won’t talk tuah!’ and pink coveralls tied around her waist. They also say ‘hawk tuah’ on them. 

 

“It’s in an ironic manner,” She says airily as she heads for the candy bowl. “Spirit Halloween had my back. It’s a social commentary.” Charles nodded along solemnly. 

 

“Oh,” Says Tony.

 

Carl goes into the kitchen and begins to poke around the cabinets. 

 

Natasha checks her watch again, then looks up at the elevator. As if on cue, it dings, and the SWORD team comes spilling out. Every single one of them has a distant, war-torn look in their eyes. One by one, they file out, Lee at the lead. He was dressed in a fireman’s coat and hat, and a massive tupperware was tucker under one arm, balanced against his ribs. Next to him, Bridgette, in pink with matching goggles atop her head, waved. 

 

“Thank God,” Natasha muttered as Lee approached her. He held out the tupperware. It was full of something that looked like water, but smelled like paint thinner. She cracked it open, took a deep whiff, then looked up at Lee. “My thanks, friendly lamp post.” 

 

“...Alright,” Lee said. 

 

Ross, dressed in green, a hat with a recycling symbol on his head, plopped down on the couch next to Abe. “‘Sup,” 

 

“They call me Zac the way I be wondering what the Efron with me,” Abe slurred, holding up a hand and waving about. Ross high-fived him. “Fuck yeah, my man.” 

 

Mal, who seemed to be a lifeguard of some sort in bright orange, went straight to the candy bowl, Dan, in high-vis and a hard hat, followed.

 

It was only then they realized the elevator was still open. Spencer stood in the back of it, covered head to toe in a toxic green substance. From what could be seen through it, his outfit was more of a coral-pink than Bridgette’s, lined with blue. His hair has been pulled into two, tiny pigtails, now dripping with green. 

 

“The hell happened to him?” Rhodey asked, leaning over Pepper to get a better look. Bridgette turned, saw Spencer, and sighed. “Oh, come here,” She muttered, grabbing him by the arm and dragging him into the kitchen. From the candy bowl, Mal shook her head. “He got Nickelodeon Slimed.” 

 

“...Why?” 

 

Mal just shook her head, haunted.

 

In the kitchen, Carl is on his tippy toes, trying to reach the stove. “Oh, shit,” Ross says. “Here,” He turns on a burner for the child.

 

“Tack. Jag vill bränna den här staden i en hedonistisk glans av härlighet.”

 

“Oh, you want to make…soup?” Ross stares intently. Carl nods. Ross hums. “I can see if there are any cans in the pantry. Come along, creature.” 

 

Back in the living room, Percy lifted his head blearily. He squinted in Spencer’s vague direction, blinked a few times, then waved his hand, almost smacking Bucky in the face. In one smooth wave, the strange slime slid off Spencer as if it had never been there in the first place. It twisted and turned in the air like a serpent before diving headfirst down the kitchen sink. He laid his head back down. 

 

Stephen scrutinized Percy, as he often did, as Pepper looked to the SWORD team. “And what are you guys?” 

 

“Paw Patrol!” Ross exclaimed. “I’m Rocky, Spencey is Liberty, Lee is Marshall, Bridgette is Skye, Mal is Zuma, and Dan is Rubble.” He explained. “We were going to ask Jackson to be Ryder, but Barnes got to him first.” He shook his fist at Bucky, who looked rather amused. 

 

Eventually, they all piled onto the couches, the floor, and, in some cases, eachother. Dan switches with Ross and begins to make soup with Carl. It’s chicken and stars soup. As the rest of them turn on Clue, Dan gives Carl soup in a small plastic cup. “We’re lucky you only needed a spoon,” He says, “Because for some fucking reason, I can’t find a single fork.” He says, bewildered. 

 

“Don’t cuss in front of the kid!” Bridgette calls from the living room. 

 

“Denna soppa gläder mig.” Carl says, taking a sip of his soup. “Olycklig. Jag kommer att sakna dig när du tas.” 

 

“I think he likes the soup, guys.” Dan says. 


Percy, still half asleep and burrowed into Bucky, lets out a small huff of laughter at the movie. Bucky’s carding a hand through his hair, nails lightly scratching at his scalp. The demigod is putty in his hands; a warm weight on his chest. 

 

A soft round of laughter at a dramatic scream on screen. 



Dan leads Carl into the living room, letting him take his pick of seats. Carl ends up sitting on the other side of Mrs. O’Leary, completely dwarfed by her.

 

Carl points at the screen. “Den här filmen är humoristisk, men orealistisk. De kommer inte att kunna hitta vad som hände med er alla.”

 

Percy, for the first time in two hours, sits up a bit. He clicks his tongue against the roof of his mouth and leans over to Carl, swiping a discarded—but clean—napkin over the kid's cheek. “Bit of soup,” He says before laying back down. Carl gives him a wide-eyed look. “Hur pinsamt. Mitt tack för att du förhindrade den indigniteten.” He blinks round eyes. "Din halsduk är en behaglig röd färg. Jag gillar det ganska. Du har också en visuellt slående symmetri i ansiktet. Jag är benägen att skona dig i min nya värld.”

 

The movie plays on. 

 

A solid five minutes later, Lee speaks up. “Gud, du er en merkelig jævla gutt. Hvor fant de deg i det hele tatt? Faktisk bryr jeg meg ikke.” 

 

Carl’s eyes widen as he stares at her. Lee raises a brow at him. “Ja, jag kunde förstå dig hela tiden. Svenska och norska är väldigt lika språk. Jävla med min skit så slänger jag dig från det här tornet. Förstår du mig?”

 

“Jag förstår.”


“Bra. Happy Halloween.”

Notes:

hi. im aware its been like three months. my bad.

happy halloween!

plumbing baby. goodbye

Chapter 48: turkey time

Notes:

(See the end of the chapter for notes.)

Chapter Text

Jenny’s fucking turkey was burning. Percy could smell it burning. He liked to close his eyes and pretend it was her. 

Bucky closed the car door, coming to stand next to Percy at the edge of the obnoxiously long driveway. Bucky squinted up at the house, hands stuffed in his coat pockets. “Shit,” He muttered.

Percy sighed. “Yep,” He muttered. 

“You think with…Tony, and all that, this would be less shocking.” 

“Somehow, billionaire philanthropist is less unsettling than suburban upper middle class.”

Bucky whistled lowly as he took in the house’s brick face. Shuttered windows symmetrically line each side of the French double doors, bracketed by white columns that support a balcony directly above the front steps. Sculpted bushes lines the short ascent to the house, set aside from the path by brick curb. 

“We can always turn around and go to McDonalds,” Percy said under his breath. 

“Christ, what happened to supporting your mom and helping Lucas get to know Paul’s family?” Bucky snarked. “This was your idea, baby.” 

“Fuck, it was,” Percy muttered. “Whatever, let’s go. Paul texted—they got here half an hour ago.” 

Bucky hefts the bag over his shoulder, taking in the host of other cars in the circular driveway. “Fashionably late, then?” 

“Sure,” Percy takes his free hand. “We can go with that.” 

 

Bucky’s first impression is how white everything is. The tile, the walls, the ceiling, and the furniture, save for some natural wood accents, in the same pale, eggshell white. Even the bulbs in the small chandelier hanging over the table in the middle of the foyer is white rather than a warm, yellowed tone. There’s a staircase curling around the back of the room, an open arch leading to a door to the yard straight ahead, two doors to their left, and one to their right. 

 

Percy takes them left, through a godsdamned butler’s pantry, then turns through another door, which opens up into the kitchen. Again, it’s all the same color; white cabinets against white walls. Dishes cover the main island—two covered casserole dishes, one that smells like sweet potatoes and the other like green beans, three pie dishes; pumpkin, apple, and pecan, and a pan of rolls. There’s a massive pot with a lid on, the burner beneath on low, full of mashed potatoes, and another with gravy. In the oven, a massive tinfoiled turkey is still cooking. 

Bucky’s nose twitches. “It’s—” 

“Burning,” Percy agrees quietly. “And yet, part of it is quite undercooked. Let it happen.” 

There’s a loose group of women standing in the kitchen. Based on the mission briefing he was given, Bucky can identify the targets. 

Marie Jenson: cousin to Paul Blofis, HR manager. A tad obnoxious. Spoils her kids. Brought the sweet potato casserole. Married to John. Children; Hunter and Mackeyleigh. Undetermined.

Nina Blofis: younger sister to Paul Blofis. Public librarian. Currently looking quite annoyed. Brought the apple pie. Married to Gabriel Blofis, who took her name—this caused a bit of a stir with some of the older family members. Potential ally. 

Jenny Price: older sister to Paul Blofis. Registered nurse. Married to Ryan Price. Has two children, Layla and Andrew. Encouraged them both to pet Mrs. O’Leary in her service dog vest last time Percy went to Thanksgiving. Enemy. 

 

Nina is the first to see them. “Oh!” She exclaims, putting her wine glass down and rounding the island to give Percy a short, half-hug. “It’s good to see you, darling!” She exclaims. “How have you been doing?”

He smiles back at her. Though his eyes are hidden behind sunglasses, Bucky is fairly sure they’re crinkling in that way they do when he’s genuine. “Just fine, Nina. Thanks.” She turns to Bucky. “Oh, and you must be James!” She sticks her hand out. “I’m Nina, Paul’s sister.” 

I know. I have your employment history, report cards, and a copy of your driver’s license, Bucky does not say. Instead, he shakes her hand. “That’s me,” He says. 

Nina gives them both another wide, red-painted grin. As she turns away from them, she gives Percy’s arm a quick squeeze, whispering nice one! to him. Percy, knowing Bucky’s enhanced ears easily picked that up, gives him a lopsided grin. 

 

“Jenny! Marie!” Nina sings. “Percy’s here with his boyfriend!” 

As expected, Jenny’s face is a little tight. “Thank you for coming,” She says, perfectly pleasant-sounding to anybody but the two men in the kitchen. “I see you brought drinks?” 

Bucky puts the bag on the counter. “Help yourself.” He says, making direct, prolonged eye contact. She shifts and looks away.

Victory number one. 

Marie gives them both a small greeting, but seems preoccupied with draining her heftily filled wine glass. 

Nina begins putting bottles in the fridge. “Everyone else is out back, I think!” She says over her shoulder. “Sally, Paul, and the rugrats, definitely!” 

“Thanks, Nina!” Percy calls, taking Bucky by the hand and tugging him in the direction of the main back doors—because there are multiple back doors, of course. 

A long, paved path snakes its way through trimmed bushes and pruned flowers, splitting off into two; one to a heated, in-ground pool, and the other to a shaded gazebo, which shelters a few tables and a crackling firepit.

Estelle and Lucas are in the pool—playing mermaids, Bucky’s pretty sure. They’re joined by a girl a few years older; Carmen, age eleven, daughter of Eliza and Michael Blofis, Paul’s older brother. Sitting at the edge of the pool is a boy; Andrew, age fourteen, son of Jenny and Ryan Price. He’s got headphones on, connected to the handheld console a few inches from his face. In a lounge chair under the shade of a tree is his sister, Layla, age seventeen. She’s got a book and is bundled up in a thick sweater. 

Based on his intel, there should be two more children, Hunter and Mackeyleigh. He’ll have to keep an eye out, in case of potential ambush. 

There’s a large table set up under the gazebo, fairy lights hanging overhead from tree branches. The small fire pit is set up adjacent to the head of the table. At it, Sally sits with John, Marie’s husband, and Cynthia, Paul’s mother. She’s got a smile on her face, but a guarded look in her eyes. A masterful opponent for the two unsuspecting civilians. 

Paul himself is standing by the firepit with Michael, his brother, and Ryan, his brother-in-law. Paul looks about two minutes away from smashing his glass over their heads. 

Percy heads to his mother first, dipping down and pressing a kiss to her cheek. “A vodka está no frigorífico,” He says quietly. “Nina won’t snitch.” 

Sally laughs. Her eyes crinkle the exact way Percy’s do. “É bom saber. O tio de merda do Paulo ainda não apareceu, mas o irmão dele já perguntou se o Lucas veio de um caso que eu tive.” She says. 

Across the table, John’s smile is fixed on his face. “What’s the joke?” He asks. “C’mon, Sally, you know we can’t understand you!” Sally smiles sweetly at him. “Oh, just asking about work.” She dismisses. Percy gives John an almost identical smile, just with sharper teeth. 

“And what is it you do, again, dear?” Cynthia asks, swirling her wine around in her glass. 

"I work for an IGO." Percy says dismissively. "And Jamie, over here, works in security,” Percy says, holding out an arm for Bucky to come take a hold of. “Have you been introduced?” 

“Can’t say I have,” John replies, holding out a hand, which Bucky shakes. “Good to meet you.” John’s got an easy sort of grin, something sly and sharp between his teeth. 

Bucky nods at him. “You too.” 

“Firm grip, there. Helluva security job, no?”

“Ex-military.” Bucky explains. 

“Oh, really?” John seems unduly surprised by that. “I didn’t think—well, someone like you would have been in the military..” 

“Excuse me?” 

“Gay,” Percy says, taking a sip of his drink. “He means gay.”

“Well, when you phrase it like that, you make me sound like an asshole!” John laughed. 

Percy takes another pointed sip. 

 

 

They end up at the poolside. Estelle and Lucas both haul themselves out and launch themselves at Percy and Bucky, soaking them with hugs. Percy laughs and spins Lucas around while Bucky hauls Estelle up. 

"Acho que você está mais pesado! Parece mais alto do que da última vez que te vi!” Percy says to a beaming Lucas. 

“I missed you!” Estelle shrieks happily. “Aqui é tão feio!”

Bucky and Percy both laugh. Carefully, Bucky responds, accent a little halting, “Eu sei que é.”

Estelle claps happily. “Good job!” 

Another shriek draws his attention back to Percy, who has Lucas by the ankle and is dangling him over the pool. “What do we think, guys?” He asks. “Do I dunk him?”

“No! No! Não!” Lucas giggles. Estelle starts chanting for them to do it, so Bucky similarly grabs her under her armpits and holds her over the water. 

“Three… two…” They both start swinging the kids, releasing them on one with a giant splash. Both surface laughing, then quickly get drawn into a game with Carmen. Percy casually nudges Bucky with his elbow, and the water soaking the front of his sweater evaporates. 

 

They run into Paul, as well. He greets them both, smiling as he side-eyes one of his brothers. 

“Big plans?” He asks them.

“If you mean fucking shit up like last time I came…no.” Percy says.

Paul laughs.

 

More introductions follow. Gabriel, Nina’s husband, is alright, but other than that, practically everyone they meet very poorly, or not even at all, hides disdain. It’s a whip-lash inducing mix of things—some at the way Percy and Bucky link hands, some at Percy’s cane or Bucky’s arm, some at Percy’s subtle accent…it just goes on. 

They’re bombarded by subtle digs and outright invasive questions, pointed looks and whispers that they can both easily hear. To be frank, it’s Hell. 

Percy’s smile is pained. “Last time,” He whispers, “I made it an hour before losing my shit. I’m trying to beat my record.” 

Bucky nods. “In that case, I’m going to go inside and try some of those breathing exercises Shannon keeps going on about.” He says seriously. “Or, I’m heading to the car, driving it into the house, and rigging it to blow.”

Percy hums. “Oh, no…the turkey…” 

That gets a short huff of laughter. Bucky pecks him on the forehead—oh, yeah, there’s Cynthia giving him a nasty look and Ryan shielding Andrew’s eyes—and heads inside to the kitchen. He debates the vodka Percy stashed in the fridge, but decides to save the hard stuff for later. 

“Ballsy move,” Bucky looks over. Layla Price is lounging across the barstool, half her attention on her phone. There’s a half-eaten piece of pie she’s clearly snuck in front of her. 

He raises a brow at her. 

She waves her fork around, a chunk of apple speared on it. “Showing up, y’know? I mean, Christ, last time Percy came to Thanksgiving, he slammed great uncle Patrick into a wall.” Layla pauses, raising a pierced brow. “You knew about that, I’m assuming?”

Bucky nods.

“Yeah, well, pulling something like that, skipping two years, then showing up with his boy friend…” Layla laughs something sardonic. “Ballsy.”  

Bucky can smell faint traces of weed on her. Down the hallway, the door to the porch enters and Jenny sticks her head in. “Layla!” She calls impatiently. “Stop hiding inside! Come out here!” 

Layla rubs a hand over her face, bitten nails and clunky rings. She grabs her plate and moves to the other side of the counter, sliding down to the floor, her back propped against the island. She looks up at Bucky. “I’m not here.” She says flatly. 

His mouth twitches. Bucky grabs the bottle off the counter and heads for the back door. “It’s just me in here, Jenny!” 

There’s a pause, then the door swings shut as Jenny hastily retreats. Bucky rolls his eyes as he rounds the corner and opens the door for himself, bottle tucked under his arm. Back in the kitchen, shaking a can of whipped cream to spray into her mouth, seventeen-year-old Layla snorts. “Ballsy,” She whispers. 

 

The questions continue once he’s back outside. Andrew asks some very concerning questions about the military and if Bucky’s ‘gotten’ to kill people. Cynthia repeatedly, and not at all subtly, despite her apparent efforts, tries to find out if Sally has converted. Bucky’s pretty sure not even Paul’s religious, so, converting to what, exactly, he’s unsure. 

Lucas is a bit of a hot topic, as well. Have none of these people heard of adoption? Bucky tells Michael, when he asks (he’s the fifth one), but it doesn’t seem to satisfy him. “They just look similar, is all,” He says, airily. 

Which…no, they don’t. Like, remotely. “How so?”

“Oh, you know,” Michael says, waving a hand. 

Bucky is, like, 99% sure that he just means they’re both Brazilian. So are 216.4 million other people, but whatever. 

Seriously, Sally is also half Hawaiian, too, and Lucas isn’t. The racism isn’t even that accurate. 

 

When it’s finally time for dinner, all of them— twenty two fucking people— gather in the dining room. The candles adorning the long table are lit, the dishes laid out in an appropriately classy manner, and the silverware gleaming in the low, warm lighting. Jenny is snapping pictures left and right, from a multitude of angles, but not a single one of the people in the room, other than Andrew, since his sister is still off hiding somewhere. 

(She’s actually in the corner of the room, hiding behind the Jackson-Blofis family and company, but none of them speak up about it.)

The table, long and rectangular, seats sixteen; seven on each of the long sides, and one on the short. On the left, closest to the door, Thomas Blofis seats himself, his wife standing to his right. At the other head, Nina helps old Lillian Blofis, Paul’s grandmother, sit. Only Thomas and Lillian stay seated, though Lillian doesn’t seem to be able to stand on her own, as Jenny insists for them all to join hands for a quick prayer. 

Bucky raises an eyebrow at Sally. “Christian?” He mouths. She just shrugs, and, quiet enough that nobody but a supersoldier or demigod would be able to hear it, replies, “When it’s convenient.” 

 

He’s a little puzzled as to what that means until they finish the prayer, during which he respectfully dips his head, regardless of how tempted he is to throw the tureen of peas in front of him at almost every single person in the room.

As a chorus of amen fills the room, Jenny gives Sally and Percy a saccharine smile. “I hope you don’t mine our prayers,” She puts an odd emphasis on our, as if Sally and Percy didn’t participate. “It’s just what we do here.” Again, we. 

Percy matches her tone of voice exactly. “And we think it’s real sweet.” He’s got that slightly patronizing tone down to a T. 

“Ah, right…you don’t pray, do you, Sally?” John says. 

“Sometimes,” She says. Sally Jackson, the amazing woman she is, doesn’t elaborate, maintaining eye contact with John with a peaceful expression on her face. 

“Not…well, not like us though, yeah?” Michael asks. “Your turkey would probably be live to sacrifice, or something,” He jokes. Ryan and Jenny both make tittering little laughs. 

Percy blinks. “That’s an interesting thing to say out loud.” 

The silence that falls around the room as Michael splutters is almost magnificent as the man who caused it, Bucky thinks, ducking his head to hide a smile. 

Nina clears her throat. “Anyway!” She chirps. “How about we—”

“What about you, James?” Thomas asks from where he’s sitting. “Do you go to church?”

“I haven’t been inside a synagogue in years.” Bucky replies evenly. 

“Ah,” Thomas says. “Jewish?” 

Bucky just shrugs. 

“Anyway,” Nina repeats, louder. “Let’s dish up the kids and start eating, yeah?” She doesn’t wait for a response, standing aside and ushering the line of kids to the table. Hunter and Mackeyleigh, Andrew and the re-emerged Layla, Carmen, Lucas, and Estelle get their plates filled as they go down the table. Neither Lucas or Estelle even go near the turkey, and Paul winks at them. 

 

Jenny tries to completely skip serving Lucas. Estelle starts complaining on her brothers behalf, and Jenny gives an over-the-top laugh. “Oh, I’m sorry, sweetie! I didn’t see you.” She plops a spoonful of potatoes on his plate. 

The kids, sans Layla, trail out of the dining room to the table set up in the kitchen. The breakfast nook, Paul had told him earlier, utterly serious with a distinct humor shining in his eyes. They call it the breakfast nook. I don’t think a nook has seats eight, but, what do I know?

“Oh!” Sally gasps theatrically, her knuckles white on the top of her chair. “I need to take the pie out of the fridge. Paul, darling, a hand?” 

He smiles politely at the family. “Excuse us,” 

 

Bucky watches them go, skeptical. “I need to piss.” Percy announces flatly, turning on his heel to follow.

Keeping a straight face is probably the hardest thing Bucky’s ever had to do. “I’ll help.” Eliza gasps so hard she starts choking. 

 

They congregate in the kitchen. 

“I swear they’ve gotten worse,” Sally says in hushed Portuguese. 

Paul nods. He, like Bucky, has an odd accent and stumbles over his words, but is near-fluent now. “They definitely have.” He agrees. “I think we’ve let them get too bold.” Paul Blofis looked like a very respectable, genial man. 

That was only a correct impression most of the time.

“I’ve been asked if Lucas is an affair baby, questioned on my immigration status—” Sally was born in New York, by the way, “My income, how much of my stuff Paul pays for, Percy’s father, and why we’ve taught Estelle our other native languages."

“My disability, my sexuality and whether it was proper to bring James here in front of the children, my father, your parenting, where Lucas came from, and whether or not I’ve been to jail,” Percy reports.

“My marriage, my relationship with Percy and Lucas, Percy’s father, my income, our living situation, Lucas’s origins as well, when we plan on leaving the city, Percy’s father, Lucas’s father, why I’m letting ‘my child’ waste time on non-English languages, Percy’s father, Lucas’s father, work, Percy’s father, Lucas’s father.” Paul rattles off. “They really seem to want to know about Poseidon and Lucas’s parents.” 

The three turn to Bucky. “My sexuality—same talk as Percy, honestly, whether I was really in the military, my job history, also Lucas’s and Percy’s fathers, and my arm. So many questions about my fucking arm.” He rolls his eyes. “Also, complete and utter shock when I said my parents were immigrants.” 

Percy nods solemnly. “The white kind.” 

Paul sighs heavily, leaning back against the counter. He chews on the inside of his cheek, looking at his wife and step-son. “I appreciate you,” He says. “You know that, right?” 

Sally smiles at him, patting him on the chest. “I know,” She says. “And we, you.” 

“‘Course, man,” Percy says easily. “We like you enough to put up with your shithead family, even.” 

Paul huffs out a laugh. “Nina and Gabriel talked to me earlier,” He casts a furtive glance into the dining room. “They’re not coming back, next year. They don’t want their family to grow up around all of this.” 

Sally gasps. “Family?”

He grins. “Yeah, Nina said I could tell you, but only if you kept it quiet. She’s not planning on telling pretty much any of them—the baby’s due in early May.” 

Sally clapped her hands. “Oh, that’s wonderful! I can make them a baby quilt!” She enthused. 

Paul gives her a look so full of adoration that Bucky feels compelled to look away. He wonders, briefly, if that’s how he looks at Percy. 

“Layla’s ditching, too,” Percy says. “Going to college and not looking back.” 

“So…nine of us, soon to be ten.” Paul says. He’s including Bucky, as well, he realizes, which makes something warm unfurl in his chest. “Definitely seems like enough to me, no?”

Sally’s brows raise. “You don’t want to come back?” She asks.

“Fuck, no,” Paul says, which makes Percy smile, pleasantly surprised by the vulgar display. “I can’t deal with this shit anymore, and I love you an incredible amount for putting up with it on my behalf, but I can’t keep asking you to do this.” Paul shakes his head. “The way they act is deplorable. I wanted Estelle and Lucas to grow up with at least some family on my side, like Nina and Gabriel, but now that they’re done with everyone…” He shrugs. “No point.”

“So…” Bucky asks. “What are you saying?”

Paul’s eyes flicked to the dining room and back. “Unless there are any objections, we’re done. No Christmas, no birthday celebrations, and Gods, no more Thanksgivings with the whole family."

Percy’s grinning something fierce. “And…?” He drags out.

Paul’s fighting a similar smile. “How did you phrase it? Ehm, let’s…fuck shit up?” 

Sally and Percy have almost the exact same laugh. “We might have already started that,”  Bucky says. “Percy said he had to go pee and I told everyone I was going to go help. Oops.” 

Paul snickers into his hand. 

 

They return to the dining room to receive a host of dirty looks. 

“Well,” Marie says, “Now that we’ve all finally seated,” She snips, “Let’s eat, shall we?”

 

The kids taken care of, everyone else sits down; Nina, her husband, Gabriel, Layla, plus Paul, Sally, Percy and Bucky take the long side by the window. The other side boasts Jenny and Ryan, Marie and John, Eliza and Michael, and Cynthia right by Thomas. 

Plating up is done with minimal conversation other than hey, pass me that—can I get—do you want—where’s the—did you get enough—

Paul takes the slices of turkey he’s offered. Sally takes half of that. Percy refuses it outright, and Bucky politely follows suit. Beneath the lacy table cloth, Percy squeezes his knee with a small grin. 

The turkey is fucking ass, by the way. Bucky can tell the instant it hits everyone—pinched faces and sharp swallows immediately followed by a large sip of wine. Paul had never touched his in the first place. Smart man.

Once dinner commences, it’s probably one of the best things Bucky’s ever gotten to witness. 

At first, they started off slow.

 

“I just don’t see the fuss,” Michael says. “Secure the damn border. I mean, really, not our people, not our problem!

“Uh oh!” Paul says, spearing a green bean. “I think that one was an inside thought!”

“Excuse me?” Michael demands.

Paul takes a noisy sip from his wine glass.

 

“It’s just a shame!” Marie complains. “Mackayleigh is clearly the best dancer! They’re shoving her aside in the name of fairness— well, guess what? Life isn’t fair!” She huffs.

Sally nods. “I’m sorry everyone is being nice to the other middle schoolers.” She says sympathetically. And, a thing about Sally Jackson—she’s such a kind woman that she can say things that you don’t even realize are mocking until five minutes after.

 

After listening to Ryan give his entire four-minute monalouge on his stance on female healthcare, Percy propped his chin into his palm. “What gave you the confidence to say that out loud?” He asked, completely genuine. 

 

Nina catches on after that and takes it up a notch. 

“When are you having kids? Time is ticking, you know.” Eliza asks her sister-in-law.

“Yeah, I decided to get a hysterectomy.” Nina lies through her teeth. “Got it done last year.” 

“But…what about your future children?” Jenny asks, aghast.

Nina, currently pregnant, shrugs. “Don’t need ‘em.”

 

Their entire side of the table ramps up after that. They just start lying their asses off. 

Percy takes a sip of water. “Oh, well, my cousin came over and played makeup with Estelle—he’s a drag queen, so he’s super talented with it—”

 

Through a mouthful of potatoes, “So, like, I was on my sixth gender-reassignment surgery—”

“What gender are you actually?” Eliza asks weakly. Ignoring her horrific wording, Bucky hums. “You know, I’m actually not sure.”

 

At some point, Percy just takes the massive plate of rolls and swaps it out for his own plate.

 

Some of it’s technically true, even.

“So, my autistic nonbinary employee took time off to visit her wife’s family in Colombia, and—yeah, they’re childfree, they both work, one’s a lawyer and the other a doctor—so my other employee—yeah, the genderfluid Thai immigrant—”

“Oh, well, there was this guy, total neonazi, so I just started swinging—”

“So, he’s a billionaire, and he hates it, and he keeps trying to instigate socialist revolutions in the local political offices, but—” 

“Well, yeah, I speak Russian. Fluently, yeah, I learned in Russia. I lived there. For how long? Hm…sometimes it feels like as long as I can remember. I work in the American government, now, so—why are you screaming—so I work directly with the head of the branch, and—” 

 

Percy starts dipping the rolls directly in both the cranberry sauce and the gravy, making an odd sludge of cross-contamination in both dishes.

 

Then they circle back around to lying.

“Oh, yeah, we only hire queer people. Diversity quotas, y’know? If you’re not gay, we’re not allowed to interview you.” Nobody has even noticed the rolls are all but gone amidst the chaos.

“Well, I only let Estelle and Lucas read books with main characters of color. That’s how Percy grew up, and he’s doing wonderful!” Sally tells Ryan.

Paul sticks his fork straight into the thin slice of turkey on his plate, flicking the handle. It stays perfectly upright. “Since I married Sally, I barely even speak English anymore, honestly.”

“Yeah, I mean, of course I was sucking dick when I was in the army. What else would I have been doing?” Bucky says to John without blinking. 

 

Eventually, the other side of the table starts trying to divert the conversation away from them. Layla, who’s been watching the whole thing with an unashamed humor, drags her finger through the dredges of her gravy. She’d slipped out at some point, and when she returned, she stank of weed again. Nobody noticed, save for him and Percy, who rolled his eyes behind his sunglasses. Her return drew the attention of her mother.

“When are you going to get a man in your life?” Jenny loudly asks her daughter, a pointed look on her face as half the table quiets down to listen. 

Layla looks slowly at her father, open disdain creeping onto her face, then back to her mother. “When are you?”

Jenny throws her fork down onto her plate, shooting upwards. “Layla Marie!” She reprimands shrilly. “How dare you speak to your father like that?” 

Bucky gives the girl a subtle thumbs up across the table—and by that, he means he just does it, because literally everyone else is staring at Jenny and Layla, who lazily looks up at her mother. “Meh, meh, meh.” She mocks.

Her mother turns a brilliant fucsia color. “Layla!” She shrieks.

Layla now opens and closes her hand in the motion of a mouth. “Layyyluhhh,” She mocks again. 

Across the table, Nina starts laughing. Marie turns on her, incensed. “We do not encourage this behavior!” 

Nina rolls her eyes, red painted lips curling upwards. “We also don’t learn to use Snapchat solely to message fourteen-year-olds, but, hey, you were still the one trying to get Patrick invited again.” 

Marie slams her hands on the table. “The only reason he isn’t here is because that fucking psycho—” She flings a hand out towards Percy, who’s got half a roll stuffed into his cheek. “Attacked him!”

Bucky leans back in his chair. “I saw the video, it was hot.” He says shamelessly. “We fucked for, like, an hour, after. In a public park.” 

John shrieks. Michael looks disgusted. “You’re both fucking perverts!” 

Bucky grins. 

“That’s it!” Cynthia screams. “This disgusting talk will not be allowed in my house!” 

“Andrew was literally talking about Hitler for twenty minutes.” Layla scoffs, rolling her eyes. “That’s allowed, though?”

“He likes history!” Jenny defends.

“He started a petition to remove AP African American Studies from our school district.” She deadpans.

Paul leans back in his chair far enough to toss a giant chunk of turkey into the fireplace. It catches immediately—food should not be that flammable, Bucky thinks to himself—and fills the room with the smell of char. Paul tosses back the remainder of his wine. “For the Gods.” He deadpans. 

Cynthia starts wailing. 

Sally wordlessly passes Percy the stuffing dish as he tosses the last roll over the table to Layla, who somehow manages to catch it in her mouth. “I miff Patwik,” Percy swallows. “He was entertaining.” 

“You stay away from my father!” Marie screams. “You dirty fucking—” Ooh, that’s…that’s not a good word. Wow. Holy shit. Absolutely not. It’s Bucky’s turn to slam his hands on the table and stand up. “You speak to him like that again and I’ll break your fucking jaw.” 

John shoots up next. “Do not speak to my wife like that!” He roars. Bucky, who’s hands are rated E for Everyone, narrows his eyes and him. “Or what?”

John launches himself over the table towards Bucky, managing to grab a fistful of his jacket and sending them both crashing backwards. Eliza screams and Michael lurches towards them, intent on pulling them apart, Bucky laughing all the while. 

Sally dabs at her mouth with an embroidered napkin. She folds it, places it over her plate, and stands, pushing her chair in behind her. Sally rounds the table to stand behind Marie, tapping her lightly on the shoulder. Marie whips around to look at her, and Sally smiles. “Cuidado com a língua, cabra,” Up until then, nobody’s noticed the bowl of mashed potatoes Sally’s holding until she turns it and dumps it over Marie’s head. She starts screaming again as Sally places the dish down and calmly returns to her seat. Paul high-fives her as she does. 

“What the fuck?” Michael demands. “Holy shit, Paul, control your wife!”

Even in the back of the room, Bucky and John pause, just as Bucky’s got the man lifted by the shirt collar. Paul stares at his brother for a long moment. “Michael,” He says slowly. “Look at me.” 

Michael scoffs but does so, his arms crossed as he watches Eliza hesitantly attempt to wipe mashed potatoes off of Marie’s face. Paul walks up to his elder brother and executes a perfect right-hook right across his face. Michael staggers back and hits the wall, blood already welling up from his lip. “Fuck you!” He yells. He lurches forward to Paul, but Nina sticks her foot out, tripping him, and he hits the ground. 

Percy laughs so hard stuffing comes out of his nose. Marie throws a fork at Sally, but misses terribly, John is in an armlock by Bucky and is getting salad pelted at him by Layla, Michael’s on his back dramatically yelling, and Eliza tries to enter the fray, only for Nina to get in her face and tell her that her pathetic husband is fine, which prompts Eliza to grab her by the hair, which then results in Nina biting the woman. Ryan enters at that point, to separate the two, but Gabriel meets him halfway with a sharp never lay your hands on my wife!

Jenny starts screaming about calling the police, only to be unable to find her phone. Layla, who stole it and tosses it into the mulled wine pitcher five minutes ago, starts loudly telling her mother about the tattoo she’d gotten last Spring break. 

Thomas and Cynthia sit, stunned, the longest. It’s them, Percy, and Grandma Lillian, who’s staring somewhere over the rest of them at the window. 

Thomas stares at his step-grandson, who has scooted his chair back so he could rest his dirty converse on the white tablecloth, the now almost-empty stuffing dish balanced on his knees. “Is that blood on your shoes?” He asks numbly.

Percy shrugs. “How would I know?”

Cynthia bursts into noisy sobs. “Paul never should have married that woman,” She manages to make woman sound like a dirty word. “He’s ruined this family, Thomas! Ruined it!” She laments as approximately five different fistfights continue around the dining room. 

Thomas is still staring at Percy. “We opened our home to you,” He says, shaking his head. “We accepted you, even though—”

“Even though… what?” Percy interrupts. “Even though my mother didn’t go to some fancy university? Even though she raised me in Hell’s Kitchen? Even though I already existed before she met Paul?” He wipes a stray crumb from the corner of his mouth. “Let me tell you what, Thomas—we didn’t need you to accept us, which, for the record, you absolutely didn’t. Paul’s one of the few good things to come out of this shitstain of a family, and now he has me, and my mother, and Estelle and Lucas, and the rest of my crazy fucking family.” 

Gabriel dumps a pitcher of water over Ryan, and Nina starts performing some honest-to-God WWE moves on Eliza. Layla is still screaming at her mother—she seems to have really needed this, quite frankly. 

“You’re filth.” Cynthia sobs, hatred burning in her eyes. “Absolute filth.” 

Percy licks the gravy off his thumb. “Yep,” He agrees. “Pretty much. And you know what? After all this, while you’re picking up shattered china, cleaning potatoes out of your custom wool carpet, and boxing up the leftovers of your nasty fucking turkey, you’re gonna realize that you, by contrast, are so damn clean that you’ve cleaned out half your family. Shit, two outta four of your kids hate you, your brother’s a fucking pedo, your granddaughter is high off her ass because it’s the only way she can stand to sit at a table with you all, and her brother’s a fourteen-year-old neonazi.” Percy snatches a bottle off the table—non-alcoholic fizzing cider, because Jenny’s pretended to give up drinking on her family YouTube blog—and takes a sip. “Paul's done a good job—a damn good one. He’s a good man, Thomas, and it’s so horrifically sad that you’re so far up your ass that you don’t even see the family he’s made for himself.”  He waves a hand behind him. “Paul has found people he’s willing to start a fistfight at Thanksgiving dinner for. That’s how much he cares about us.” Percy says. “And look at you, still sitting your ass down at the head of an empty table.” 

Percy tips his head back and takes another swig. He uses the back of his sleeve to wipe his mouth, then puts the empty bottle down on the table with a resolute thunk. “And, for the record, my mother is the best thing to ever happen to this shit-talking, boot-licking, ignorant-ass cumstain of a family that only falls back on a religion they don’t even really follow purely to be xenophobic dumbasses. Newsflash, dickheads, my mother was born, like, fourty-five minutes from here.” 

And then, because he’s an asshole, Percy reaches over, plucks the discarded turkey leg bone from a platter, cracks it in half with his teeth, and noisily slurps the marrow from it. Cynthia actually gasps. 

Behind him, John finally seems to have given up on trying to attack Bucky, who, up until now, has been, quite frankly, playing with his food. Eliza scrambles away from Nina, who yells at her retreating back, “I haven’t liked you since the day my brother brought you home!” 

Well…in for a penny, in for a pound, Percy supposes. He tosses the bone into the fire and, in perfect Latin, says, “Hoc te tam malum terrent. Aliquid, aliquid, daemonia, satana.” 

Cynthia starts screaming. “Satana? Did you just say Satan! Thomas, he’s a fucking heathen!” She scrambles up, still shrieking. “Heathen!” Then—holy shit, she says something about the the mark of Cain and flees the dining room. Probably to call the police, or something. 

Percy stands up and monetarily lowers his sunglasses so Thomas can see him wink. Percy turns to the riot happening in the rest of the dining room. “Hey, you guys ready to go?” 

Bucky gives John one last wet willy before standing, brushing off his slacks. “Sure.”

Paul lets go of his older brother’s beard. “Yep.”

Sally slips the shoe she’d been about to toss at Marie back onto her foot. “Of course. I’ll get the kids.” She’s still smiling. Gods, Bucky is obsessed with Sally Jackson. 

Nina and Gabriel, too, stop and look over at them. “Well, if the cool people are leaving, I’m out,” Nina announces. “Gabriel?” He loops her arms through his. 

“Can I come, Aunt Nina?” Layla asks suddenly. 

Nina holds out a hand. “Of course, darling.” She says kindly. “Shall we?” Layla laughs and runs to take her hand, sounding like a kid for the first time that day. 

Mussed hair, wrinkles collars, and missing a shoe, the group rights themselves and stands together. “Later, dad!” Paul calls behind his shoulder. Nina, on the other hand, opts for a “Smell ya later, fuckers!” 

The two Blofis children lead their families out into the hallway, only to be halted by a quiet, “Nina, darling? Paul?”

They turn around. Grandma Lillian squints up at them. “Are you leaving?” Her voice is croaky and wobbly.

Nina nods. “Yes, Grandma.” 

The woman reaches for her walker. “This turkey smells like shit. I want Taco Bell.” 

Nina’s jaw practically hits the floor, but she moves forward nonetheless to help the woman up. Paul starts laughing, a rough bark that turns into full-on belly laughter. He wipes at his eyes, an arm around Sally’s shoulder, Lucas clinging to his leg while Estelle sits comfortably on one of Bucky’s strong shoulders. With the addition of one, still laughing, they head back through the hallways, living room, and entryway, towards the front door. 

“Oh, by the way,” Percy calls out into the house, pausing in the doorway. “Lucas is mine. James knocked me up when we were teenagers.” He shuts the door behind him quickly just as the yelling starts. 

 

The dishevelled group stands in a loose circle in the driveway. “Holy shit,” Gabriel whispers. “Oh, my God.”

Nina blinks. “We’re totally getting the cops called on us, aren’t we.” It’s not a question. 

Percy shrugs. “I definitely heard Cynthia going for the phone.” 

Paul scrubs a hand down his face. “Shit, yeah, I don’t think there’s going back from this.” 

Layla shrugs. “I’m eighteen in a week. I had a place to crash lined up, anyway.” It’s silent for a long moment, before she tacks on, “I’m gay, by the way.” 

Nina ducks down and presses a kiss to her forehead, leaving a bright red lipstick mark. “I support you as long as your girlfriend isn’t a loser.” Layla snorts. 

Bucky wordlessly pats her on the shoulder. “Cool. Stop smoking weed, though. You’re young enough that it’ll fuck you up good.” She rolls her eyes. 

Behind his back, Bucky passes Percy the small baggie he’d just stolen from her coat pocket. Percy, barely keeping a straight face, puts it into his. 

Paul glances back towards the house. “Shit,” He says again.

It’s Sally who covers her mouth first, a giggle escaping her. Then it’s Paul, who smiles anytime he hears that sound, which quickly turns into a short chuckle as he shakes his head. Nina elbows her brother lightly, a wide-toothed grin growing on her face. Percy has so such reservations, tossing his head back, laughing in that way that makes him snort a little. Hanging off him, Bucky smiles, huffing. The slight movement jostles Estelle, who’s little giggle sound almost exactly like her mothers, which sets off Lucas, too. Gabriel grins, and Grandma Lillian’s laugh sounds like the rumble of heavy clouds while Layla’s is breathy and short. 

They end up standing in that driveway laughing until their ribs hurt. 

“I told Jenny I got a hysterectomy,” Nina wheezes. 

“Michael and Cynthia think I’m a Russian spy,” Bucky whispers, shoulders shaking. 

Percy buries his face in Bucky’s shoulder. “Cynthia thinks I’m the host of Satan,” 

“I threw a roll at Hunter!” Estelle chirps. 

Paul is practically crying. “I bit my brother and watched my sister use Arn Anderson’s Spinebuster on our sister in law,” 

“Jesus fucking Christ,” Gabriel’s clutching his stomach. “Fuck, now I want Taco Bell, too.”

Grandma Lillian nods. “Yes! I want a Chalupa. Nina, dear, Paul, love, drive me to get a Chalupa.” 

“Yes, grandmother,” They chorus. 

At this point, they decide fuck it, and all want Taco Bell. Nina drives Gabriel and Grandma Lillian, Paul drives Sally, Lucas, and Estelle, and Layla hops in the back of the SUV Bucky…acquired. It was from Tony, so it was probably legal. Probably. 

 

On the way, Percy puts his feet up on the dash. Bucky smacks him on the knee. “Heathen.” 

For some reason, that sets Percy off laughing again. Bucky rolls his eyes but leaves his hand on his boyfriends knee, giving him a gentle squeeze.

Through the rear-view mirror, Bucky can see how Layla’s face softens as she watches them, and vows to buy her a Baja Blast.

 

The Taco Bell, surprise, is near-empty. The sole employee lets them push a few tables together, and after they rattle off their orders, they tell her to take her time—they’re in no hurry at all. 

Paul leans his head back against the booth. Sally leans against his shoulder, smiling at him. They’ve got a cup full of ice and are passing it around, taking turns icing knuckles and, in Nina’s case, elbows. 

“So…” Paul drags out. “Our place next year?”

Notes:

a few serious notes:
1- this chapter is a dig at a lot of things, but christianity as a concept isn't one of them. christianity as a religion can be kind and wonderful, but in practice, far too many people use it to justify countless forms of hatred and prejudice. THATS what this is making fun of. shit like the justification of racism through stuff like the mark of cain (seriously, google some of this shit if you've never heard of it). to any christian readers, know that this wasn't intended as an insult to you, but towards hypocrites that use religious texts as weapons.
1.1- clarification: the mark of cain is specifically used as a prejudice tool against Black people. though percy is not Black, cynthia is racist and stupid.
2- remember the true story of the origin of thanksgiving and the real role Native Americans played. the europeans were colonizers, not their best friends who they had lovely dinners with. if you live on native land, try to find out what tribe and do what you can to be an ally and respect them and their land.
heres a link on being an Indigenous ally: https://urbannativecollective.org/indigenous-ally-toolkit
and one on Native perspectives of thanksgiving: https://americanindian.si.edu/nk360/informational/rethinking-thanksgiving
(also, i am not Native myself! if any of you are, and have any better information you'd like me to provide, i'd be happy to)

 

yeah, i dont even know if i spelled Makeyleigh in the same way more than once.

paul's learning portuguese, and is planning on hawaiian next, btw. bucky's learning as well :)

solo poly Black Hijabi amputee...autistic nonbinary person in a gay marriage to a colombian immigrant...

properly translating latin is...rough, guys. percy's latin is supposed to say 'this is gonna scare you so bad. something, something, demons, satan.'

can't believe it took me three and a half years to make an mpreg mention

btw layla WILL go and live with nina and gabriel AND get a girlfriend whos not a loser

happy thanksgiving to all those who celebrate!

plumbing baby. goodbye

Chapter 49: christmas 4: die really hard guys

Notes:

i really hope you guys are familiar with the plot of die hard

(See the end of the chapter for more notes.)

Chapter Text

Bucky couldn’t take it anymore. 

From his spot in the kitchen, leaning against the counter, he stared over the island to the living room. 

Tony was sitting on the edge of the couch, tablet in hand, leaning practically against Stephen, showing him some…something. Bucky wasn’t entirely sure, to be honest. Lots of big words were used. Something sort of kinda related to BARF? Hence the neurosurgeon consultation.

(At least, that was Tony’s excuse. But Bucky saw right through him—SI literally had an entire team of doctors of all sorts, including neuroscientists and surgeons.)

Bucky took a long sip from his mug as Stephen said something that made Tony toss his head back in laughter. Stephen was staring. God, the yearning. Him and Percy weren’t nearly this bad. 

(Okay, he and Percy had definitely had shit like that. But they’d been fairly efficient about it—the benefit of both being quite blunt and upfront. They met, they got to know each other, Bucky got over the fact Percy was technically supposed to kill him, Percy got over the fact Bucky was a hundred-year-old Russian assassin. Bucky went missing, Percy lost his shit and went on a rampage to find him. Percy got hurt, Bucky lost his shit and went on a rampage to save him. Blah, blah, blah, they kiss. Easy!)

Speaking of—the elevator doors slide open and Percy, rubbing at his eyes, stumbles out and into the kitchen. Tony doesn’t even notice, because now, he’s staring at Stephen. Percy makes a beeline for Bucky, tripping over one of his own fuzzy socks on the way. Bucky catches him with one arm, the other raised high, holding his mug. 

“The fearsome demigod himself,” Bucky quietly teases.

Percy grumbles something, shuffling closer to stand in Bucky’s space, his face pressed into his shoulder, right above the prosthetic joint. It can’t have been very comfortable, but Percy seemed content. Truthfully, Bucky was still getting used to his boyfriend's almost complete apathy about Bucky’s left arm. 

Well—apathy wasn’t the right word. Percy cared, obviously, he cared so much it hurt. Whenever he had an appointment to check over or fix the prosthetic, Percy would sit on his right, holding his other hand and would just…talk. It didn’t seem like it on first impressions (or second, third, fourth…) but Percy had an insane talent for just yammering on and on. A byproduct of his ADHD—if you got him started on something he was interested in, Gods help you, because he would only stop when he was well and ready to. He didn’t talk linearly, either—he’d jump around to different topics, going off on side tangents that turned into their own info-dumps, only to circle back around to the main point, like, fifteen minutes later. It should have been annoying—honestly, sometimes it was, when Bucky was trying to keep track of everything, but even then, he could never find it himself to be actually upset— but during his appointments, listening to his boyfriend, watching him talk so expressively with his hands and face…the appointments were a little less awful. 

So, yeah, Percy cared about his arm, but it didn’t…well, it didn’t bother him. He was just as likely to take Bucky’s hand, to sleepily demand Bucky hold him, or to have him carry things for him, with his left as he was his right. 

He’d asked, once, late one night, after Percy had burrowed into his left side under the covers, Bucky’s arm around him. “I’ve hurt a lot of people with this. Does that bother you?” 

“No. ‘m in love with you. Don’ care.” Percy sleepily flung an arm onto the metal of his bicep. “‘Sides, differ’nt prosthetic, anyway, dumbass,” He grumbled. “What’s there to be scared of, the concept ‘f your left side?” Gods, even half-asleep, Percy was such a bitch. 

Bucky needed him so bad it was insane. 

He pulled his boyfriend in closer. Bucky pressed his nose into the mess of Percy’s hair, inhaling lavender and the ocean breeze, overlaid by the faint scent of Bucky’s own aftershave. They stand like that, both trying to block out to the faint sounds of Tony and Stephen flirting, until Bucky’s coffee goes lukewarm. 

 

Decorating the Tower is a massive undertaking. The public areas and outside are done by a company Tony hires, but the top few floors, the residential, have too high clearance for anybody but the residents to do it. Peter takes great joy in climbing around to hang garlands and lights, and Tony has the worst ten seconds of his life when he hears Bucky give the kid a nail gun.

FRIDAY is playing soft, instrumental holiday music as a backdrop to overlay the process. Mrs. O’Leary dragged the tree from the elevator into the living room. Somehow, not a single stray pine needle is found to be cleaned up.

She’s a miraculous creature. 

…Whatever she is. 

 

Of all her missions, this may be the most critical, yet. Natasha stares down at the mess in her hands, hair pulled back in a braid to keep it from obstructing her vision. If she fucks this up, it’s over. The whole thing. There’ll be no coming back from this. 

Complete the mission, a voice in the back of her head whispers. 

Like all tasks, Natasha leaps into it with grace. 

She will not fail. 

She cannot. 

 

“Hey, Nat, how’s it going?” Tony asks, poking his head through the doorway. 

Natasha doesn’t look up from the Christmas lights she’s untangling. “Fine.” She says robotically. 

He’s silent for a moment as he watches her. Her fingers itch for the dagger sheathed beneath the bulk of her sweater. You can’t cut the lights, Natalia, she tells herself. The package must remain intact. 

“...You sure you don’t want help?” Tony checks. 

“No.” Natasha says shortly. “I will succeed.” 

“Right,” Tony agrees. He doesn’t leave.

“Why don’t you go flirt with Stephen, or something,” Natasha snaps, threading the string through a particularly complicated knot. “Leave me be.”

Tony’s spluttering of denials is almost as infuriating as the target in front of her. 

She will not use her knife. She won’t. 

 

 

 

Bucky’s laying face-down on the bed, arms splayed out and face buried into the pillow. Their bedroom is warmer than the rest of the tower, but gooseflesh still prickles his arms under his sleeves. A part of him wants to move under the covers, but the rest of him simply can’t find the will. 

The front door opens, and the familiar sounds of Percy kicking off his shoes echo from the entryway. Footsteps, then a small bang and a muffled curse. 

Bucky tilts his head to the side so he’s audible. “I keep offering to move that table,” He reminds.

Percy huffs as he enters the room, tossing his coat over the back of the desk chair. Bucky’s totally going to pick that up and hang it in the closet later, and they both know it. “I’ll just walk into something else,” He grumbles. It’s an ADHD thing, according to Percy, rather than a blindness thing—he can sense the table perfectly well, but that doesn’t do him much good with a lack of object permanence—his words, not Bucky’s. 

His boyfriend climbs up on the bed and flops down atop Bucky, draping himself over his back. Bucky lets out a small oof, just to be dramatic. Percy weighs practically nothing to him, and they both know it. With his nose buried in the nape of Bucky’s neck, and his chest pressed against his back, they occupy almost the exact same space in the bed, Percy’s unnaturally high body heat seeping down into Bucky. 

“Tony’s pissing me off,” Bucky grumbles into the pillow. 

“If you say him and Stephen,” Percy’s lips ghost across his collar as he speaks. “I am going to scream.” 

Bucky’s frustration takes a momentary step aside for amusement. “Would certainly be the most effortless way I’ve made you scream in bed.” 

Percy bites him. 

Bucky reaches blindly back to smack him. “Yeah, biting is usually involved, too.” 

“I will explode you with my mind.” 

Bucky huffs a small laugh that Percy feels through his ribs, then sobers. “Seriously, though, I need you to start hiding my guns. I fear the anger that is coursing through my body with an exponentially increasing frequency will completely override BARF and all my therapy, and I will simply snap and kill Tony. Or Stephen. Or both of them, together. Maybe arrange their corpses in something artful.” 

Percy groans and rolls off of Bucky, splaying on his back next to him. “A bold assumption I’m not tempted to let you kill them.”

Bucky sighs heavily. “They’re so oblivious.”

“We weren’t that bad.” Percy laments.

“Not at all!” Bucky agrees vehemently. “We were much more direct.”

“And quicker! It’s been, like, two years, at least, of just pining!” 

“Yeah! That…has it really been that long?”

“I mean, I think.” 

Bucky turned his head to face him, cheek squished against the pillow. “You came to the tower, what, like…”

“Summer of 2016.” 

“And it’s now…”

“...Spring of 2018?”

“But we’ve spent…three Christmases together?”

“...and I spent another at the Tower before you got here.”

“...”

“...” 

“I—”

“Well—”

Bucky frowned. “Does last Christmas count?”

“It…yeah? I mean…”

“It was in Westblooms, though.”

“I thought we agreed not to talk about that—wait. Jamie, baby, do you—do you think that things in Vermont just don’t count? That—that still happened. It was just in Vermont.”

Bucky squinted. 

Percy looked increasingly stressed with every moment of silence. 

Bucky squinted more. 

“Babe…”

Suddenly, Bucky gasped and scrambled up. “Oh, my Gods!” 

Percy jolted, bracing himself upright on his elbows. “What? What?” He shrieked. 

Bucky grabbed him by the shoulders. “Fucking Tinsel!” He yelled, shaking his boyfriend. Percy, flopping in Bucky’s hold, looked incredibly confused. “What the fuck?”

“Tinsel!” Bucky practically yelled in his face. “The fucking elf that Vermont-ed us!” 

The realization dawns on Percy’s face. “Right! After Westblooms they magicked me into the living room!” His eyes narrow at Bucky. “I barely met them last year because—”

“Yeah, yeah, I grabbed you and took you upstairs to fu—”

“Okay!” Percy says loudly. “I think we all remember that!” 

Bucky, grin rakish, dips down and pressed a kiss to Percy’s lips. “Damn right you do.” He said against him. He pulled back, taking in the rosy flush to Percy’s cheeks as he got back on track. “Hear me out,” Bucky said to his boyfriend, who was already raising a skeptical brow. “We find Tinsel and get them to do whatever they did to me to Tony.” 

Percy opened his mouth then closed it. He tipped his head to the side in the way he did when he was thinking, a small furrow in his brow. “We…we solved our problems and escaped through murder. I don’t think they’ll do that.” 

“They might,” Bucky defended. 

“Jamie, we jumped to murder, like, incredibly fast.” Percy winced. “I think it was almost immediately after Tony called us and told us Hammer had bought the preserve, we decided to kill him.” A beat. “Well, a few hours after—”

“Because we got freaky in front of the fireplace.” Bucky nodded along.

Percy sighed. “Yeah, because we got freaky in front of the fireplace.” 

“Jorked it.” A beat. “Ross taught me that.”

“James Buchanan Barnes, if you ever refer to our sex life as jorking it , it’ll die out faster than Justin Hammer.” 

“Noted.” Bucky leaned in a little. “So…Tinsel?”

“I just think—” Percy broke off, his entire face contorting. His eyes went distant in the way they did when he was paying attention to something far away. “Fuck it. Tinsel.”

Bucky raised a brow.

“Tony just tripped, Stephen caught him, and now they’re both having breakdowns in different rooms. Tinsel.”

Bucky cheered. “Tinsel!” 

 

 

Their second problem: they had no idea how to contact Tinsel. 

Bucky, Percy, plus Nat and Peter, who had overheard and immediately decided to get involved, stood in a loose circle in Percy’s apartment in Hell’s Kitchen. Peter was only half-paying attention, craning his neck to look around the building. 

“Is this, like, a super-secret safe house? Do you keep bodies here?” Peter asks, squinting at a photo frame. “Is this you?”

Percy gave him a deadpan look. “No, maybe, and how would I know? It’s my childhood apartment, from before my mom and I moved next to you guys.” 

Bucky takes a quick peek at what Peter’s looking at—it is, indeed, Percy, standing with Blackjack and Mrs. O'Leary—then goes straight for his favorite armchair. The murder armchair. He likes to lean back and imagine he can hear Gabe Ugliano screaming. Percy takes a seat on the arm, his legs across Bucky’s lap. He’s probably imagining the same thing. It’s beautiful, the things that couples bond over.

“So,” Natasha says, looking at the giant fern. “How do we go about this? Magic of some sort?”

“I could try getting Hazel and some of my other family to look into it,” Percy offers. “But whatever the fuck Tinsel was up to had nothing to do with Greek magic, as far as I could tell.”

Bucky leans back. “What if I stand around and look super lonely again?”

Natasha nods along. “Or, I could spend the next three weeks manipulating and gaslighting Strange until he does all the legwork for us.” She looks away from the fern for a second. “He wouldn’t realize until it was too late, of course.”

Percy hums. “We’ll keep that as Plan B.” 

Peter, meanwhile, is half out of the window, his hands bracing himself on the sil. “Hey, look!” He chirps. “It’s snowing!” 

Bucky reaches out and tugs Peter back into the building with one hand. “And you can’t thermoregulate.” He reminds. Peter, pouting slightly, keeps one fingertip stuck to the windowsill. “It’s the first snow of the year!” He defends. “We should go out and make snowmen!” 

“Tinsel first, snowmen second.” Bucky says firmly.

Peter deflates. 

“So…Strange, Percy’s cousins, and Bucky being pathetic.” Natasha recaps. “Those are our options.” 

“That seems like a lot of work,” Peter inches back out the window, sticking his tongue out to catch snowflakes. “Wha’ if we jus’ ask nishely?” He asks, garbled. “Mx. Tinsel! Can ‘ou come do Chrissmas mayic again?”

Natasha puts her head in her hands. “Peter—”

A sudden chill swept through the room, but it originated from seemingly the middle of the living room, not the open window. There was a loud crack, a flurry of snow and…glitter? For the second time in Bucky’s life, a person appeared onto the coffee table.

“Well, at least you’re not holding a knife, this time. Love softens you like that, I guess!” Tinsel enthused in all their holiday glory. 

Bucky didn’t have the heart or the patience to explain that he actually did have a weapon on him. 

It was Percy.

His boyfriend could do this cool thing called ‘dehydrate you with his mind until you die’. It was very effective. 

Also, all Bucky’s knives were under the custody of Mrs. O’Leary, to keep him from killing Tony and/or Stephen. 

“Hi, Tinsel,” Bucky sighed. Lord, he forgot how fucking bright they were, from the cherry-red outfit to the blinding white hair. Their hair was in twin braids, as opposed to the sole one last year, but still done up with the same scarlet ribbon. 

Tinsel bounced on their toes, skipping forward to stand directly in front of Percy. They leaned in, faces a few inches apart, and reached up to lightly poke at his cheek. (Bucky knew Percy. That subtle twitch of his lips was him pushing down the automatic instinct to bite Tinsel.)  “He’s so cute! Oh, you guys are adorable!” They chirped. “Hi! I’m Tinsel!” 

Percy waved politely.

Natasha and Peter exchanged looks, shrugged, then chorused, “Hi, Tinsel.” 

Tinsel spun a little, the sound of jingle bells emanating from them. “Hello! Hi! How are we feeling this Christmas?”

“Merry and joyous!” Peter all but screamed, pumping a fist in the air. 

Tinsel spun towards him, pointing at him with both fingers. “I like you!” 

“I am very whimsical!” Peter yelled again. 

“Listen,” Bucky said, steering the conversation back on track. “We need a favor.” 

 

Eyes draped by white lashes fixed on him. “I’m listening,” 

 

 

 

 

 

 

 

 

 

 

 

Stephen Strange leaned his head back into the airplane seat, eyes shut as another little drop of the plane made his stomach lurch.

A voice came from the seat next to him. “You don’t like flying, do you?”

He looked over to see a woman, elegant braids piled into a bun atop her head, glasses hung on the collar of her shirt, raising a dark brown at him. 

Stephen exhales slightly, casting a glance to the window to her left as his grip on the armrests tightens, watching the airport grow closer as they descend. “No, no,” He says. “Where’d you get that idea?”

The woman smiles a little. “Well,” She says, a soft accent curling around her words. “Do you want to know the secret of successful air travel?” She leans in a little, conspiratory. “After you get where you’re going, you take off your shoes and socks. Then, you walk around on the rug barefoot, and make fists with your toes.” She whispers.

Stephen blinks. “Fists with your toes.” He repeats. 

She laughs a little, a warm, rich sound. “I know, I know. It sounds crazy. Trust me, I’ve been doing it for nine years. Works better than a shower and a hot cup of coffee.” 

They touch down on the tarmac with a lurch that makes his stomach jump into his throat. The woman, too, jolts a little, but is far less affected than him. “Rough landing. Think they’ll need to check if a doctor’s on board?” She jokes. 

Stephen rubs a hand over his face, other hand still on the armrest. “I sure hope not,” He says. “Because then I’ll have to do my job.” 

 

She looks at him, surprised. “You’re a doctor?”

He nods. “Neurosurgeon.”

She whistles lowly. 

“You?”

“I work for the U.N.” She holds out a hand. “Willa Hanover.”

He shakes it. Her grip is firm, her hands strong. “Stephen Strange.” 

 

      

 

Across the city, the cork of a bottle explodes across a large office, its trajectory halted by a Christmas tree standing proud in the center of the office. The cork hits a branch, then rolls harmlessly across the carpeted floor. 

Standing on the desk, Nick Fury holds up the bottle triumphantly. Around him, a crown of business casual cheers.

“Ladies and Gentlemen,” Fury says. “I congratulate each and every one of you for making this one of the greatest days in the history of the SHIELD corporation.” 

 

Behind him, Tony Stark-Strange flicks through a stack of fresh prints, still warm to the touch. Eyes glued downwards as he reads, he walks down the hallway. A pair of dress shoes fall into step with him as he makes his way to his office. 

“What about dinner?” The man asks, leaning in to get a better look at Tony’s face. 

Tony doesn’t do him the service of meeting his eyes, flipping over a paper to scan the back. “Hammer, it’s Christmas Eve. Families…stockings…chestnuts…Rudolph and Frosty…those things ring a bell?” He turns into his office, past the nameplate T. Stark, PhD dropping the pages on his secretary’s desk. Without looking at his coworker, he strides further in, opening the door nestled a bit behind his secretary’s desk that leads to his office proper. Of course, he’s followed.

Hammer grins, leaning against Tony’s desk. “I was thinking more of roaring fireplaces…mulled wine and a nice brie…” 

Tony ignores him with a subtle roll of his eyes. He turns to his secretary, who’s poked his head in. “It’s 6:40, you’re making me feel like Ebeneezer Scrooge. Go on, join the party, have some charcuterie.” 

His secretary is oddly still for a moment. For a second, Tony considers kicking Hammer out, however abrupt it may be, but then the other man seems to snap out of it. “Thanks, Dr. Stark,” He says, standing and brushing off his sweater. 

Hammer, still encroaching on both their space, is still grinning at Tony, all slicked back hair and starched collar. “How about tomorrow night?”

Tony just sternly points to the open door. Hammer sighs, but follows his secretary out. He rounds the office to stand behind his desk, taking a seat and dialing the phone. 

“Stark-Strange residence. This is Peter speaking.” 

Tony smiles, all previous traces of his hard exterior melting away. “Hey, Pete.” 

“Dad!” Peter chirps. “When are you gonna be home?”

“Soon enough. You better be in bed when I get there, though. Don’t think I don’t know about your and Ned’s all-nighter.” He says. 

Peter’s sigh is audible over the line. “Mean.” He complains. “Is Pops coming home with you?”

The nail of his pointer digs slightly into the meat of his thumb. “We’ll see,” He says. “Don’t blow up the house.” 

“Yessir!” Peter snickers before hanging up. Tony looks down at his phone, checking to see if he’s missed any calls. Maybe there wasn’t time before the flight, he tells himself. He’s made up the spare room, just in case. 

 

Stephen, bundled into a coat, stands in the overlarge baggage claim exit, his eyes landing on the young man standing near one of the doors. He’s in an ill-fitting suit, drumming his fingers in an odd beat on a large sign, SHIELD printed neatly on the top, Stephen Strange written boldly and a tad messily below it. 

He stops in front of the young man. “I’m Stephen Strange,” He introduces. 

The kid grins. “Ross. I’m your limo driver. Hey, nice bag.” He turns on his heel and starts walking out of the terminal, swinging the sign a little as he walks. Stephen starts after him, tugging his scarf on with one hand, struggling with his bag with the other. 

“Ross, don’t you take this stuff?” He asks, more curious than demanding.

Ross halts and looks over at him, sheepish. “Do I? I’m sorry. You’re gonna have to help me, man. This is my first time driving a limo,” He says as he reaches over for the bag. 

Stephen waves him off. “That’s okay. This is my first time riding one.” 

 

In the limo, Ross looks over at Strange as he peels out from the wide three-lane that wraps the front terminal. “So…” He drawls. “I know where I’m taking you—duh—but where to after that? You got a hotel, or you staying with a friend?” One pierced brow waggles slightly. “Is this a special friend situation?” 

Stephen rolls his eyes. “I’m married,” He says plainly. 

“They live here?” Ross asks. 

“For the past six months, yeah,” Stephen says. 

“And you still live in Philly?” 

Stephen sighs. “You’re nosey, you know that, Ross?” 

His driver shrugs as he merges onto the highway. “I’m getting my psych degree. I like figuring people out. Part of the job, man.” 

“You wanna be a psychiatrist?” Stephen asks.

Ross shrugs. “I’m thinkin’ ‘bout it.” He says. “Dr. Ross sounds pretty sick.” A beat. “So…you divorced, or what?” 

 

Stephen gives up. “He got a good job offer.” 

“One that meant moving here? Why didn’t you come?”

His mouth twists. “I’ve been working at the same hospital since I was an intern. I couldn’t just up and leave.” 

Ross squints at him without turning. “You didn’t think this whole New York thing was gonna last?”

“I—” Stephen sighs. “No. He’s brilliant. Anything he puts his mind to will last. It was just…a difference of opinion.” 

“Sounds to me like you’re both too stubborn for your own good.” Ross says lightly. 

For the second time that day, Stephen leans his head back into the seat. “Probably.” 

 

 

“Listen, man,” Ross says, bouncing on his toes, standing by the trunk, craning his neck up to look at the building towering over them. “So, you head up to that party; your guy sees you, you run into each other's arms, music comes up, you live happily ever after. That the goal?”

Even as he’s shaking his head, Stephen replies, “It’s corny, but I could live with it.” 

“And…if it doesn’t?”

“Guess I find a hotel.” 

Ross gives him a scrutinizing look, and, for the first time, Stephen really sees the sharp intelligence in his dark eyes, hidden behind heavy eyeliner and a lackadaisical attitude. “Tell you what,” Ross says. “I’ll pull into the parking garage and wait. You two make up, you give me a call and I’ll leave your bags inside at the desk. If not, I’ll get you to a hotel.” 

 

Stephen smiles at him. “You’re alright, Ross. Thank you,” 

Ross gives him a wink. “Just remember that when you sign the tip,” He jerks a thumb towards the highrise, lit by blinding spotlights. “They’re footing the bill, so don’t be afraid to be generous.”

 

The lobby is deserted save for a single security guard standing behind the desk. Stephen strides in, casting a quick glance around. The ceilings are high, at least thirty feet, a Christmas tree a bit over half that size centered in front of a massive fireplace with a few leather couches scattered around it. 

“Hey, I’m looking for Tony Stark-Strange,” 

The guard nods to a small console on the desk. “Just type it in there,” 

Stephen raises a brow but does as he's told, only to for the console to emit a small beep, the words NO SUCH EMPLOYEE LISTED appeared across the screen. Stephen frowns for a second, then exhales roughly. He tries again, this time ‘Stark, Tony’ and a small model of the building appears on the screen, a room on the 30th floor highlighted. 

He’s directed to the elevator and told to ‘get off where he hears all the noise’. 

Stephen is greeted by the sight of a massive party in full swing. Music— Ode to Joy, it sounds like—is playing over what must be a massively expensive speaker system. It seems like every available surface is covered in some sort of tinsel or lights, twinkling and shining under the overhead lights. 

He looks around, craning his neck to try and get a glimpse of Tony. Making his way through the crowd, Stephen glances at every face, flushed cheeks and wide grins, tipsy stumbling and laughing. 

Abruptly, he bumps into somebody. Stephen stumbles back a little, but rights himself. “Shit,” He mutters. “Sorry,” 

The man he bumped into, around his height but definitely broader, stares back. His eyes are a pale, icy blue, almost startlingly so. “It’s fine,” The man says after a beat. “Are you looking for somebody?”

 

Stephen adjusts the collar of his coat. “Tony Stark?” 

The man nods, still a second off. He must not be holding his drink well. “Third office on the left, down the hallway back there,” The man says, pointing off to the side to a hall partially hidden by yet another Christmas tree. 

“Thanks,” Stephen steps around him and makes directly for the hallway.

Though he doesn’t see it, Bucky Barnes swivels to watch him, eyes wide. “Shit,” He breathes, running a metal hand through dark brown hair. He knew Tinsel said it would feel weird—he knew firsthand it would, after Westblooms—but snapping out of the magic felt like getting a massive bucket of water poured over his head. Bucky glanced down at his watch. 

He needs to find Percy. 

 

 

Percy finds him, actually. His boyfriend is dressed slightly more casual than Bucky’s suit, but not by much. He’s wearing nice slacks and a button-up with a sweater overtop and a tie, glasses perched on his nose. He also looks incredibly stressed. 

Bucky catches him by the arm as he rounds a corner. “Perce?” He asks, just for a second absolutely terrified that Percy hasn’t yet snapped out of it as well. To his relief, though, Percy’s hand overlaps his. “Hey,” He breathes. “Jamie, we have a problem.” 

“If it’s Stephen,” Bucky says. “I saw him, like, five minutes ago.” 

Percy shakes his head. “James, I think we fucked up.” 

Bucky’s brows shoot up.

“We should have been more specific. Christmas movie. Should have said Hallmark movie, or something.” Percy says, chewing on the inside of his cheek.

“What?” Bucky asks, confused. 

Percy tilts his head to the side a little, face distant and clouded. “Is there a company logo or anything around here?” 

Confused, Bucky obliges, looking around the plaza. From the corner they’re standing in, he can see a large engraved metal sign hung over the fireplace. “Nakatomi Plaza,” He reads aloud. Bucky turns back to Percy to see his boyfriend with his face buried in his hands. “What?” He asks. 

“Do you remember that movie I made you watch last Christmas Eve?” Percy asks, strangled. 

Bucky pauses, thinking. “The one we didn’t finish?”

“We did finish it,” Percy corrects. “It was just…muted.” 

“Right,” Bucky says. “Because you accidentally laid back on the remote when I was—” 

“Yep,” Percy says. “So that was your fault.” He sobers. “James, we were watching fucking Die Hard. We’re in Die Hard.” 

It takes a minute for Bucky to remember—machine gun bursts and shattered glass, C-4 and hostages. Right. Die Hard. “Why the fuck are in that one? Why not, like, Hot Frosty?” 

“Do not bring up Hot Frosty to me. And, well…Tinsel chose the movie last time, right? Would Tinsel choose Die Hard?”

“I don’t think so,” Bucky said immediately. “Not their style.” He regards Percy curiously. “Were you thinking about Die Hard when they did the spell?” 

A pause. Percy ducked his head a bit. His ears were red. “Maybe. Were you?”

…Bucky refused to be ashamed. He thought about the noises Percy made a lot. “Yep.” 

They both stood in silence for a moment. “Shit.” They said in unison. 

“So, terrorists are gonna attack the building.” Bucky said. “That happened, like, right after John McClain showed up, right?” 

“Uh…like half an hour after? 45 minutes?” Percy offered. Bucky checked his watch. “Fuck. It’s been twenty.”

“We need to find Peter and Nat.” Percy said. “Tinsel said snapping them out of it should be way easier than last time.” 

Bucky nodded. “I’ll find Nat, you poke around and learn what you can.”

 

While Bucky began to navigate the crowd in search of Natasha, Percy did what he did best—be nosy. He found Stephen almost immediately and began tailing him. 

“Excuse me,” Stephen says. “I’m looking for—”

“Tony Stark?” Fury says. He holds out his hand, and Gods, is it weird to see the man acting so… normal. It’s not really Fury, just like how last year it wasn’t really Rumlow, but still. “Nick Fury. I’ve spent half my life on airplanes, I can recognize the look of somebody who just got off one.” 

Stephen smiles a bit, despite himself, as Fury tells him, “I’m assuming you’ve already dropped by his office? I think he went down to one of the copier rooms. He’ll return in a moment, if you want to go back.” 

Stephen nods. “Thanks, I’ll do that.” He casts an appreciative glance around. “Nice place you’ve got here.” 

Fury takes a sip of his drink. “It will be if we ever get it finished. There are still several floors under construction.” 

Percy slips around them and into Tony’s office, stopping to listen briefly to the person inside. He opens the door and enters just as Fury leads Stephen into the hallway, quickly sitting at his desk just as they round the corner into Tony’s office. 

“Ah,” Fury says, stopping right by the door. “This is Mr. Percy Jackson, Tony’s assistant.” 

Percy rises smoothly from his desk as if he’d been here the whole time, holding out a hand as a plan quickly formulates in his mind. “You must be Stephen!” He exclaims, smiling, all dimples and crinkled eyes. “I’ve heard so much about you!”

Stephen shakes his hand on autopilot, looking a bit shocked. “Have you?” 

He nods. “All goods things, promise.” He says lightly. “He’ll be really happy to see you.” Percy casts a preformative glance to the other door to his right that leads into the office proper, where fucking Hammer is sitting at Tony’s desk. “Tony’ll be back in a minute, but I’m sure he won’t mind you making yourself comfortable in there.” He makes a small face. “Though it looks like someone is trying to beat you to it.” 

Stephen’s eyes narrow slightly, and, internally, Percy grins. 

The following conversation with Justin Hammer is awkward and awful, Fury’s obvious disapproval and Stephen’s suspiciously protective icy demeanor. 

Tony enters not a few minutes later. He stops briefly in front of Percy’s desk, not yet noticing the ajar door. “I thought I told you to head on out to the party,” He says. 

Percy waved him off, rolling his eyes a bit. “Party got a bit too loud,” He dismisses. “Besides,” He says, leaning in. “You have a visitor.” Tony’s heart rate jumps slightly and Percy grins wolfishly. “Hammer’s in there, too. I think your darling Stephen is about to punch him.” 

The moment Percy utters the name Stephen, Tony is practically throwing the door in. He stops still in the doorway, hand falling limp to his side. 

“Tony,” Stephen breathes, lips parting slightly. 

“Stephen,” Tony replies softly. There’s a brief moment of hesitation, then Tony is placing the papers in his hands on a nearby table to free his hands, stepping towards Stephen and pulling him into a short embrace.

It’s impossible to miss the way Stephen practically melts into his arms. 

Percy quietly raps his knuckles on the doorframe. “Mr. Fury? Someone was looking for you,” He lies. Fury, the smallest calculating smile on his face as he watches Stephen and Tony, nods and straightens. “Excuse me,” He says to the pair. Then, “Hammer,” 

Hammer scampers out after him, his eyes repeatedly flicking back to Tony. 

Mission accomplished. Percy softly closes the door, the barest click as to not interrupt the little moment the two are having. Time to find James. 

 

 

Inside Tony’s office, in the private bathroom off to the side, Stephen leans against the counter after freshening up. Tony sits on the counter, watching him. 

 

“You know,” Stephen says, removing his tie. “I think Hammer’s got his eye on you.” 

Tony rolls his eyes. “If IQ points were TNT, Justin Hammer couldn’t blow his nose.” 

Despite himself, Stephen smiles. He’d missed that snark. 

“So,” Tony says. “Where are you staying? This all happened so fast I didn’t even ask you on the phone.”

“Well,” Stephen says, “My old Attending retired out here a couple years ago. She offered up her spare room.”

“Oh,” Tony says, studying the floor tiles. “Where does she live?” 

“Pomona,” Stephen replies. 

“Pomona? You’ll be in the car the whole time...Look, let's make this easy.  I have a spare bedroom.  It's not huge, but Pete would love to have you at the house.”

Stephen glances up at him. “He would?” A small smile is tugging at the corner of his mouth. 

Tony fixes a surprisingly open look on him. “I would, too.” He seems to steel himself. “I’ve missed you.” 

Something flashes over Stephen’s face as he turns to face Tony fully, leaning against the doorframe. “I guess you didn’t miss my last name, though. Since when did you start going by just Dr. Stark?”  

A sigh escapes Tony, his shoulders dropping a bit. “Stephen—”

“We’re married, Tony, you—”

“We’re not having this conversation again, we had it last July—”

“We never finished this conversation in July.” Stephen says firmly. 

“I had an opportunity, Stephen. I had to take it.”

“Yeah, right, no matter the consequences,” Stephen tacks on bitterly. “No matter what it did to our marriage.” 

That all-too-familiar stubborn look graces Tony’s face. “Stephen, do you have any idea how perfect this job is for me? I’m finally doing what I’ve always wanted.” 

Stephen scrubs a hand down his face. “Fuck, Tony, I know, and I’m damn proud of you. Alright? I just…I wish you’d have thought about what I wanted.” 

His husband looks to the side, his jaw working. “You didn’t make it very easy.” He says flatly. 

The door opens, interrupting Stephen’s response. A woman, dressed in nice slacks and a tie, stands in the doorway. She briefly eyes the two of them, blue eyes flicking back and forth between them before fixing on Tony. “Fury wants you to say something,” She says, jabbing her thumb behind her and towards the distant source of the noise. The woman looks back at Stephen, something analytical in her gaze. She doesn’t wait for a response, turning on her heel, bright red hair flicking over her shoulder as she leaves. 

Tony stands, biting the inside of his cheek. “Be back in a few minutes.” 

Stephen watches him leave, shutting the door behind him. He closes his eyes and lets his head hit the doorframe with a dull thunk. “Great job,” He mutters to himself. “Very mature.”

 

Natasha presses herself back around the corner as Tony exits the office, pausing to run a harried hand through his hair as he straightens his tie. Even in this odd parallel not-quite-real world, it’s fascinating to watch how easily he can switch demeanors, stressed and a little bit lovesick to confident and easy-going as he walks away from her down the hall. 

The second he’s out of sight, Natasha checks her phone. She’d been tracked down and quickly brought back to reality only minutes ago, and had immediately set off on her mission following a text from Percy, who had been on the search for any other allies. Last time, Tinsel had brought the entire SWORD team and even some of Peter’s friends into it, though this time, maybe not having a bunch of teenagers would be for the better. 

[Percy: fuck fuck fuck they’re fighting ]

[Percy: interrupt them please one of you ]

She stared at the old messages for a moment, waiting. A moment later, a soft ping and a new one. 

[Bucky: nat you need to convince stephen to not take his shoes off ]

[Bucky: say literally whatever ]

Natasha squints at the screen, sighs, and walks back into Tony’s office. Stephen is still standing in the en suite, not in her line of sight. Natasha, soundless even in her heels, steps inside and quickly scans the room. She grabs the first thing she sees—a vase full of flowers, and executes a perfect three-pointer with it. 

It smashes into the wall, glass shattering across the floor, and Stephen swears loudly, practically bursting out of the en suite, but she’s already gone.  

[Natasha: Done. If anyone asks, a drunk couple looking for somewhere private stumbled in and knocked it over. ]

 

The three meet up in an empty conference room. 

“We’ve got, like, ten minutes, tops.” Percy opens with. “I found Spencer and Bridgette. They’re accountants, now.” 

“Gross.” Bucky says. 

Percy frowns at him. “Rude.”

“Math nerd.” 

Percy looks affronted.

Bucky dismissively turns to Natasha. “It’s his darkest secret. He skipped like two years of math in school. Started taking calc as an underclassmen.” 

Natasha looked at Percy consideringly. Huh. You learn something new about someone every day. “Well, are we bringing them in or not?” 

Bucky sighed. “I think we’re gonna have to. John McClane was a cop. Stephen is an unarmed surgeon. I don’t even think he’s a wizard this time.” 

“And we don’t have time to remind him that he is,” Percy finished. “Let alone explain the plot of Die Hard, because there is no way in Hell this man has watched it.” 

“Finding the SWORD members will be faster and easier,” Natasha concluded. “Tinsel put way less magic on them, this time around.” 

 

Percy is sent to start hunting his employees down, and he does so with vicious efficiency. At one point, when he finds Mal, he just grabs her by the shoulder and very intently says “Party City.” She gasps like she’s been dramatically resuscitated on live television.

Percy, Mal, Bridgette, Spencer, and Dan return to the conference room five minutes later to see Bucky and Natasha have drawn the shades and locked the door to cover up the massive blueprint they’ve drawn onto the whiteboard at the far side of the room.

Natasha turns to briefly greet them, pauses, and looks back. “No Ross or Lee?”

“Can’t find ‘em.” Dan says. 

Bucky caps his Expo marker. “Ross, I get. But Lee? She’s, like, a foot taller than everyone here. Have you tried just looking up?”

“Yes,” Mal and Dan chorus. “First thing we did.” 

Natasha sighs. “Right, well, we’ll have to keep an eye out. You’re all up to speed?’

Mal nods. “Die Hard. No John McClane, just wimpy surgeon Stephen. Useless gay people.” 

The redhead purses her lips slightly. “Sure,” She allows after a second. “That’s a way to put it.” 

Bucky checks his watch. “First things first,” He orders. “We need to block off this floor. The party’s contained here, everywhere else should be empty. First thing the terrorists go for is the hostages—it’s up to us to stop that from happening.” 

“Wait, so,” Dan interjects. “We’re just killing these guys, or…?”

“Not…immediately.” Percy says. “Once we fulfill the plot, the movie’s over. Tony and Stephen will snap out of it. If they don’t reconcile and confess their love in the movie, then all we’ve done is made it awkward for them in real life.” 

“And if that happens, and, somehow, Gods forbid everything gets worse, I’m blowing up the Hub with all of us in it.” Bucky says solemnly. 

Percy nods in agreement. “We need to give them time. Nice, happy, calm time together. Not hostage time.” He explains, Natasha shaking her head behind him. “No hostage time.” 

“So…” Bridgette draws out. “Fulfill the plot of Die Hard in an appropriate amount of Die Hard time while simultaneously circumventing the plot of Die Hard by preventing the hostage situation that is, like, 80% of the plot of Die Hard?”

“Yeah.” 

“Pretty much.”

“Sounds right.” 

The SWORD members look at them in silence for a moment. “Okay.” Spencer finally says, speaking for the first time. 

 

 

They split up. 

 

Natasha pickpockets fake-Fury and spends no longer than thirty seconds getting into his phone. Then, she tracks down the Head of Security—it’s Happy, she notes with glee—and steals his keys from right under his nose. From there, she manages to engage the electronic locks on the doors to the stairwell. After that, she wanders between floors until she finds a janitor’s closet. 

The out of order signs seem to just call her. 

She goes around merrily slapping them on every non-elevator access door she can find, locking them as she goes. 

Bucky follows her and begins crushing doorknobs and barricading doorways. Unless the terrorists want to waste their C-4, the two highly doubt they’ll be able to get through any of them. 

 

Percy, on the other hand, heads to the lobby with Bridgette. 

 

Down in the garage, a semi truck turns down the ramp into the parking garage beneath the plaza. It backs up to the loading dock, parking. A large group of men, standing ready, exit from the back as soon as it opens, many with duffel bags slung over their shoulders. 

In the lead, in a tailored suit and double-breasted coat, Hans Gruber strides towards the service entrance of the building, his men behind him. 

 

Elsewhere, a young man with glasses sits behind a computer, humming to himself as he works. By his hand, the security grates close over the garage entrances and the elevators lock out below the twenty-ninth floor. 

On said twenty-ninth floor, a different young man with glasses frowns at his own computer. He pulls out his phone, sending a quick text.

[Dan: It’s starting. Elevators are locked out below 29, basement levels sealed off ]

Dan cracks his knuckles and gets to work.

 

Down in the lobby, the men flood in through the hallways leading to the sublevels. Confident, they stride into the lobby to surround the front desk, only to be greeted by the face of a young woman sitting there, smiling at them. 

Hans stops cold, dark eyes fixed on her. His face takes on a calculating look as he slowly, casually, reaches into his coat pocket, fingers wrapping around a pistol. 

Bridgette, beneath the desk, digs her nails into the meat of her palm. “Eddie sends his regards.” She says politely. “And his apologies that he could not make it.” 

She has the pleasure of watching complete and utter confusion flit across Hans’s face. “Did he?” The man asks. Bridgette swallows dryly, but it’s not out of fear. Listen…she’s in a wonderful relationship with the love of her life, but…

“He did, Mr. Gruber.” She says, propping her chin up in her hand. “He also has this for you,” She says, sliding the small device across the desk. 

Hans’s eyes don’t leave hers, nor his hand leave his coat pocket, as he leans in to pick it up. He inspects it briefly, then nods shortly. He hands it off to another man, who quickly attaches it to the electronic lock on the side of the main door, which flashes red as the locks engage. “And…where is Eddie?” Lord, that man’s voice has no business being that rich. 

Bridgette shrugs delicately. “He doesn’t tell me personal things.” She casts a careless look behind her, at the elevators. “Oh,” She says, putting a little airy aloofness into her voice, “But he did also want me to tell you that more people than expected left early, whatever that means. But Fury is still here.” 

He’s still watching her. Bridgette is not God’s strongest soldier. 

She smiles at him. “But what do I know? I’m just a secretary.” Bridgette winks.

Seemingly mollified for now, Hans nods slowly and turns to Theo. Wordlessly, the two head out of her view, down the hallway. 

Bridgette exhales, deflating slightly. 

“Really?” A voice hisses out. 

She looks down at Percy, crouching under the desk. “Okay,” She defends. “He…well…Lee doesn’t mind!” She rushes out, face pink. “I mean, seriously, his voice, Jackson.” 

He’s squinting at her from behind his glasses. They’re a good look on him, though they do literally nothing, she thinks. Barnes definitely likes them. She keeps that tidbit in the back of her mind for future blackmail. “He really that hot?” He asks.

Bridgette nods before he’s even finished. “Yes.” 

He just sighs. “Sure.” 

 

Down in the basement, a tall blonde man slides down an access stairwell, stopping to crouch by the fuse box. Pacific Bell Employees Only, reads the sign posted on the exterior. 

He drops his bag and pulls out a thick pair of gloves and an electric saw. 

A large metal case sits to his left as he forces the fuse box open and begins pulling wires, attaching a few with metal jumpers before cutting a small red one, hidden in the back of the box.

 

In Tony’s office, Stephen pulls the number Ross gave him out of his wallet. He dials it on the phone attached to the wall, leaning against the doorframe. 

“Hey, man!” Ross chirps once he picks up. “How’s it going with your guy?”

Stephen’s mouth twists. “Vote’s not in yet.” 

 

Karl joins his brother beneath the tower, though he has a protective mask and a large saw, which he immediately hefts, beginning to cut through the large pipes amidst his brother’s protests, who is now furiously working on splicing the last few wires, sweat dripping down his nose. 

Finn barely manages to attach the final cable as Karl disables the telephone junction box, looking up and glaring at his brother.

 

Upstairs, Stephen’s connection to Ross is abruptly ended. He frowns at the receiver. “Ross?” 

 

Hans stands at attention in the elevator as, behind him, the sounds of guns being loaded echoes throughout the small space. He, himself, once again curls his fingers around the handle of his pistol, but doesn’t yet take it out. 

A great shudder stops the elevator in its tracks. The overhead lights flicker out for a moment before returning. 

 

[Dan: GO GO GO GO ]

[Dan: GET THEM OUT ]

 

Natasha and Bucky exchange wide-eyed looks before rushing out, one to Tony’s office and the other to the party. 

Bucky wastes no time sprinting down the halls at top speeds—the benefit of Tinsel’s magic is that the few people that do see him pay him little mind, even as he easily tops the speed of an Olympic sprinter while in a suit. He barrels into Tony’s office, taking a short half-second to compose himself before entering the ensuite. “Excuse me?” He calls out. 

Stephen looks up at him, hanging up the phone. Based on the slight furrow in his brow, it must have already been disconnected. There’s glass shattered all over the floor—Natasha’s doing, he assumes. 

Plastering a smile on his face, Bucky tears his eyes away from the mess. “Hi, sorry. Unfortunately, I’m going to have to ask you to briefly vacate this office while it gets cleaned—we had a…bit of an incident earlier with a pair that indulged a tad too much with the champagne.” He looks pointedly down at the glass. “Safety hazard. You can enjoy the festivities for a bit while we take care of it.”

Predictably, Stephen, not particularly sociable, looks a bit uncomfortable. “I’m not a Nakatomi employee,” He says. “I don’t think…” 

“You’re a guest,” Bucky says. “Please, have fun. The entire department is here.” He says that like it’s enticing, when, to Stephen, he knows it’s the exact opposite. He watched the man and lets the ‘realization’ dawn obviously on his face. “Not a fan of parties?” 

 

Stephen shrugs slightly. “Not particularly,” He admits.

Bucky bites his lip, all hesitant and unsure. “I’m sorry, but I really can’t have you stay here. It’s policy—too much potential for injury and lawsuits.” He explains haplessly. He lowers his voice a little. “If you really want to stay out of it, go out to the elevators—the middle one is down for maintenance, but the other two are fine." More like there's a squad of armed terrorists stuck in it, but, whatever. "Take it a floor up. There’s a big lounge right down the center hall—can’t miss it.” When Stephen says nothing, Bucky adds on, “You’re Stephen, right? Tony’s husband? I’ll tell him you’re up there. He’ll meet you. Truthfully, I think his patience is wearing a bit thin, too.” 

That seems to do the trick. Stephen’s shoulders relax a bit and he nods. “I’ll do that. Thank you.” 

Bucky nods. “Just doing my job.” 

 

Out on the main floor, Natasha pushes her way through the crowd, towards the thick throng of people that have naturally congregated around Tony. “Dr. Stark!” She calls, thinking quickly. At present, she has no clue how Bucky is convincing Stephen to go up to the lounge, so she’ll need to get creative. For all she knows, the poor man might be having his unconscious body dragged up a stairwell by an ex-assassin. Tony turns to her. “Ms. Rushman,” He greets. “Enjoying the party?” 

“I’d be enjoying it a bit more if I hadn’t been fielding calls from Reed Industries for the past ten minutes,” Natasha lies smoothly. “Do you have a minute? I’ve got Dr. Richards on hold in my office—just a second of your time,” She says, almost desperate. 

“Of course,” Tony says immediately. “Lead the way.” 

She catches the left elevator closing just as her and Tony turn the corner. The lights on the middle panel are completely out—they probably don’t have a lot of time before Gruber gets impatient. They go to the one on the right, but at the last minute, Natasha pushes the button and steps back out. As the doors close, she calls out, “My office right there, just past the lounge! Can’t miss it!” 

 

[Bucky: dropped stephen off. ]

[Bucky: in the stairwell ]

[Nat: Sent Tony up ]

[Dan: ten seconds ]

 

Natasha takes that as her cue to duck out of sight, hurrying to get as far away from the elevators as possible. True to his word, ten seconds later, she hears the soft ding of the middle elevator. 

 

[Dan: all doors are locked. left and right elevators are down, middle one is skipping the thirtieth floor. elevator won’t register it

 

And, just like that, Tony and Stephen were stuck together. 

 

In the security room, ignoring Dan’s furious typing, Mal hums as she messes with the building’s intercom system. Crouched beneath the desk, pliers hanging from her mouth, she snips a small wire and twists it, connecting it to another, leading up to a small power bank that her phone is plugged into. 

Mal leans into the mic. “Apologies,” She says as robotically as she can, watching the light labeled 31 blink back at her. “The plaza is experiencing a sudden power outage. We have been forced to use our emergency generators. For the time being and our safety, all doors will remain sealed and the elevators are out of service. We apologize for this inconvenience. Rest assured, this will be fixed by the end of the night. Please enjoy the party in the meantime.” 

She flicks off the mic, then turns to Dan, who’s still intently hunched over his computer. Nerd.

 

The middle elevator slides open. Almost silently, unnoticed, nine men, shoulder to shoulder, step out, guns raised at the ready. The music overhead abruptly cuts off as the gunshots begin, fired upwards into the ceiling. 

The screaming begins almost immediately. The men fan out and ruthlessly drag everyone they find out from the offices and hallways, corralling them all into the main plaza. 

“Shit,” Natasha hisses, pressed behind a door. Fortunately for her, while these men do seem to know what they’re doing, their situational awareness seems to be lacking. She slips out from her hiding spot and dashes to the stair access door at the end of the hall, which quietly unlocks just as she reaches it. The second it’s closed behind her, she breathes a sigh of relief.

[Nat: Thanks, Dan. Heading up to the 32nd.] 

She resists the urge for a brief pitstop on the 31st to eavesdrop on Tony and Stephen, instead heading up to first of the half-constructed floors. The walls are bare drywall, a myriad of exposed supports, scaffolding, and tarps filling up the space in lieu of cubicles and offices. 

 

“Ladies and Gentlemen,” Hans says, stepping out in front of the crowd, voice comparatively calm and gentle to the muffled screams and sobs laid out before him, all backdropped by the artificial waterfall that cascaded down the wall by Fury’s office. He idly flipped through a few pages of a small, leather-bound book in his hands, almost the exact same shade of scarlet as his silk tie. “Due to the Nakatomi corporation’s legacy of greed around the globe, they’re about to be taught a lesson in the real use of power.” He says. “You will be witnesses.” He closes the book with a soft snap. “Now, where is Mr. Fury?”

Hans scans the crowd, eyes raking over each and every person. “Nicholas Joseph Fury,” He says cooly, beginning to slowly descend the steps from the elevators. “Born Huntsville Alabama, July 4th, 1937. Interned at Manzanar, 1942-1943.” He begins to circle the crowd, stopping to make eye contact with people that catch his eye. “University of California on scholarship, 1955. Law degree, Stanford, 1962. MBA, Harvard, 1970. President, Nakatomi Trading—”

“Enough.” Fury stands from the crowd. 

Hans turns to face him. “And Vice Chairman, Nakatomi Investment Group.” He finishes. 

“That’s me.” Fury says, stone-faced.

Hans smiles at him. “How do you do? It’s a pleasure to meet you.” Fury is grabbed the the collar of his suit but one of the men, Karl, and goes willingly as he is dragged, a myriad of fearful gasps erupting from behind him. 

 

Meanwhile, Natasha, crouched on a high, unfinished pillar, peeks out from behind a tarp. Slowly, she taps the small, outdated comm Dan had scrounged up, and, by the sounds of it, had just got working. “Hey, guys,” She whispers. “Three guys just brought a missile up here.” 

“...Fun.” Mal whispers back. “Can I have it?”

“I don’t know,” Percy replies dryly with a soft grunt. “Have you been good this year?” 

“I’m wonderful every year.” She replied indignantly. 

There’s a small heave over the line. “Debatable.” 

“Mean. What are you doing?” 

“Elevators are down, and they have the stairwells,” Percy says. 

Natasha’s lips curl up into a smile. “Jackson, are you climbing up the elevator shaft?”

“Maybe.” He breathes. Then, “Climbed, past tense. I’m heading for Fury’s office.”

“I’m obsessed with you.” Bucky’s voice joins the conference. 

“...Is Hans in there?” Bridgette asks. 

“Seems like it.” Percy replies. He pauses for a long minute. “Bridgette, do you want me to get close enough for you to hear him?”

A soft, almost ashamed sigh. “Yes.” 

Percy huffs out a small laugh. “I’ll do my best.” 

Natasha settles in to watch the missile get wheeled in on its little cart. She wonders, briefly, if they brought the cart with them. 

 

Hans runs his fingertip lightly over the model of Nakatomi Plaza that sits on display in the middle of Fury’s office. “And when Alexander saw the breadth of his domain, he wept, for there were no more worlds left to conquer,” He drawls, a soft chuckle leaving him as he glanced at Fury. “The benefits of a classical education.” He wandered, next, to a model of Nakatomi’s next project in Indonesia. 

As Fury gave a tight reply about developing a region, not exploiting it, Percy rolled his eyes. “Classical education,” He muttered. “I spent half mine in jail and I bet I can speak Latin better than this clown.” 

Hans holds out a friendly arm to Fury. “We could discuss industrialization or men's fashions all day, but I'm afraid my associate, Mr. Theo, has some questions for you—sort of fill-in-the blanks questions, actually…” He says, leading Fury towards the desk where Theo, his computer open in front of him, sits. Glowing green, across the screen, spells out;

NAKATOMI CORPORATION.

BOARD WORKSTATION.

ENTER CENTRAL COMPUTER CODE KEY _ _ _ _.

Hans seats himself opposite of Theo, while Fury stands at the foot of the table. “I don’t have that code.” He says sternly. “You broke in here to access our computer? Any information you could get, once they wake up in the morning in Tokyo, they’ll change it. You won’t be able to blackmail our executives or threaten—”

“Sit down!” Hans barks, a sudden contrast to his calm demeanor. Fury does, and, abruptly, Hans is once soft-spoken. “Mr. Fury, I am not interested in your computer. I'm interested in the 640 million dollars in negotiable bearer bonds you have in your vault.” 

Fury’s lips part in subtle surprise. 

Hans smiles. “Yes...I know about them. The code key is a necessary step in accessing the vault.”

“You want money? What kind of terrorists are you?” Fury asks. 

Amused, Hans replies, “Who said we were terrorists?”

Behind them, Percy creeps along the outer wall, ducked behind the variety of furniture as he inches closer. “Oh, shit, guys,” He whispers. “I think they’re about to shoot him.” 

Hans is calmly detaching the silencer from his gun. “Now,” He says. “The code, please.” 

Fury shakes his head. “It's useless to you! There's seven safeguards in our vault, and the code key is only one of them. You'll never get it open,” He warns.

Hans lifts the gun. “Then,” He says. “There’s no reason not to tell it to us.” 

Across the table, Theo lazily spins his chair to Karl. “I told you…” He trails off. Karl rolls his eyes. “It’s not over yet.” Hans gives them both a stern look. In the back of the room, Finn, Karl’s brother, sits, annoyed. Hans’s eyes are fixated on Fury. “This is too nice a suit to ruin, Mr. Fury. I’m going to count to three. There will not be a four. Give me the code.” He cocks the gun. 

“One,” He says calmly, taking aim. “Two,” 

Fury shakes his head once more. “I don't know it, I’m telling you.” He insists. “Get on a jet to Tokyo and ask the chairman! You're just going to have to kill me.” 

“Oh, no.” Percy whispers flatly. It’s definitely Dan that giggles softly. 

Hans deliberates on this for no more than a second. “Okay.” He pulls the trigger, and Fury’s blood paints the glass pane behind him crimson. As Fury falls to the floor, Hans stands. “We’ll do it the hard way. Finn, see if you can dispose of that. Karl, you better go check on Heinrich’s work up on the machine floor.” 

“Nooooo,” Percy whispers. “Guys, I think he’s dead.” 

“Oh my fucking God they fucking killed him,” Dan whispers back. 

Karl leaves, leaving his brother behind to drag Fury’s body out of the room. Hans, standing over him, turns to Theo. “Now,” He says. “You can break the code?” 

Theo slings his coat over his shoulder. “You didn’t bring me along for my charming personality.”

Over the comms, Dan hisses out something unintelligible but very unkind. 

“Ooooh,” Mal sings softly. “Dan’s got competition.” 

There’s a dull thud that Percy assumes is him smacking her. 

 

“Thirty minutes to break through each lock, two and a half hours in total. The seventh is out of my hands.” Theo says. “The electromagnetic seal? The circuits can’t be cut locally.” 

Hans smiles. “Trust me.” Is all he says. 

 

 

 

Bucky casually strides into open half-constructed space, hands in his coat pockets. He cranes his neck up to the shadowed ceiling. “Nat,” He calls out. “TBH, IDK where you are, but I’m pulling the fire alarm.” The little red lever has been calling his name since he Awoke in his stupid building. 

He pulls it. It makes a funny little noise. 

Bucky turns to a knife in his face. “Did you just use texting acronyms verbally? Out loud? In front of me.” Natasha asks. 

“Maybe, LOL.” 

“I’ll fucking kill you right here, Barnes. We both know I’ll do it. Hans Gruber and I will be in Cancun before they even find your body.”

“Percy,” He reminds her. 

Natasha sighs and holsters her knife. “Goddamnit.” 

Bucky smiles pleasantly at her. 

“Hey, Hans just asked what floor the alarm got pulled on. Totally snitched on you two.” Bridgette says over the comms. 

Natasha sighs. “Really?”

Bucky shakes his head. “This is embarrassing. Stand up, Bridgette.” 

She just sighs over the line. “You’re gonna have  a couple guys with rifles coming up there in a second.”

“Kill them?” Bucky asks. Natasha nods eagerly. “Christ, you two perked up like Lea when she gets to chase birds.” A beat. “Yes, you can kill them.” Bucky and Natasha high-five. 

Heavy footsteps echo down the hallway. In the blink of an eye, both ex-assassins are once again perched up in the rafters, obscured by shadows and tarped scaffolding. They watch from above as two men enter, one fair and blonde and the other with dark, curly hair. 

“The fire has been called off, my friend,” The latter, James, calls out, his heavy rifle ready in his hands, slowly advancing into the room. “No one is coming to help you,” He flicks the lights on as he continues, eyes taking in every corner. “You might as well come out and join the others.” 

Bucky narrows his eyes. There can only be one James, here. 

James rounds a large stack of crates. “I promise I won’t hurt you.” 

 

Above him, the two make eye contact. Slowly, Natasha nods, and, without a sound, the two drop down from the rafters, landing in identical crouches. Natasha leaps at James, the tip of her knife pointed at his throat. Bucky stands behind her, reaching out and wrapping his hand around the barrel of the gun. It creaks lowly in his grip, but doesn’t yet warp—he doesn’t want to ruin it. He wants it, obviously. 

“Poor Christmas spirit,” Natasha critics. “Drop the weapon.” 

Then, Natasha fucking jumps the guy, landing on his back and wrapping her lights around his torso while she throttles him. It’s almost laughably easy how quickly they take him out. Bucky wrenches the gun from his arms as he’s weakly trying to pry her off and slams him to the ground, and Natasha is on him, slitting his throat with one sure movement. 

“Oh, wow,” Bucky says, standing over the man. “He’s bleeding glitter. How festive.” 

Natasha ooohs softly. “Nice touch from Tinsel.” 

The soft sound of a gun cocking echoes wildly. “Hands up.” 

Bucky looks at Natasha from the corner of his eye. “Oh, we are never hearing the end of this,” He whispers as he slowly raises his hands. She closes her eyes, a pained look on her face. “Percy can’t hear about this, do you understand me?” She hisses. 

“Turn around.” 

They do as they’re told. 

The other man, Finn, is standing in the doorway, an assault rifle aimed at the ready. 

The three stare at each other for a long minute. 

“Oh, hey, guys.” Lee says. 

“Lee?” They both yelp. 

“What’s up? I didn’t know you guys were here.” She asks casually, lowering her weapon. 

“What the fuck are you doing?” Natasha exclaims. 

Lee shrugs, adjusting the strap of her duffel bag. “Well…snapped out of it and realized what I was doing when I saw you escaping from the plaza,” She explains. “But, I figured at this point, I was already in too deep. They let me use power tools, you know?” 

“Oh, that’s cool.” Bucky nods. “The work’s good, then?”

“Hans Gruber offers dental and eye care,” Lee replies with a shrug. “Besides, not like I was up to much else.” 

“So you just…went with being a terrorist?” Bucky double-checks. 

That gets him a raised brow over the rim of her glasses. “Do you really want to go there?”

“Nope.” He says. “Just clarifying.” 

Lee nods approvingly. 

Natasha taps her comm. “I found Lee,” 

The line explodes with chatter, overlapping voices and surprised demands, plus Dan, who Bucky’s pretty sure is just screaming nonsensically. “Quiet!” Percy snaps. He’s pulled out the Dad Voice. It’s very effective—stern but not quite mean. “Lee?”  

“She’s a terrorist.” Bucky explains, pulling a spare comm from his coat pocket and tossing it to her. She puts it in with one hand, the other still holding her rifle. “I committed to the bit.” Lee says by way of introduction. “Me and my brother. It’s family bonding, I think.” 

“Aww,” Mal coos. 

 

Theo grins as the vault beeps with a final keystroke. The screen lights up green; 

DO YOU WANT TO PROCEED? 

“You bet your ass I want to proceed,” He leans in, pressing the button. As he waits for it to go through, he turns to the drill and readies it. A pause, then another small beep;

TOO BAD.

Theo does nothing but stare for a solid second. He enters the password once more, only to get a similar result, this time with a;

LOSER. 

He tries again. And a fourth, and a fifth, time. The screen responds in kind. 

UGLY LOSER. 

BAD OUTFIT. 

His eyes narrow and he pulls his computer towards himself. “Well,” Theo murmurs under his breath. “Looks like I’ve got company.” 

 

“Hey, Percy?” Bucky asks. 

“What’s up?” 

“Where are you right now?” 

“Fury’s office,” Percy says. “Comfy chair.”

“And what are you wearing, right now?” Natasha asks lowly in a poor imitation of Bucky’s voice. He turns to her and makes a face. Lee gasps gleefully—a motion she manages without her expression changing in the slightest. God, Bucky’s Hydra trainers would have loved her. So effortlessly stoic and unfeeling. Envy-inspiring, really. “Are you going to do the thing?”

“The thing!” Mal cheers. Then, softly to Dan, “What thing?”

“We can hear you, Mal,” Natasha says. “Percy?”

The sound of Percy spinning in Fury’s chair. “I don’t really give a fuck, to be honest.” 

For the second time that night, Natasha and Bucky high-five.

They set the cargo in the only working elevator. Lee stands silently behind them, absently playing with the lighter she lifted from her ex-coworker’s pockets. As soon as the elevator doors slide shut, Natasha flicks the emergency shut-off switch, bringing the car to a shuddering halt. Bucky easily pries the doors open and hefts himself up onto the floor, Natasha and Lee following suit. Once all three of them are level, he reaches down and flicks the switch again, then taking his arm out from the doors and allowing them to close. 

Then, they settle in and wait for the screams.

 

The hostages are forced back, out of view of the elevator, as Hans slowly strides towards it. James, propped up in an office chair and very clearly dead, says nothing, because he is very clearly dead. 

Hans straightens James’s sweatshirt, face cold. “Now we have a machine gun. Ho-Ho-Ho.” He reads aloud, lip curling. James’s Santa hat flops lifelessly over his equally lifeless eyes. Hans pulls his radio out and hands it off to Marco. “Try for Finn. He was with James. If he doesn’t respond, we must assume he has received…similar treatment.” 

He stares at James, calculating. This is not the work of a security guard. We, the morbid note reads. This is a team. 

Behind him, Marcos shakes his head. “Nothing from Finn.” 

Hans sighs. “Call Karl down. Tell him his brother is gone.” 

 

“Are we skipping the whole cop thing?” Mal asks, swiveling in her chair. Dan, very intensely engaged with his new mortal enemy, doesn’t reply. 

“I’m kinda bored,” Bridgette says with a sigh, similarly messing around at her reception desk down in the lobby. 

“We are,” Percy replies. He, too, is rapidly spinning in Fury’s chair. “If you’re bored, though…” He trails off and smiles. 

 

Bridgette stays where she is, but Dan patches her through to the security cameras so she can ‘play God’, in her words. They need someone with eyes while Dan is busy getting in an online fistfight, anyway. 

Mal and Percy meet up in the South stairwell. Dan still has a firm control over the electronic locks, so they have no issue bypassing the doors. Lee, Natasha, and Bucky begin tracking down more of Hans’s men, he and Mal go on a hunt of a more specific kind.

“About fifteen pounds of C-4!” Mal enthuses, bouncing on the balls of her feet. 

Percy squints for a moment, but fake-Fury’s death has put him in a good mood, so he just shrugs. “Yeah, alright.” 

They drop by the North stairwell to grab Spencer, who’s been quietly playing Tetris for the past hour. They can hear the sound of gunshots through the ceiling above—Natasha, Bucky, and Lee have clearly found some success. 

 

They head through a service entrance, shimmying through a few tight corridors and into the guts of the building. Percy holds out a hand, stopping the other two. “We’ve got two men,” He says softly. “One of them has the bag.” 

Mal giggles.

Spencer is chewing intently on his nails. Without acknowledging it, Percy gently pushes Spencer’s hand away from his mouth. Mal takes his palm, uncurls his fingers, and, from somewhere, produces a glob of silly putty and deposits it in his open hand. 

He looks at her in silent shock. 

“Emergency slime,” Mal whispers. 

Spencer fiddles with the putty. He doesn’t ask questions.

With a silent gesture for them to stay put, Percy creeps forward and around the corner. The two men are crouched beneath a large pipe, open bag between them. They’re speaking to each other, softly, loud enough for Percy to easily hear, but, unfortunately, not in a language he speaks. German, maybe? 

One of them has an open can of some sort of energy drink to the left of his planted knee, the opposite of Percy. With a sharp grin and an even sharper flick of his fingers, the can tips over and clatters noisily. Both men whip around, and, taking advantage of their momentary distraction, he steps out from his hiding spot and lunges forward. A swift kick knocks the first gun out of their reach, sliding across the concrete floor. 

The two whip around. The first lunges for Percy, slamming into him brutally, while the other scrambles for his gun. A swift uppercut and a right hook makes the unarmed one stagger back, and a sharp whip of battery-acid green liquid knocks the other off his feet. Percy steps on the muzzle of the gun and grins down at the two men as, behind him, churning and writhing in the air like a serpent, the now liberated energy drink mimics the movement of his fingers. “Hasn’t anyone ever told you these things will kill you?” He asks.

From behind him, Spencer steps out. Spencer now has a fucking machine gun. “Those can damage your heart,” The now incensed med student says. 

Slowly, Percy backs away. Mal is watching with wide eyes, though her attention is clearly divided between that and the C-4 bag, which she’s eyeing like a dog with a steak. 

Percy slowly reaches out and snags the bag, then hastily retreats until he’s shoulder to shoulder to Mal. Spencer is yelling, now. Loudly. Percy didn’t even know he could reach that volume. 

“Should we…go?” Mal whispers. 

Percy shrugs.

Spencer definitely kills those two guys, though.  

 

“Two down,” Percy says through the comms. “I’d be a little nicer to Spencer for a while, by the way.” 

Lee raises a brow. “Well,” She comments idly. “Natasha and Bucky are taking care of two more.” Behind her, Bucky repeatedly slams a man against the wall, steadily making a dent in the drywall. Natasha, on the other hand, has another man by neck and is giving him an absolutely foul wet willy. He’s screaming. She’s laughing. 

“We’re making good time.” She concludes.

“I’m going to do something drastic,” Dan cuts in. “I want to build a bomb. I want to kill this man. I want his head stuffed and displayed on my wall.” 

“Oh?” Bridgette asks. 

“Dan’s new boyfriend,” Lee dismisses as Nat executes a wonderful roundhouse kick. The man goes careening out the window, and Lee pokes her head out the adjacent window to watch him fall. “I can do that for you, if you get me the head, by the way.” There’s a dull thud and a sickening crack as the man hits the pavement below. “Also, I think the cops will be coming soon.” 

Natasha just shrugs sheepishly. 

Bucky looks over. “Oh, is that what we’re doing now?” With one hand, he punches the man out the window. 

Lee watches this one fall as well. “Well,” She says. “I suppose it is, now.” 

All three of them jump at the sound of sudden knocking. The corner window, thankfully unshattered, shakes slightly with the force of the knock. Natasha squints at the night sky outside, and absolutely does not yelp a little when something moves directly outside of it. 

“It’s kinda cold out here!” Peter yells, muffled through the glass. “Can you let me in?”

Bucky stares for a second, but then rushes forward and swiftly removes the shards of glass around one of the…’opened’ windows. Peter crawls in with a grateful grin, landing neatly on the floor. “Hey, guys!” 

“How’d you…” Natasha trails off, curious.

 

Peter brushes a light dusting of snow from his hair. He’s shivering a little, and Lee wordlessly takes off her coat and drapes it over him. It goes down to the middle of his shins, and he squished his face into the lined collar. “Well, I was just kinda sitting at home, and I was thinking, man, I can’t wait for my two parents to come home, and, like, two? In this economy? That was foreign enough to me that I just kinda snapped out of it, honestly. Why are you looking at me like that?”

Bucky pulled Peter into a hug while Natasha called in. “The boy has been acquired.” 

Outside, even from this height, the roar of police sirens rings through the night. The four creep closer to the edge, watching a flood of red and blue light draw closer. “Looks like somebody found the bodies,” Bridgette hums. 

Peter’s eyes zero in on the radio in Lee’s hand—the one she’d had from her terrorist gig. He makes grabby hands, and she hands it over without complaint. 

 

In Tony’s office, which has since been commandeered by Hans, Karl, Franco, and Alexander argue restlessly. 

“All of you relax,” Hans snaps overtop them. “This is a matter of inconvenient timing, that is all. Police action was inevitable,” He says. “...and, as it happens, necessary. So, let them fumble about outside and stay calm. This is simply the beginning.” 

On his desk, the radio crackles. He snatches it up. “I thought I told all of you I want radio silence until further—”

“Iiiiiiiiiii—” A truly astounding reproduction of the opening riff of Mariah Carey’s hit song All I Want for Christmas is You crackles over the radio. “Don’t want a lot fooooor Christmas,” 

Hans’s grip tightens painfully on the radio. “Who is this?” He demands. 

There is just oooooone thing I need,” Overtop the clearly young singer, another voice, this one belonging to a man. “James, Heinrich, Marco, Uli, and Kristoff.” The man says lowly. “Karl, Franco, Alexander, Fitz, and you.” 

“Halfway there,” A third voice, this one belonging to a woman. Then, the transmission cuts out. 

Before Hans can speak, another voice, similarly female, but slightly higher, perhaps younger. “We also got your Christmas gift!” She chirps happily. “I’d say give our thanks to Heinrich for delivering it, but…” She trails off, and ends the transmission. 

Hans, a frozen fury alight in his eyes, looks up at Karl, Franco, and Alexander. “Find them,” He snarls. “See if they’re lying, and find Heinrich’s bag.” He orders.

Karl is white-knuckling his weapon. “And my brother?” He asks, jaw tight. Finn’s name hadn’t been mentioned at all. 

“Do what you need to,” Hans dismisses. “And stay off the radios!” 

 

Franco and Alexander return only minutes later. “He wasn’t lying,” Franco says gravely. “Marco and Heinrich are lying on the street below. And Heinrich’s bag is missing.” The detonators. 

Swiftly, Hans picks up the radio and punches in a few numbers. “Theo,” He calls. 

“Yo!” Theo yells over the deafening whirring of the drill. 

“We may have some problems. How’s our schedule?” Hans asks. 

“Somebody is fucking with me, Hans! They have a tech guy! I’m two down, four to go, but I can’t do shit if this guy keeps getting in my way!” Theo hollers. 

“Give the radio to Fitz.” Hans orders. After a moment, “Fitz, find whoever is attempting to stop Theo. Kill them.” 

“Got it.” 

 

In the lobby, Bridgette watches as the police pull up, bathing her entire word in blue and red. The second one of them, a tall man with graying hair, sees her, his eyes widen. 

Bridgette stands and makes her way to the locked doors, staring at the assembled force. 

She reaches for Eddie’s radio. “Hans?” She asks softly. “I…don’t know what I’m supposed to do here. Eddie didn’t tell me this part.” 

There’s a brief pause. She’s still not entirely sure if Hans trusts her, like, at all, but she doesn’t particularly care. “Do what you must. Do not unlock the doors, no matter what they do, be it negotiation or threats.” 

“Yessir,” She says airily. Bridgette looks around for a moment before locating a loose piece of printer paper and a marker. She gets to work, leaning over the front desk, before returning to the windows. One man, the captain, by the looks of him, is gesturing desperately at the front door. Doing her best to look confused, Bridgette shakes her head. Then, she puts the piece of paper up against the window. 

“Sorry, we’re closed?” The glass is thick, but she can hear the captain’s outraged voice quite clearly. 

Bridgette shrugs glibly. 

Then, eyes wide, she turns around and rushes back to the front desk. “Oooh,” She enthused, grabbing her radio. “I’m gonna push the button! Hans, I’m pushing the button!” 

He sighs over the radio. 

Bridgette pushes the button. A large metal gate slowly makes its way down over the entrances, both front and side, of the lobby. Bridgette claps her hands together happily. Wonderful button! 

“Also,” She says. “I’m pretty sure they’re sending in a SWAT team.” 

 

Down in the garage, Ross turns down the music, looking up at the ceiling. “What the fuck was that noise?” 

 

Fritz sweeps the hallway, his gun drawn, shoulders in. As he turns the corner, he reaches out cautiously for the lightswitch, illuminating the half-constructed office space. He takes a step forward, only to be plunged back into darkness. 

He flicks the switch back on, lights turning back on. Faulty wiring, he dismisses. 

About three steps later, the lights turn back off. Fritz narrows his eyes. He turns them off, waits a long second, then proceeds.

The lights turn off. 

 

Peter creeps along the ceilings, half his attention on the hostages he can hear down the hall. Hans is in Tony’s office—rude—but his view of the back corner of the plaza is blocked by a truly impressively sized fern. Peter lands silently, ducking behind a cushy chair that is sat by the cold fireplace. 

Alexander, the only gunman left with the hostages, does a casual sweep every few minutes, but his attention lies elsewhere, directed towards the elevators and stairwells on the opposite side of the grand plaza—coincidentally, closer to Hans, as well. 

 

“Psst,” Peter hisses. Fearfully, the woman closest to him whips around, eyes wide. Quickly, Peter puts a finger to his lips. Seeing that he is just a little guy, the woman calms, but only slightly. He smiles at her. “You wanna get out of here?” 

She glances once at Alexander, his back momentarily turned, then nods frantically. 

Peter holds out an arm. “You scared of heights?” He whispers. 

 

 

Fritz roughly slams the lightswitch, knocking his fist against it. That usually works with electronics issues, doesn’t it?

To his relief, the light stays on. He advances, gun at the ready. Now harshly lit, he can see around the half-build pillars and walls, loose insulation fluttering at the powerful commercial AC overhead. 

The lights turn off. 

 

 

“I hate you, I hate you, I hate you,” Dan whispers into his computer.

Two floors away, hidden in the back room of Fury’s office, Theo leans in to his screens. “I can’t wait to see you in Hell,” He tells the anonymous code flowing across his screen. 

The vault beeps, it’s screen lighting up once more. The drill stills. FUGLY BITCH.

Theo screams.

 

 

Peter gently lowers the young couple down onto the floor of the office. This floor, by contrast, is almost dead without the constant hum or fear, or in the case of the ones his friends are occupying, unadulterated malice. 

“I think there’s coffee in the break room over there,” Peter adds helpfully. The half-dozen rescued—well, maybe not rescued, as Peter has definitely kept them in the building instead of returning them to their families—hostages stare at him, baffled. 

“I’m…just gonna—” Peter jabs his thumb behind him before scampering out of the room and back into his precious ventilation shafts. The moved, yeah, moved, hostages say nothing as they watch him retreat. 

 

 

 

Fitz turns the light on. 

The light turns off. 

Fitz turns the light on. 

The light turns off. 

Fitz shoots the light switch. 

The lights stay off.

 

 

Dan keeps up a running commentary of evil curses under his breath—not as in swearing, but as in actual ancient curses. Barren fields, infertile animals, polluted water, no rain, etcetera. 

Theo shoves the drill back to work. 

 

 

 

Alexander whips around, eyes narrowed, the soft whistle of wind echoing from somewhere in the large plaza. The hostages whimper fearfully as he sweeps his weapon in their direction.

…For some reason, he feels like the crowd is smaller than he last thought. 

 

 

 

Fritz doesn’t even see Percy coming. 

He jumps out from around a corner, grabs the man by the back of his, admittedly very beautiful and luscious hair, and slams his face into the wall. While the man is dazed, Percy grabs him by the throat and crushes his windpipe. 

The man is dead before he hits the floor.

“Loser needed the lights,” Percy laughs into the comms. 

 

 

 

Natasha carefully peeks around the corner. “Dan, how bad do you want your enemy dead?” 

“Not until I defeat him,” Dan murmurs tonelessly. “Not until he’s sobbing at my feet.” 

That complicates things, but only a little. 

Franco, standing guard at the doors to the security room, looks, quite frankly, bored. Since Hans had sworn them off any channels but the private, he’s just been standing there, listening to Theo’s angry murmuring and the shrill sounds of the drill. 

Natasha briefly considers just shooting him where he stands, but that might distract Theo, which will in turn anger Dan, which will then affect Natasha’s Flappy Bird access. 

Instead, she briefly considers her options. She could lure him away somehow…

Natasha lifts her hands and, after a great moment of consideration, executes a perfect California Condor call. (Thank you, Lee.) Franco looks around, confused. Natasha does it again, warbling. This time Franco does take a hesitant step forward, looking to the windows down the hall. Natasha presses herself against the far wall, waiting for the precise moment for him to pass.

The second Franco enters her field of vision, Natasha jumps him. She darts out and grabs his rifle, yanking it back and out of his hands. The strap twists around his arms as she kicks out his knee, bringing him down. A foot planted between his shoulder blades, she yanks back with the rifle and twists the strap, leaving Franco gasping for air desperately. Natasha keeps him pinned with her weight as he scrabbles for his throat, holding tight until, slowly, he stops moving. 

“One down,” She says into her comm. 

 

 

 

Bucky…was bored. Just a little. Natasha has just finished terrorizing one of the last men, while Peter was currently menacing the second to last, sneaking hostages out one by one. Dan was still at nerd-war, Mal was playing with her C-4 (YIKES), Lee was roaming around with Spencer, Percy had just spent the last ten minutes fucking with a guy with a ‘lightswitch war’(?) and Bridgette was antagonizing the local police force—soon to be the FBI, probably—while simultaneously flirting with Hans Gruber over the radio. 

(Lee definitely found it amusing, too. They refused to elaborate their reasons.)

Bucky, temporarily commandeering a wonderful spinny chair, tapped his comm. “Hey, did we ever find Ross?” He asked. 

“...No,” 

“Nope.”

“Don’t think so.”

“Huh,” Bucky mused. “Maybe we should be worried about that.” 

“Meh,” 

The SWORD team is full of such odd creatures. Ross likes to walk around shirtless to intimidate Dan, who plays online math games against middle schoolers to ‘humble them’, Lee keeps bugs in her pockets, Mal works part-time at a Party City, Bridgette ninjas baked goods into peoples’ homes, and Percy is scared of sparkling water. 

He missed Percy. 

 

 

Lee and Spencer stood back, staring upwards at the ceiling. Spencer’s arm was outstretched, fingertips barely falling short. 

“I’m gonna get on my tiptoes,” Lee said decisively. “Brace yourself.” 

He did as he was told, and when she rocked upwards, Spencer, who was standing balanced on her shoulders, pressed his palm to the ceiling. “Yes!” 

Footsteps echoed down the hallway—heavy, booted steps. Spencer looked down and Lee looked up, exchanging panicked looks. Spencer scrambled down, practically falling off her shoulders. Lee caught him by the middle and deposited him on the floor, both of them quickly looking for a corner to hide in. Spencer dove behind a filing cabinet while she ducked into a cubicle, folding herself under desk a across the small walkway down the middle of the office. 

To the left, the footsteps grew louder.

Across the walkway, Spencer made a few panicked gestures. Lee just shrugged and pressed herself further against the cubicle wall, drawing her stupidly long legs up to her chest. 

A shadow stretches down the hallway, stopping in front of the open office space. Slowly, the person advances towards their hiding spots.

A pair of heavy boots pass right in front of Lee, who bites the inside of her cheek. 

Then, Spencer sneezes. 

The man whips around, easily pinpointing his location and hefting his gun. He fires off a shot that strikes a precious few inches from Spencer’s head. “Out!” The man roars.

Spencer stumbles to his feet and into view, eyes wide, hands raised. 

“Are you one of them?” The man screams, the muzzle of his rifle pressed between Spencer’s eyes. “Where is he?” There’s a ragged, frantic look in his eyes. “What have you done with him?”

Spencer blinks, eyes wide. “Who?” 

The gun is pressed harder into his freckled skin. “My brother,” Karl snarls. “The least you can do is tell me where you put his body.” His voice is shaking, not just with rage, Lee realizes. 

 

…Oh. Ohhhh noooooo. 

 

Spencer made desperate eye contact with Lee over Karl’s shoulder. Wincing, Lee slowly unfolded herself from under the desk. “Uh,” She said awkwardly.

Karl jerks backwards, spinning to see her. She stands there for a second, unsure, before he drops the gun completely, kicking it to the side in his haste. Karl all but tackles her, arms tight around her middle as his face is buried in her shoulder. She makes eye contact with Spencer for a second, and he gestures frantically towards Karl. Jerkily, Lee hugs him back. “Uh,” She says again. “There, there?” 

In the back, Spencer smacks his palm to his forehead.

“I thought—” Karl exhales shakily. “I am glad you’re okay, brother.” 

“Sister,” Lee blurts out. 

Spencer stares at her, completely and utterly flabbergasted. “Now? Really?” He mouths.

Well, Lee’s on a roll. “Sort of? Sibling, maybe. Or brother works, sometimes, I guess. I’m…nonbinary.” She finishes. “Just mix it up?” 

Karl draws back for a second. Then, he bursts into tears. “I am so proud of you!” He hugs her again. “Thank you for telling me, Finn.” A beat. “Is it still Finn?” 

“Yeah,” Lee says softly. “Yeah, Finn is fine, Karl.” Abruptly, she finds her mouth dry, and she silently leans into his hold. “I’m…fine.” 

Spencer is staring at her. It almost looks like sorrow in his eyes. Quietly, he points out into the hallway, and leaves. 

Fuck. Lee hated emotions. 

 

“It’s just Alexander, left,” Spencer’s voice comes over the comms. 

“Karl dead?” Percy asks, swinging his legs idly. 

“Uh, no, but he’s otherwise occupied. Don’t—don’t worry about him, actually.”  

Huh. Alright. 

“There’s like, nine hostages left. Alexander looks like he’s about to shit himself.” Peter reports. “I think he’s trying to decide whether or not to tell Hans.” 

“Speaking of,” Bridgette says. “The police have an ATV and are trying to breach the front doors. Also, I have breached the candy counter. Lee, there’s a chocolate bar in my purse for you.” 

“Thank you,” Lee’s voice is uncharacteristically soft. 

“Dan, how’s it going?” Percy asks.

Never before has Percy heard this tone from his employee. “Victory,” Dan whispers. “Victory.” 

“...Alright,” Mal says. 

“Where are you all?” Percy asks. 

“Top floor,” Nat reports. 

“Heading towards you, Percy.” Bucky chimes in—he must be on the 33rd, then. 

“Security office,” Dan. 33rd, as well, then.

“Outside the main plaza, in the vents.” 30th, for Peter.

“Offices,” Lee, slightly muffled. 34th. 

“Lobby!” Bridgette. 

“Thirty fifth floor.” Mal says. 

“Same,” Reports Spencer. “So…Ross?” 

“Fuck, I’d forgotten about that,” Natasha mutters. “I’m bored. Peter, I’m in the vents a few floors above you. Can I come down and kill Alexander?” 

“I don’t see why not.” 

The lines go silent. A few minutes later, a muffled bang Percy’s pretty sure only he and Bucky can hear. Natasha works fast. 

Speaking of Bucky, the man strides into Fury’s office a few minutes later. He takes a moment to appreciatively look around, taking in all the scale models of Nakatomi projects and opulent furnishings. Then, he takes in Percy, who’s sitting atop Fury’s desk. “Hey,” Bucky says, grinning. 

“Hi,” Percy says, similarly smiling. He spreads his knees a little wider so Bucky can stand between them, which the other man does almost immediately. Bucky’s hand cups his jaw, and he leans in and presses a sound kiss to his lips. “I like the glasses,” He says. 

Percy grins up at him. “You know,” He says. “Before I lost the rest of my vision, I actually used to wear some. Will made me— to protect my eyes, or whatever.” He drops his voice to an absurd Southern drawl. Bucky laughs. “And you just stopped caring?” He asks, a little incredulous. Percy just shrugs. Bucky sighs and drops his forehead to Percy’s. “Listen to your doctor, dumbass.” 

“You just like they way I look in them,” Percy accuses, joking. 

“Maybe.” Bucky is not joking. 

 

Meanwhile, on the floor above, Natasha, Peter, Mal (with her suspicious little backpack on), Dan (hunched over, still typing), Bridgette, and Spencer stand in a loose circle. Lee stumbles in a second later, one of the terrorists…hanging off her back? He’s crying a little. 

“This is my brother, Karl.” She announces firmly. 

Dan, for the first time that entire evening, looks up. “Hi, Karl.” He immediately returns to his work. 

Lee points to Bridgette, who waves. “This is my wife, Bridgette.” 

Karl weeps loudly. “It is so lovely to meet you!” He sobs. 

“So,” Natasha says, eyes not leaving the trio. “Hans is the only one left, no?” 

“Yep,” Mal says. “So…what should we do?” 

“All the hostages are gone,” Peter says. “I figure it’s just a matter of time until he notices. I think he’s just plotting in Tony’s office.” 

Natasha hums for a second. “You know what would be really funny?” 

 

The entire group (including Karl) looks at her expectantly. 

“I’m pretty sure Percy and Bucky are with each other right now…” 

A chorus of evil giggles. 

 

Hans Gruber has been having a rough day. His men have been dropping like flies, and now, as he stands in front of the large glass wall of the office, the plaza is fucking empty. 

Alexander, who was supposed to be keeping watch of the hostages, is gone. As are the hostages. 

Hans takes a slow, measured breath. He picks up the radio. “Alexander? Karl? Franco? Fritz? Theo?”

No response. 

Hans steps out of the office. Then, a soft crackle. It’s garbled and staticky, but it almost sounds like Karl. “Fury’s office” 

“Karl,” Hans says. “Have you found them?” 

 

When he is not answered, Hans’s fingers wrap around his gun. He keeps a tight grip as he walks down the completely deserted hallways. He takes a slow breath before throwing the door open, gun at the ready. 

 

“Was zur Hölle?” Hans can’t help it. He yells. There’s a man sitting on Fury’s desk—where Hans shot the man himself not a few hours ago—with another crowded over him, kissing the breath right out of him. Based on the way they’re dressed—the seated one in slacks, sweater, and a tie, the standing in a suit, they’re Nakatomi employees. “This is a hostage situation!” Hans roars. “What are you doing?” 

 

The suited one seems to take a long second to finish sticking his tongue down the others throat before pulling away and shooting Hans a dirty look. “We’re kinda busy.” 

 

The other, glasses crooked on his nose, peeks over the other’s shoulder. “You seem mad,” He notes. Then, he gasps. “Are you homophobic? Oh, my Gods, James, the terrorist is homophobic.” 

 

The newly named James narrows his eyes at Hans. “Not cool,” He says, shaking his head solemnly. “Not cool at all.” 

 

Hans just stands there, gaping. He thinks about shooting them. Would that be a hate crime? He’s a terrorist, not a bigot. But he wants to shoot them so bad. Not because they’re gay, but because they’re pissing him the fuck off. 

 

He’s not sure how long he’s frozen. Certainly long enough for the two to resume making out. 

 

Certainly long enough for him to be completely shocked when someone taps him on the shoulder. It’s a woman, brilliant red hair and blue eyes. She smiles at him, all teeth. “Yippie-kay-yay, motherfucker.” She says.

 

It’s the last thing Hans ever hears.




 

They ride in the elevator together. Light music plays above them, filling in the very few existing gaps. Karl is still hugging Lee. Lee is holding hands with Bridgette, who’s behind Mal and Dan, who are next to Spencer, who’s behind Nat, who’s next to Percy and Bucky, who are also holding hands. Peter is on the ceiling above them. 

 

They arrive, for the first time in hours, on the 31st floor. 

 

The doors slide open and they all pile out from the car, stumbling onto the floor. “Aw, shit, Dan,” Bridgette grunts. “That was my spleen.” 

Mal went down cradling her backpack. Bucky catches Percy and simply doesn’t let go. Percy seems to have no issues with this. 

 

Two, identical, horrified screams. “PETER?” 

 

Peter looks up. “Oh, hey…Dad. Pops.” He grins at them. 

 

Tony and Stephen look fucking awful, actually. Both their clothes are rumpled, but not in the fun way. Their faces are pale and drawn, eyes bloodshot red. They look like they’ve just had a three hour nervous breakdown. But…

 

“They’re holding hands!” Nat screams. Tony and Stephen, are, in fact, gripping each other tightly. 

 

Everyone, even Karl, begins cheering. Tony looks close to tears. “What the fuck is happening?” 

 

Mal, muffled into her backpack, replies, “We locked you in here so we could take care of the hostage situation while you two kiss.” 

 

“A stress free environment.” Peter says, nodding solemnly. “For reconciliation.” 

 

Tony, still numb, pulls Peter in and grips him to his chest tightly. Stephen joins in, the two almost completely enveloping the boy. “Where’s your coat?” Stephen asks him on instinct. The one Peter’s wearing is obviously not his—Stephen pinpoints it to the fascinatingly tall blonde in the corner, to whom he nods gratefully. “Left it at home!” Peter chirps. “This was more important.”

 

“So, did you guys kiss, or what?” Dan demands. 

 

Tony looks to his secretary, who is holding hands with the head of their international acquisitions department. “What the fuck, Jackson?” He asks tearfully. “What the fuck?”

 

“Did you kiss?” Percy insists. “Would you say your relationship is better than it was…six hours ago?”

 

“Who fucking cares?” Stephen bellows unexpectedly. Everyone, sans Tony and Peter, jolt. “Fuck, yes, we talked! We thought we were going to die!” 

 

Mal squints at them. “Why?” She asks. 

 

Tony stares at the young person, gobsmacked. “Did…did you really fucking think we couldn’t hear the fucking gunshots and explosions over the last couple hours?”

 

“...Oh,” Percy says. “Our bad.” 

 

“Shit,” Bucky whispers. 

 

Natasha winces. 

 

“Wait, explosions?” Lee speaks for the first time. 

 

Mal just gives an awkward thumbs up. “Speaking of! We should leave!” She says loudly. “In the next two minutes and fifteen seconds!” 

 

“Mal, why is your backpack beeping?” Percy asks calmly. 

 

“Two minutes and five seconds!” She says, smile fixed determinedly. 

 

They book it into the elevator. They’d barely fit before, so now Percy is sitting on Bucky’s shoulders, Spencer and Bridgette on Lee’s, and Karl is supporting a gleeful Mal. 

 

The elevator ride is silent. 



They reach the lobby to find the doors busted open, the hostages outside in the courtyard, wrapped in shock blankets. The cops—oh, shit, the FBI, too—all swivel to see the eleven people standing on the front steps of the highrise. 

 

The yelling starts almost immediately. 

 

Loudest from Dan. “FUCK!” He roars. “Theo!” 

 

Their heads all snap to the left as the armored grate covering the sublevel garage ramp opens. A massive truck rumbles down below and comes careering out of the entrance. Dan stands there, fury emanating from him. “YOU!” He screams at the driver.

 

For just a second, Theo stares out the window, and the truck screeches to a halt. “YOU!” He screams back. All previous plans seemingly abandoned, Theo throws the door open and jumps out of the truck. 

 

There’s a sudden screech of tires.

 

A limousine hits him. Theo gets hit by a fucking limo. 

 

Ross rolls down the window, flicking up his shades. It’s the middle of the night, so Ross just looks like an asshole. “Hey, Stephen.” He says casually. 

 

“Hi, Ross,” Stephen says faintly.

 

Ross looks to Tony, who’s under Stephen’s arm. “Shit worked out with the hubby?”

 

“Yep,”

 

Ross nods. 

 

Behind them, there’s an earsplitting boom, and glass rains down on them like snow. There’s a great plume of fire, and a devastating creak. 

 

The entire Nakatomi tower crumbles right in front of them.

 

Well, in front of the FBI, police force, and hostages. Behind them, because the SWORD team and company like to look forward. They’re optimists like that. 

 

Also, Mal’s backpack is missing. 

 

The police chief is staring at them. 

 

A long beat. “Merry Christmas,” Percy offers. 





They wake up in a pile on the floor of the Tower common room. 

 

Bucky blinks, rubbing his eyes. Percy and maybe Nat(?) are splayed across his back. He doesn’t attempt to get up, instead staring up at Stephen and Tony, who are looking down at them. Bucky’s not quite sure what the expression on their faces is. 

 

“They’re still holding hands!” Ross bursts out. 

 

“I hate you so much,” Tony whispers. “I hate all of you so fucking much.” 

 

“Kiss!” Mal screams. 

 

Stephen looks like he’s lost a piece of himself. He looks to his side at Tony, who seems to be considering building Ultron 2.0. Then, he pulls Tony in, cups his cheek, and kisses him. 

 

Everyone starts screaming. 

 

Bucky, smiling, lays face down on the floor. He makes no effort to move in the slightest. His work is done. He can rest now. 

 

Natasha and Percy seem to have the same idea, but they're way ahead of him. He’s pretty sure Natasha is snoring. Percy is drooling. 

 

Whatever. Bucky’s slept in worse places. As the yelling dies down, and Tony drags Stephen off somewhere (fucking finally) Mal draws her hood over her head and sighs dreamily, probably still thinking of bombs or something, as she drifts off. Dan and Spencer are back to back. Bridgette worms her way next to Ross, who sleeps spread-eagle, Peter on his other side. Lee sleeps on her back like Dracula, arms crossed over her chest. 

 

Also, Karl is still here. Bucky’s not quite sure how that happened.

Notes:

57 fucking pages

bucky: i've killed so many people with this arm
percy, holding his hand: iVe kiLLeD sO mANy pEOplE wITh tHis aRM. bitch

bucky and percy trying to puzzle out the timeline was literally me when i started writing this. it's been four years. what the fuck.

jorked it

‘dehydrate you with his mind until you die’ lmao

and yes, i watched hot frosty. unsure of my feelings, tbh. the knight before christmas for sure remains superior, though

percy being an undercover math talent...hilarious to me, tbh. like i know it varies by school and area, but in a lot of places, especially in nyc, a class specifically for pre-algebra is 8th grade math. percy was in 6th grade

bridgette is based on my friend, who, when we finished watching die hard, told me that she had no idea what the main plot was because she kept getting distracted by hans gruber
and yes, lee knew about bridgette's whole thing and thought it was fucking hilarious

and for those who don't know, die hard is set in the late 80s, so fury being born in '43 isn't insane

peter: i love my two dads
peter:
peter, eyes narrowed: thats a lot of parental support...almost too much, one might say

spencer and lee do just stack sometimes. just for improved height. lee likes for him to see new things

karl: oh my god my brother hasn't been murdered and left to rot in some storage closet
lee: oh boy what a time for me to come out!

lee normally being very chill but freaking tf out whenever she has to deal with family...telling

do i bring back percy in his little glasses yes or no
and do we keep karl, yes or no (different from evil child halloween carl)

IRONSTRANGE!! FINALLY

merry christmas and happy holidays! i hope you're all having a wonderful end of the year.

plumbing baby. goodbye

Chapter 50: The Voices or whatever

Notes:

(See the end of the chapter for notes.)

Chapter Text

ethically sourced sluts: 

 

vintage bi: how we doing?

 

antique gay: bad

 

antique gay: we doing bad

 

vintage bi: you need anything?

 

antique gay: i took my meds already

 

antique gay: so now im just kinda sitting on the floor with a blanket on

 

vintage bi: a classic

 

vintage bi: sorry you’re feeling shitty about The Voices or whatever 

 

antique gay: appreciate it

 

 

 

our family tree is a wreath

 

pied piper: yeah i just dont think black tar heroin can solve this one

 

mcshizzle: are we 100% certain on that one though

 

framk: …well, no

 

mcshizzle: well there we go

 

horse girl: hmm

 

furby slayer: imagine having your whole memory wiped and then you gotta remember that you’re gay

 

furby slayer: the winter soldier having flashbacks to gay sex and not knowing why

 

furby slayer: oh gods i need to talk to james so bad

 

furby slayer: excuse me

 

blonde superman: sobbing what the fuck

 

pied piper: OHMY GOFD

 

 

centenarian, 30 ton hell puppy, toph from avatar = blended family

 

pb&j: hello the light of my life

 

Jamie <3: hi

 

pb&j: i have a very important question

 

pb&j: do you have a minute?

 

Jamie <3: always one for you

 

pb&j: gay

 

pb&j: so when you first started getting your memories back

 

pb&j: like the very beginning

 

pb&j: did you or did you not randomly get memories of you getting freaky with a man

 

pb&j: and then just have to take a breather in the middle of an assassination or whatever to figure out what the fuck that was about

 

Jamie <3: 

 

Jamie <3:

 

 

 

ethically sourced sluts: 

 

vintage bi: was that you?

 

antique gay: laughing my ass off?

 

antique gay: yes

 

antique gay: god i love my boyfriend

 

 

 

 

centenarian, 30 ton hell puppy, toph from avatar = blended family

 

jamie <3: i feel as if i shouldnt answer that

 

pb&j: THAT MEANS THE ANSWER IS YES

 

 

 

 

ross (NOT the one from friends) @rossBOOMni 

‘you’re so funny’ thanks im not allowed to serve in the military

 

bridgette! @lavendarmenaced

Ross…

 

 

 

 

robert <3: 

supreme overlord jackson: every single one of you are rewriting your reports. Every. Single. One. 

 

[supreme overlord jackson is offline]

 

class traitor: waht the FUCK ross

 

certified monster fucker: what??? me??????

 

class traitor: i KNOW you wrote some stupid shit

 

certified monster fucker: oh like you didnt

 

egg: ok, so you BOTH did stupid shit

 

local milf: mal there is no way they did and you didn’t. 

 

local milf: unbelievable

 

local milf: all three of you

 

thor understudy : kjære…

 

thor understudy: i read your report

 

local milf: 

 

local milf: your betrayal should consume me with rage, but i just google translated that 🥺

 

skibidi ohio: i thought my report was good 🙁

 

thor understudy: yours just probably needed a bit of refinement. inexperience, not stupidity. 

 

egg: WHO THE FUCK IS THAT

 

class traitor: …spencer????

 

skibidi ohio: hello!

 

certified monster fucker: oh god

 

certified monster fucker: how long have you been here

 

skibidi ohio: a while!

 

class traitor: dear god

 

class traitor: and…your name is skibidi ohio

 

skibidi ohio: mhmm

 

class traitor: i need a moment

 

class traitor: well…i know what i did, what did YOU guys do

 

certified monster fucker: 

 

certified monster fucker: nuthin

 

class traitor: tell me or ill just get into the system and read the whole thing myself

 

certified monster fucker: i loathe you

 

class traitor: mehehe

 

certified monster fucker: [One Attatchment: It’s a screenshot of the PDF of Ross’s quarterly team report: ‘I have only one complaint about my colleagues. Last week, when I was speaking about my personal life, Mal Tanuk made some very hurtful comments. I would like her drawn and quartered, please and thank you.’ ]

 

egg: BRUH????

 

egg: WHAT THE FUCK DID I DO

 

certified monster fucker: you know. 

 

egg: 

 

egg: oh my god are you fucking kidding me

 

local milf: what happened? 

 

egg: ross was showing me his new unhealthy situationship and said ‘i could change him’ or whatever

 

certified monster fucker: and then you said…

 

egg:

 

egg: ‘why? did he shit himself?’

 

class traitor: SOBBING

 

local milf: oh my god

 

egg: i thought it was hilarious

 

egg: same with this

 

egg: [One Attachment: Mal’s report:

‘I would like to submit a form about workplace hazards. I’m certain Spencer and Lee’s crypt lab is haunted, due to the consistent and unexplained chill that assaults me whenever I venture down there. I do not appreciate this. I would like to get HR involved for permission to do a seance.’ ]

 

thor understudy: it’s not haunted you stupid piece of shit

 

skibidi ohio: it’s cold to keep lee’s morgue in good shape!

 

thor understudy: yeah dumbass

 

egg: whateva

 

egg: you’ll see the truth someday

 

egg: now someone else embarrass themselves

 

class traitor: a captain is always willing to go down with his ship

 

class traitor: [One Attachment: Dan’s report: 

‘I would like it to be enforced that Ross Bunmi eat lunch somewhere else. For the past two weeks, daily, he's taken his lunch break while standing over my desk. Normally, this would not be a problem. However, every single day since this has begun, his lunch has been a slab of chicken and a tupperware full of ‘purple’. I am not sure what this is, but it bothers me immensely. It’s just a tupperware full of some purple of unknown consistency. It’s lowering my work ethic.’ ]

 

certified monster fucker: purble

 

class traitor: IM GOING TO KILL YOU WITH A GUN

 

egg: …bridgette? 

 

local milf: …yes?

 

egg: send the report.

 

local milf:

 

local milf: 

 

local milf: class traitor: [One Attachment: Bridgette’s report: 

‘Though I am an ally, as a lesbian, I do find it a bit off-putting when I see Commander Jackson and the Sergeant. Where is the woman? It is odd to me to see romance that is not woman-centric. It doesn’t sit right with me.’

Then, a ten-step plan to move past this issue is laid out. ]

 

egg: 

 

certified monster fucker:

 

class traitor: 

 

local milf: listen…

 

 

 

 

trusted with scalpels

 

doc mcstuffins: do i need to send mine???

 

doogie howser, i guess: no

 

doogie howser, i guess: just stay silent

 

doogie howser, i guess: they get worked up enough with each other that they just forget about us

 

doc mcstuffins: thank god

 

doogie howser, i guess: pretty much

 

doogie howser, i guess: because there’s no way in hell im sending mine

 

doc mcstuffins: does it

 

doc mcstuffins: does it perhaps have the

 

doogie howser, i guess: the time i had to hold bridgette back from attacking you after you pronounced dulce de leche as ‘doosh da loosh’? yes, yes it does.

 

doc mcstuffins: 😞

 

 

 

drinking groundwater is good for the soul

 

teletublees: they’re fixing them

 

pj masks:

 

teletublees: yes, mine is still the same, and, yes, all the drama and gossip you’ve missed is in there

 

teletublees: i know who you are

 

pj masks: thank you

 

teletublees: yep

 

 

 

scientists hate this local new yorker @jbarnes

in a top/top trad husband relationship. every day my partner and i both get home at six, throw our briefcases on the couch, pour ourselves each a drink, light a cigarette, and silently brood about our relationship with our fathers. we have not eaten dinner in two years. 

 

You Know Who I Am @TonyStark

where do you even come up with half this shit?

 

You Know Who I Am @TonyStark

i know this isn’t true, he made you both galinhada literally two days ago

 

You Know Who I Am @TonyStark

and he gave me a bowl to taste-test. it fucked hard

 

scientists hate this local new yorker @jbarnes

im so funny. all of you adore me

 

james @jimmyjammy

i have something inappropriate to ask

 

scientists hate this local new yorker @jbarnes

go ahead, fellow james

 

james @jimmyjammy

in a top-top trad husband dynamic…who…y'know

 

scientists hate this local new yorker @jbarnes

well, we’ve already established that i was lying on the internet…so…i guess we’ll never know, actually

 

james @jimmyjammy

woah…top ten questions scientists still can't answer

 

james @jimmyjammy

…i have another inappropriate question

 

scientists hate this local new yorker @jbarnes

yes?

 

james @jimmyjammy

i think you know what it is, sergeant barnes

 

scientists hate this local new yorker @jbarnes

i see

 

scientists hate this local new yorker @jbarnes

the answer is missionary so we can continue our argument from before

 

james @jimmyjammy

i'm so obsessed with you

 

 

 

centenarian, 30 ton hell puppy, toph from avatar = blended family

 

pb&j: doggystyle so you can watch the powerpoint presentation i made outlining why you’re wrong

 

james <3: im crazy in love with you

Notes:

dare i say...denimbeans consistently active era once more??

got paid five dollars to put skibidi ohio in here btw (spencer is from right outside of columbus)

btw when ross, genius prodigy psychologist and profiler says 'i could fix him' he means it. he's putting this man through operant conditioning. he's changing him down to his core sense of self

mal wants to do a seance so bad guys, she already bought ghost-hunting gear

i have no comment on the entire bucky on twitter bit. i feel as if i've made myself pretty clear on that one

and yes it is canon here that the winter soldier would sometimes get a random memory of him having gay sex and would just have to stop and be like ???????

plumbing baby. goodbye

Chapter 51: S.T.A.R.K.

Notes:

(See the end of the chapter for notes.)

Chapter Text

mal(practice) @mothmanass

big fan of whatever barnes and his bf have going on

 

annlis @anli

would you care to elaborate

 

mal(practice) @mothmanass

boy would i!

 

scientists hate this local new yorker @jbarnes

Stop

 

mal(practice) @mothmanass

i will not

 

mal(practice) @mothmanass

so barnes had gotten a loving tap on the head (slight concussion)

 

scientists hate this local new yorker @jbarnes

mal i will kill you with a gun

 

mal(practice) @mothmanass

and he was gonna go talk to his boyfriend

 

mal(practice) @mothmanass

and so he was calling for him trying to find him

 

mal(practice) @mothmanass

but because of his concussion

 

mal(practice) @mothmanass

he was like, SCREAMING

 

scientists hate this local new yorker @jbarnes

mal…

 

mal(practice) @mothmanass

and his boyfriend pokes his head out of the room he was in and goes ‘you must be talking to me like that with your left mind because it sure as FUCK aint the right one you’re yelling at me with’

 

scientists hate this local new yorker @jbarnes

STOP I FELT SO BAD

 

bearbi @bearbi3 

IM MPISSING MYSLEF WHATY

 

Ferris wheel fighter @ihatecarnivals

NATIVE NEWYAWKER RIGHT THERE!!! REPPING US WELL

 

mal(practice) @mothmanass

and THEN my friend (medical degree) was like ‘he has a concussion i dont think he knows hes yelling’

 

mal(practice) @mothmanass

and then the BOYFRIEND felt really bad

 

scientists hate this local new yorker @jbarnes

:(

 

james @jimmyjammy

…did everything turn out ok?

 

scientists hate this local new yorker @jbarnes

yes we each came home to surprise one another with flowers and ice cream because we both felt bad :/ so we were just standing opposite ends of the hallway like dumbasses

 

ross (NOT the one from friends) @rossBOOMni 

 

mal(practice) @mothmanass

thank you ross

 

 


 

 

SSEA

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: hey tony :)

 

Tony Stank: yes nat :)

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: when were you gonna tell us about stark :)

 

gitc: do we not know about that miss black widow?

 

percenary: nat it says stark on the side of the big tower (or so im told)! hope this helps ❤️

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: i despise you

 

percenary: liar

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: 

 

percenary: xoxo

 

mindinna: wait so what do you mean??

 

Tony Stank: the education program? 

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: YES

 

Tony Stank: oh

 

Tony Stank: hehe

 

Tony Stank: its actually called S.T.A.R.K. 

 

Tony Stank: (percy do the thing)

 

percenary: hope this helps ❤️

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: crashing out, killing all of you, going back to russia

 

skrunkly raccoon: i also do not know what you’re talking about

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: tell them what it stands for tony

 

Tony Stank: it's a free program that parents can enroll their kids in for tutoring or daycare

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: TELL THEM WHAT IT STANDS FOR

 

Tony Stank: science technology arithmetic reading and karate :)

 

Tony Stank: the necessities for an education

 

skrunkly raccoon: YOU ARE TEACHING CHILDREN KARATE???????

 

skrunkly raccoon: you said DAYCARE

 

skrunkly raccoon: YOU ARE TEACHING TODDLERS KARATE

 

Tony Stank: not me personally

 

baby avenger: i was SO born in the wrong era…could have learned karate from tony stark…

 

Tony Stank: i would like to clarify i do not personally do karate

 

Tony Stank: karate and a 200 pound suit dont really mix well, i fear

 

Tony Stank: did teach a kid to build a bomb though

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: oh my god you are such a threat to national security

 

baby avenger: sobbing how am i going to learn karate now

 

percenary: @skrunklyraccoon

 

baby avenger: MR BARNES DO YOU KNOW KARATE

 

skrunkly raccoon: yes

 

[gitc has changed skrunkly raccoon’s username to ‘Mr. Miyagi’]

 

baby avenger: HOLD ON IM COMING TO FIND YOU

 

Mr. Miyagi: im scared now

 

Tony Stank: probably for the best

 

 


 

 

 

our family tree is a wreath

 

furby slayer: im so angry right now

 

pied piper: how unusual

 

sparky: babe please do not make this worse i value my plumbing

 

pied piper: you’re not with him??

 

sparky: he has range

 

horse girl: what’s wrong percy?

 

furby slayer: so recently

 

furby slayer: one of those fucking kids peter calls his friends introduced james to ‘booktok’

 

pied piper: OH NO

 

my chemical ron weasley: NOOOOO

 

mcshizzle: NOT who i expected to react to that ngl

 

furby slayer: and now

 

furby slayer: whenever jamie has a book there’s a 50/50 chance it’s what he typically reads, or its the most unholy thing ever created

 

furby slayer: might be some wonderful poetry or a straight couple having the worst sex ive ever heard of

 

furby slayer: and now he’s got WADE involved and they have a book club

 

pied piper: you have my sympathies but why is this your problem

 

horse girl: 

 

horse girl: percy does bucky still like reading aloud

 

furby slayer: YES

 

sparky: oh my god

 

furby slayer: AND I NEVER KNOW WHAT I’M IN FOR

 

furby slayer: WORSE THAN PHINEAS AND THE GORGON BLOOD

 

framk: please do not compare those two

 

framk: at least the scales were tipped in your favor with the gorgons blood

 

RARA: If it bothers you, just tell him to stop. 

 

furby slayer: I CANT

 

furby slayer: THATS THE WORST PART

 

furby slayer: HE THINKS THEYRE SO FUCKING FUNNY AND HE LAUGHS SO HARD WHEN HE READS THEM

 

sparky:

 

furby slayer: I LOVE HIS LAUGH SO MUCH HE IS THE LIGHT OF MY LIFE

 

furby slayer: BUT I CAN'T WITH THIS ENEMIES TO LOVERS BULLSHIT

 

furby slayer: LIKE WHAT DO YOU MEAN???’ ohhhh hes so mean to me….but so hot :(‘ STAND UP

 

furby slayer: WHERE IS YOUR RAGE??? WHERE IS YOUR ANGER??? IF YOU HATE SOMEONE AND THINK THEY'RE HOT YOU DO NOT HATE THEM ENOUGH

 

furby slayer: I CAN'T SEE AND I KNOW ALL MY ENEMIES ARE HIDEOUS BECAUSE I FEEL IT IN MY BONES

 

furby slayer: AMATEUR HATING

 

pied piper: oh my god you are literally so insane

 

pied piper: correct though! someone does something i dislike and they instantly shrivel before me into an ugly hag!

 

sparky: jesus christ

 

furby slayer: not in these fucking books he isnt

 

 


 

 

areyoushuriaboutthat: how is your paranoia doing old man

 

Bucky: i always responds appropriately to happenings and situations (toaster went off and i punched a hole in the dishwasher)

 

areyoushuriaboutthat: nice

 

Bucky: tony thought so too

 

Bucky: hows wakanda? 

 

areyoushuriaboutthat: fine

 

areyoushuriaboutthat: thinking about breaching containment

 

Bucky: oh?

 

areyoushuriaboutthat: idk maybe ill come terrorize you or something 😼

 

Bucky: as long as you give me a heads up im ok with it

 

Bucky: i say this only because i imagine you are less dense than a dishwasher 

 

areyoushuriaboutthat: unfortunately at the moment, yeah, but im working on it

 

Bucky: fascinating

 

Bucky: percy and i have a spare room

 

Bucky: hes cool with you taking it

 

Bucky: as long as you pass the dog vibe check

 

areyoushuriaboutthat: putting aside my vague terror of that man because theres a DOG??

 

Bucky: yes

 

Bucky: big

 

Bucky: [Attachment: A picture of Lea sitting in a chair at the kitchen counter, a pastel blue handkerchief around her neck ]

areyoushuriaboutthat: oh my god….big…amazing…

 

Bucky: she can drive

 

areyoushuriaboutthat: im enthralled.

Notes:

percy is full of so much rage i love him so much
peter taught him to do the 'hope this helps ❤️ ' btw and he thinks its hilarious

the S.T.A.R.K. idea is from social-justice-waterbender on tumblr(? bootlegged on pintrest, naturally)

bucky barnes would be into booktok. specifically the insanely shitty 'dark romance' or supernatural ones. he's sitting there giggling snickering having the time of his life. but little does he know...he IS the assassin mafia boss to percy's sweet innocent baker or whatever. marvel comics hire me.

shuri :)

plumbing baby. goodbye

Chapter 52: gorilla

Notes:

(See the end of the chapter for notes.)

Chapter Text

bucky’s victims and also percy’s bimbos

 

president lincoln: one hundred men vs one gorilla

 

moonmoon: many such cases

 

president lincoln: what

 

president lincoln: why do you always do this

 

president lincoln: now i dont want to finish the scenario

 

moonmoon: hehe

 

murphy’s law: its ok abe im listening

 

president lincoln: thank you charles

 

president lincoln: 100 men vs. 1 gorilla. Physical fight. Who would win?

 

avril lavigne: i dont like you learned to capitalize for this question

 

The News(™): also this is a dumb question

 

The News(™): the answer is so fucking obvious

 

nedleedle: yeah im sorry but this isnt a debate

 

moonmoon: the scales are clearly tipped

 

nedleedle: yeah in favor of the gorilla

 

The News(™): for the people obviously

 

The News(™): what.

 

avril lavigne: oh my god what

 

avril lavigne: clearly gorilla

 

murphy’s law: no??? theres a hundred people???

 

president lincoln: gorilla strong though

 

The News(™): you know who else is strong?? Peter

 

The News(™): and i watched him roll down a flight of stairs after slipping on a french fry today

 

The News(™): i would not bet on him against a hundred people

 

tungsten dioxide whats this: ouch

 

The News(™): sorry peter

 

moonmoon: yeah but like

 

moonmoon: bucky is also strong

 

moonmoon: i think he could beat a hundred people

 

president lincoln: interesting…

 

president lincoln: so you think the level of the gorilla’s training matters?

 

tungsten dioxide whats this: hey can we stop comparing me to a gorilla

 

Scary Captain: this is the stupidest argument ever.

 

Scary Captain: gorilla. 

 

murphy’s law: oh my god mj no

 

Scary Captain: don’t argue with me on this. gorilla.

 

The News(™): im so sorry mj but i absolutely will argue about this

 

The News(™): you know what

 

The News(™): @terminator

 

moonmoon: no fucking way betty

 

The News(™): @terminator

 

avril lavigne: jesus christ

 

The News(™): @terminator

 

The News(™): @terminator

 

terminator: Oh my god what

 

The News(™): do you think 100 men could beat a gorilla

 

terminator:

 

terminator: you know what?

 

terminator: one second.

 

terminator: ill get back to you with an official opinion

 

 

 

chappel roan fans here to attack people

 

[bucky has changed the group name to ‘100 men v 1 gorilla?]

 

Tony: unbelievable. 

 

natasha: what the fuck

 

natasha: 100 men obviously

 

mj: i just felt a physical pain in my chest.

 

dan: is this just in the woods somewhere?

 

webs: abe says yes

 

mal: is the gorilla armed?

 

webs: abe says nobody is

 

mal: oh shit

 

mal: gorilla obviously

 

bridgette: im not too sure

 

spencer: gorilla, maybe? they’re very tough and strong

 

ross: do the people have planning time?

 

webs: im just going to give the phone to abe, so just know whatever comes next is not from me

 

webs: the humans get five minutes in a sealed chamber. they can’t see where they’ll be dropped. the gorilla knows the land decently well

 

Tony: wait, were the humans randomly drafted? did they know this was going to happen? did they sign up for this??

 

webs: random sample of people. they get a piece of paper that tells them what’s about to happen, and then the five minutes begins

 

Tony: i’d like to say humans, but the answer may be gorilla

 

Tony: 100 strangers trying to plan a cohesive attack in five minutes? they’ll crumble

 

natasha: okay but the gorilla would get tired eventually

 

Tony: it’ll only really take one good hit to take a person out though

 

Tony: i think a gorilla has 100 good hits in it

 

lee: i would not get near the gorilla

 

dan: really?? i did not expect this from you

 

mal: didnt you used to fight polar bears for fun

 

lee: no, they are endangered. 

 

lee: wolves were fair game though

 

ned: wolves are okay but you wouldn’t even approach a gorilla??? you’re like twice the height of one

 

bridgette: babe what

 

lee: what if the gorilla threw its poop at me

 

mal: I DIDNT EVEN THINK ABOUT THAT

 

wade: i would throw mine back!

 

lee: you conjure a beautiful world

 

Tony: oh my god i forgot you were here

 

 

 

bucky’s victims and also percy’s bimbos

 

terminator: official opinion: there is none

 

terminator: they’re talking about the logistics of defensive pooping now

 

moonmoon: oh :/

 

 

 

YES we have very strong opinions about colors and NO we dont all know each other

 

“blue”: do NOT check that groupchat you got put in a while ago

 

“red” oh i left that thing ages ago

 

“blue” thank god

 

 

 

 

Bblimm @blooo

mr sergeant barnes do you like men

 

scientists hate this local new yorker @jbarnes

man is a hopeless creature. I don't like much of anyone

 

scientists hate this local new yorker @jbarnes

oh if you meant sexually then yes

 

scientists hate this local new yorker @jbarnes

how am i still answering this question? 

 

You Know Who I Am @TonyStark

jesus christ edgelord alert

 

spidey @spidey-official 

what??? happened???

 

scientists hate this local new yorker @jbarnes

percy wont go to barnes and noble to look for quan millz books with me

 

You Know Who I Am @TonyStark

giving you freedom was a mistake!

 

 

 

robert <3

 

mal: if i had a penis i would use it to sniff our various treasures such as. metal coins in the sand. rare and elusive truffles. Etc 

 

supreme overlord jackson: DO YOUR JOB

 

 

 

our family tree is a wreath

 

pied piper: PERCY JACKSON

 

pied piper: WHO TAUGHT YOU HOW TO DO THAT

 

furby slayer: huh

 

pied piper: YOU RETWEETED SOMETHING???

 

furby slayer: oh yeah

 

furby slayer: when lee gets overstimulated in the labs i give her my phone and she reads tweets out loud to me in a little voice

 

mcshizzle: no way you’re ipad baby parenting your employees

 

furby slayer: say that to lee’s face i dare you

 

framk: you got a stepstool for him to do that?

 

pied piper: GOT HIS ASS LMAO

 

mcshizzle: eat shit!!

 

sparky: wait what did he retweet

 

furby slayer: i was just speaking my truth

 

pied piper: [Image Attatchment: 

 

     kelp face @localcryptid retweeted:

     IDGAF who shot JFK #MoveOn ]

 

framk: no fucking way

 

furby slayer: what about that statement confuses you

 

my chemical ron weasley: jesus christ

 

my chemical ron weasley: oh also btw if you guys hear will screaming dont worry about it

 

horse girl: hm

 

pied piper: what did bro do!!!🔥🔥

 

my chemical ron weasley: he’s training a few campers as field medics

 

my chemical ron weasley: there was an accident at a the forge and a camper got a chest wound

 

my chemical ron weasley: trainee blurted out that she was gonna be breathing ‘mad crisp’ 

 

my chemical ron weasley: and thats how we all found out together that her lung had been punctured

 

my chemical ron weasley: shes totally fine but jesus christ

 

pied piper: IM CRYINF

 

 

 

nick fury @12yearoldterrorist

area 51 has penis walking around

 

You Know Who I Am @TonyStark

YOU

Notes:

had to weigh in on the gorilla debate im sorry

im firmly on the side of the gorilla for one reason: have you ever seen a group of FIVE men try and plan something?? its awful. 100 unfamiliar men in five minutes? they're not getting ANYTHING done
any other circumstance the humans would win but...100 random men? absolutely not

i also had to but quan millz books in here im sorry for that too
we've just already established bucky is on booktok...he IS on his way to pick up a copy of 'this hoe got roaches in her crib'

mal's truffle statement is totally stolen from a tumblr post but i cannot find it for the life of me holy shit i swear i didnt come up with something like that

lee sitting in a spinny chair in percy's office: IDGAF who shot JFK #MoveOn
percy: hah...i like that one! share it with the people, squire

taking suggestions and interpretations as to what the little voice sounds like btw

plumbing baby. goodbye

Chapter 53: not funny!! didnt laugh!! guards, use the drone strike

Notes:

(See the end of the chapter for notes.)

Chapter Text

scientists hate this local new yorker @jbarnes

call my mans thighs misinformation the way i'm spreading them

 

scientists hate this local new yorker @jbarnes

manspreading because, you guessed it, i'm spreading my man

 

scientists hate this local new yorker @jbarnes

my mans thighs called excel because i am spreading them on the sheets

 

You Know Who I Am @TonyStark

Please shut the fuck up

 

Black Widow, Baby @NatashaR

have i ever told you how much i hate you? because it's a lot.

 

scientists hate this local new yorker @jbarnes

what did i do??

 

Black Widow, Baby @NatashaR

are you fucking kidding me?



 

 

 

SHIELD breakroom coffee maker survivors

 

nasha: percy

 

packson: hello

 

nasha: can you please check twitter

 

packson: cannot

 

packson: so many buttons nasha

 

nasha: that is literally the worst shortening of natasha ive ever heard why are you both like this

 

packson: both ?

 

nasha: youd understand if you were on twitter

 

nasha: god i cant suffer through this alone

 

nasha: where are you

 

nasha: im reading this to you

 

packson: yeah alright

 

packson: im in the pool

 

nasha: im not getting in

 

packson: well im not getting out

 

packson: its salt water :)

 

nasha: i will sit by the poolside and read loud

 

packson: deal




 

 

robert <3

 

class traitor: lee where are you

 

thor understudy: mcdonalds

 

class traitor: you hate mcdonalds?

 

thor understudy: dislike clown

 

thor understudy: but brother has never had big mac

 

thor understudy: big part of american culture according to my research

 

egg: research?

 

thor understudy: spencer

 

skibidi ohio: me!

 

monster fucker: wait wait wait

 

monster fucker: brother?

 

thor understudy: karl

 

monster fucker:

 

egg: 

 

class traitor:

 

egg: wait

 

thor understudy: yeah?

 

monster fucker: huh

 

thor understudy: my brother that i have always had

 

class traitor: ???

 

thor understudy: my brother that i have always had that you have all met

 

skibidi ohio: wh

 

skibidi ohio: hm

 

thor understudy: my brother karl

 

egg: where has he been

 

thor understudy: i dont know what you mean

 

egg: i

 

thor understudy: jackson

 

monster fucker: he’s not gonna respond unless you @ him

 

supreme overlord jackson: yes?

 

monster fucker: okay.

 

thor understudy: can i take an extra hour off for lunch

 

supreme overlord jackson: yes

 

class traitor: FAVORITISM?????

 

class traitor: you always interrogate us about our workload!!

 

supreme overlord jackson: your hobbies include forgetting tasks and procrastinating responsibilities

 

supreme overlord jackson: lee’s hobbies are bugs and lab

 

supreme overlord jackson: enjoy your time with your brother, lee

 

thor understudy: :)




 

 

 

SSEA

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: percy just leapt out of the pool and started running into the stairwell

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: i think he hopped over the rails for speed

 

Tony Stank: what the fuck?

 

gitc: why??

 

Mr. Miyagi: percy????

 

baby avenger: I SEE HIM

baby avenger: IM SUITED UP AND IM FOLLOWING HIM

 

baby avenger: HE'S SO FAST

 

Tony Stank: he’s outside??

 

mindiana jones: what the hell

 

Mr. Miyagi:  im getting worried now

 

Mr. Miyagi: peter if he starts veering towards hells kitchen and you see daredevil running towards him you have my full permission to do everything in your power to tranq him

 

baby avenger: YESSIR 🫡

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: you're dating such a fascinating creature, bucky

 

Mr. Miyagi: part of me wants to argue but i really cant

 

Mr. Miyagi: ive genuinely never seen this behavior from him

 

Tony Stank: i feel like reinforcements are in need

 

Mr. Miyagi: hmmm

 

Mr. Miyagi: one second

 

[Mr. Miyagi has added Clarisse La Rue to the chat ]

 

Mr. Miyagi: any explanations?

 

Clarisse La Rue: calm the fuck down and let me backread

 

baby avenger: [Video attachment: Percy has made it into the middle of a deserted park. Riptide is in his hand, and he, unflinchingly, is running at a large, half-bull half-man creature that stands in the center of the sand pit ]

 

Clarisse La Rue: oh

 

Clarisse La Rue: he’s just chasing down the minotaur again, don’t worry about it. 

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: im sorry?

 

Clarisse La Rue: he hates that fucking thing, always stays ready to clock it

 

Clarisse La Rue: it chased him down on his way to camp when he was twelve, and he murdered it with his bare hands on top of the hill. like half the camp was watching

 

Clarisse La Rue: i know he can’t read so you better not tell him this, but it was pretty fucking sick. he was such a rageful preteen

 

Mr. Miyagi: my boyfriend can fucking read clarisse

 

Clarisse La Rue: he’s been telling me he can’t since he was four feet tall

 

Clarisse La Rue: not buying into your clickbait

 

baby avenger: he’s biting the minotaur

 

Clarisse La Rue: not surprised

 

Clarisse La Rue: again, his hatred for this thing is legendary

 

Clarisse La Rue: first monster he killed when he knew he was a demigod, first monster he killed in the battle of manhattan, first monster he killed after he lost his vision

 

Clarisse La Rue: i swear he can just sniff it out at this point

 

[Clarisse La Rue has left the chat ]

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: huh.

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: so he was pretty much always like that, then?

 

Tony Stank: i refuse to believe percy was ever four feet tall

 

Mr. Miyagi: what, cause you still are?

 

Tony Stank: sending a drone strike to your location

 

Mr. Miyagi: WAIT NO

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: he actually just did it i saw him press the button

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: now barnes is running too wow

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: damn tony i didn't know height jokes bothered you like that

 

Tony Stank: oh they don't

 

Tony Stank: im the smartest man in america who gives a shit if im not six feet tall

 

Tony Stank: i just wanted to try out my new drone strike button

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: wow

 

Tony Stank: plus its super convenient because my boyfriend is like half a foot taller so he can state judgmentally at people over my head 

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: you know, theres a name for your kind

 

Tony Stank: WOAH???

 

 

 

our family tree is a wreath

 

pied piper: percy your boyfriend is thirst tweeting about you again

 

mcshizzle: you follow him??

 

pied piper: you dont?? quality stuff right here

 

pied piper: never thought war hero james buchanan barnes would be a shitposter but ill take it

 

furby slayer: yeah i know natasha read them to me while throwing stuff in the pool for me to bring back to her

 

horse girl: oh

 

furby slayer: we have fun

 

pied piper: ok the black widow stole my thunder but its the BLACK WIDOW so ill let it slide

 

pied piper: anyway i just wanted to ask you your thoughts on his work

 

furby slayer: he’s an annoying slut and i love him

 

RARA: Lovely.

 

sparky: true love right there

 

sparky: brings a tear to my eye

 

pied piper: i dont see why you wont learn to use twitter so you can return his energy

 

furby slayer: i keep telling people, way too many buttons

 

sparky: ive seen you drive

 

furby slayer: i havent

 

mcshizzle: HA

 

furby slayer: 🥰

 

pied piper: but then how does he know your feelings about him

 

furby slayer: well usually he gets reminded when i blow him

 

[furby slayer has deleted a message]

 

pied piper: WHAT

 

pied piper: WHAT THE FUCK

 

pied piper: I SAW THAT

 

horse girl: piper?

 

framk: sorry what are you talking about

 

framk: i was yelling at the senate 

 

furby slayer: so proud

 

furby slayer:  no clue what pipers talking about though

 

pied piper: PERSEUS JACKSON I HATE YOU

 

furby slayer: 🙁

 

sparky: thats a bit harsh, babe

 

RARA: Uncalled for.

 

pied piper: ADFHFDHTEBRW!!! FYUCK YOUDGBRQBGV

 

furby slayer: odd

Notes:

credit for bucky's thirst tweets goes to tumblr user bulletproofheartmp3

RETURN OF KARL
you guys said you wanted to keep him so here he is

also ironstrange canon, also from the christmas special

percy is the ultimate gaslighter im not sorry

yeah nat oficially doesnt know about demigods or monsters rn in the file official timeline…just ignore it

i saw the tags of this fic while i was updating it... 'attempt at humor'. i was really nervous when i first posted this because id never written anything like it, but now im confident and secure in the fact that im literally the funniest bitch alive (hubris) so should i take it out orrr

plumbing baby. goodbye

Chapter 54: hotdog

Notes:

(See the end of the chapter for notes.)

Chapter Text

SSEA

 

Mr. Miyagi: i have news

 

baby avenger: omg are you about to come out

 

Mr. Miyagi: wh

 

Mr. Miyagi: peter

 

baby avenger: sorry automatic response

 

gitc: dont worry bro, we’re gonna find your meds 🙏just keep holding on

 

baby avenger: you’re the worst!!

 

gitc: 😛

 

Tony Stank: i hate children

 

percenary: you have like 5

 

Tony Stank: so?

 

Tony Stank: that doesn't always stop people #howardstark #followinginhisfootsteps

 

Mr. Miyagi: oh my god??

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: tony…

 

percenary: real tbh

 

Mr. Miyagi: PERCY

 

percenary: what?? 

 

percenary: my uncle literally turned his own daughter into a tree idk what you want from me

 

Mr. Miyagi: sigh

 

percenary: i love our daughter though so dont worry

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: your daughter is a 200 lb mastiff that chews holes in tires when left unattended

 

percenary: just some of her many positive traits

 

mindiana jones: bucky, what did you have to share?

 

Mr. Miyagi: thank you, mj, the only one here i respect

 

percenary: hello???

 

Mr. Miyagi: i don’t respect you, im in love with you. mutually exclusive

 

Tony Stank: uhm

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: oh…thats not…

 

percenary: no thats fair actually 😞

 

Mr. Miyagi: like im obsessed with you to a dangerous degree but also ive seen you explode watermelons in fear. so

 

Mr. Miyagi: so anyway

 

Mr. Miyagi: shuri wants to come visit

 

Tony Stank: is that the genius shithead from wakanda

 

Mr. Miyagi: yes

 

Tony Stank: ok yeah she’s cool enough to come to the tower

 

Tony Stank: she has a room if she wants to stay here

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: there’s a coolness standard?

 

Tony Stank: absolutely there is

 

Tony Stank: barnes barely made it, by the way

 

Tony Stank: his only bonus at the time was killing nazis

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: at the time?

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: so his coolness factor has increased since he arrived?

 

Tony Stank: yes, he’s dating percy now

 

baby avenger: percy is very cool

 

mindiana jones: i can't argue there

 

Tony Stank: i meant more the fact that when they started dating Barnes was no longer sad, gay, AND single

 

Tony Stank: you can only be two of those things

 

percenary: fascinating

 

 

 

Bucky and areyoushuriaboutthat

 

Bucky: tony said you can stay at the tower if you want

 

areyoushuriaboutthat: CAN I BE FRIENDS WITH HIS AI

 

Bucky: you can certainly try

 

Bucky: she’s very friendly

 

areyoushuriaboutthat: YES!!!

 

areyoushuriaboutthat: 

 

areyoushuriaboutthat: is your boyfriend going to be there

 

Bucky: is my boyfriend going to be at the place he lives? Yes

 

areyoushuriaboutthat: nnnhnfndbsbg

 

Bucky: he will not bite you

 

areyoushuriaboutthat: he seems like a biter

 

Bucky: no he definitely is a biter

 

Bucky: he just won't bite YOU

 

areyoushuriaboutthat: hmmm

 

Bucky: i have bite marks because i let him chew on me like a rawhide toy

 

Bucky: you will be fine

 

areyoushuriaboutthat: freak 🫵

 

Bucky: yes!

 

areyoushuriaboutthat: ugh whatever i'll see you like tomorrow

 

Bucky: hehehe yess

 

Bucky: you’ll love new york

 

areyoushuriaboutthat: do you think it’s cooler than wakanda

 

Bucky:

 

Bucky: okay well

 

Bucky: wakanda is undeniably amazing

 

Bucky: and it means a lot to me

 

Bucky: but my life is in new york right now, you know?

 

Bucky: and i like hot dogs

 

areyoushuriaboutthat: yeah you do.

 

Bucky: OKAY

 

 

 

Van Keppels

 

Leopold: my boss just mentioned that he appreciates how much i stay out of the office drama and shenanigans. i have no idea what he was talking about

 

Karles: Then I suppose you are doing a fantastic job!

 

Karles: I found a beetle on the sidewalk. Would you like to see it?

 

Leopold: call me. 

 

 

 

Avengers Watch @avengerswatchofficial

Bucky Barnes spotted at Delmar’s Deli in Queens!

[Image Attachment: Bucky is standing in a deli on his phone. He’s wearing a white shirt that says I’M THE CHEETAH THAT IS THREATENING TO GO CRAZY]

 

annlis @anli

Ohhhh he looks hot

 

james @jimmyjammy

gnawing at the bars of my enclosure

 

mimi @wheresmybeans

hes so cutie but WHAT is that shirt

 

bearbi @bearbi3 

@spidey-official @jbarnes @TonyStark @NatashaR ????

 

Black Widow, Baby @NatashaR

It’s part of a matching set.

 

Black Widow, Baby @NatashaR

[Image Attachment: Though his face isn’t visible, it’s clearly Bucky’s mysterious boyfriend, wearing a sweater over a white shirt that says I’M THE DOG THEY PUT WITH CHEETAHS TO KEEP THEM FROM GOING CRAZY IN CAPTIVITY]

 

iron man <3 @starkswife

oh my god.

 

 

 

You Know Who I Am @TonyStark

I have crazy garlic fingers from peeling and chopping garlic cloves yesterday. This phenomenon is always fascinating to me because it reminds me that I, too, am made of meat, and therefore I am susceptible to being seasoned. 

 

scientists hate this local new yorker @jbarnes

so how are those meds working?

 

You Know Who I Am @TonyStark

Pretty good, i’d say

 

scientists hate this local new yorker @jbarnes

wonderful

 

 

 

SSEA

percenary: so, the WSC building is trying to do a phone ban while in session

percenary: and i usually attend the meetings where they announce this sort of stuff, but since i was busy, the whole team went instead

Tony Stank: oh my god

Tony Stank: what did they do??

percenary: [Video Attachment: The SWORD team is sitting in the back of a large conference room. There’s a projector with a slideshow, detailing the limits and rules of the proposed cellphone ban. 

Mal raises a hand. “Will I be permitted to send smoke signals instead?” 

The man presenting—his nametag reads Jake— blinks. “Uh, I don’t think open flames are permitted on WSC grounds. So…no.” 

Mal sighs heavily. 

A few seats down, Bridgette raises her hand. “What about carrier pigeons?” 

“Uhm, is it a service animal?”

“...No.”

“Non-service animals aren’t allowed on WSC grounds either.” Jake tells her.

Spencer raises his hand. “What if I know somebody who has a service animal of suspicious intelligence? Could this hypothetical legally registered service animal carry messages for me?” 

Jake splutters. “I—I suppose? Well—we can’t have an animal loose in the building, they’re required to stay with their handlers—”

Ross cuts him off. “Let’s say I am caught with my cellphone during a session, and so am required to surrender my cellphone at the start of the following session. If I go home and replace every single component in the phone with a replacement, is it still the same phone? How does the WSC plan to address this Grecian philosophical dilemma?” 

Jake is stunned silent. “Well, we—” He looks at the slide, then as Ross. “We wouldn’t confiscate your phone, uh, that’s—that’s a security breach, and also seizure of personal property. Nowhere on the slide does it say that we’d, uh, do that—” He looks at the slide again. 

Next to her, a furrow in his brow, Lee raises a hand. “Would I be permitted to use a Cobra PX650 Pro Business 2W 6-Pack FRS 2-Way Radio with Charging Port to send messages in morse code while we are in session?”

Jake swallowed. “I—That’s not a cell phone? So, well, it’s—” He stops for a second and stares at the slide blankly. “I…” 

Dan looks up from his phone. “Would banning cell phones cause Verizon’s stock price to drop? Would you recommend diverting from the company before the ban goes into effect?”

Jake stares at Dan. Dan does not stare back, because he is playing on his phone. Jake slowly folds up his slideshow pointer and puts it in the pocket of his coat. He turns off the projector and walks out of the conference room, shutting the door and turning off the lights behind him. The entire assembled group of WSC members and employees sits, stunned. SWORD gets up and files out of the room, illuminated only by the glow of Dan’s Flappy Bird game. 

“Thank God,” Ross is heard saying to Mal as they leave. “I have an eyebrow threading booked in an hour. I was hoping this wouldn’t go too long.”]

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: now where was this energy during SHIELD

 

Tony Stank: every day i wake up and remember these people are at the highest level of national security clearance and start crying

 

 

 

trusted with scalpels

doc mcstuffins: idk if i'm actually a guy but we have a autopsy due at 9 am tomorrow so tbh i can't really worry about that right now

doogie howser, i guess: SPENCER????

Notes:

percy and bucky are both losers. friendly reminder

tony does have a spreadsheet that keeps track of how cool everyone is, and there ARE rigid standards, as well as a list of things that can add and subtract from your score. last time he let losers into the tower, the og avengers happened and he's not gonna let that slide again\

karl and lee :)

OKAY SO FUNNY STORY the SWORD team is...sort of all based off people i know in real life, and the person i based spencer off of just came out and is transitioning. so because its pride month and im a #ally spencer is now also not cisgender. enjoy this subplot

credits: tony's tweet about the garlic is a mimic of a post by tumblr user darrellenjoyer and the cell phone bit is based off a reddit post i saw about student responses to a high school cell phone ban

plumbing baby. goodbye

Chapter 55: feeling mystical magical in the tower tonight

Notes:

(See the end of the chapter for notes.)

Chapter Text

SSEA

 

Tony Stank: WHO THE FUCK IS PLAYING THAT

 

baby avenger: huh

 

Tony Stank: THAT GODDAMN MUSIC WHO IS THAT

 

Mr. Miyagi: im not even at the tower right now

 

Tony Stank: its driving me fucking nuts what the hell is this

 

gitc: what does it sound like?

 

Tony Stank: its like JUST far away enough that i cant exactly tell but i can still hear it

 

Tony Stank: i am absolutely consumed by rage right now

 

mindiana jones: go investigate

 

Tony Stank: somebody is going to pay VERY soon

 

 

 

 

centenarian, 30 ton hell puppy, toph from avatar = blended family

 

pb&j: hello my darling boyfriend

 

pb&j: inquiring minds would like to know when you will come back home

 

jamie <3: about ten minutes, im on my way

 

jamie <3: is everything alright?

 

pb&j: 

 

pb&j: so…you saw tony’s texts?

 

jamie <3: yeah

 

jamie <3: oh my god is that you playing the music

 

pb&j: it might have been yes

 

jamie <3: jesus christ babe

 

jamie <3: what are you even listening too that loud

 

jamie <3: your ears are so fucking sensitive anyway

 

pb&j: 

 

pb&j: benson boone

 

jamie <3: huh

 

jamie <3: wait

 

jamie <3: is that the man with the backflips

 

pb&j: he has entranced me

 

pb&j: he’s so smooth with it

 

jamie <3: …the backflips are pretty impressive

 

pb&j: tony is after me

 

jamie <3: where are you

 

pb&j: hiding :( im at the bottom of the pool

 

pb&j: but benson is playing through friday so its still. everywhere

 

jamie <3: oh my god

 

pb&j: i can hear it through the water :)

 

jamie <3: i cannot fucking believe you are about to get killed by tony over fucking mystical magical by benson boone

 

pb&j: moooooonbeeeeaaaam icecreeeeaaam

 

jamie <3: theres no way you are genuinely enjoying this

 

pb&j:

 

jamie <3: oh my fucking god im dating a benson boone enjoyer

 

pb&j: god forbid a boy likes pop music

 

jamie <3: BUT MOONBEAM ICECREAM??

 

pb&j: ITS A GOOD SONG

 

pb&j: THAT ONE CLIP IS OUT OF CONTEXT AND OVERPLAYED

 

jamie <3: you’re lucky you’re cute

 

pb&j: are you going to come save me

 

jamie <3: always, and you know it

 

pb&j: love youuuuuuuuuuuuuu

 

jamie <3: good

 

 

 

 

bucky’s victims and also percy’s bimbos

 

tungsten dioxide whats this: GUYS

 

The News(™): hi

 

tungsten dioxide whats this: I GOT IN THE ELEVATOR AT THE TOWER AND BENSON BOONE IS PLAYING???

 

president lincoln: HWAT

 

moonmoon: are you being serious

 

Scary Captain: you better be joking

 

tungsten dioxide whats this: [Video Attachment: It’s a close up of Peter, facing up at the ceiling. Overhead, Mr Electric Blue by Benson Boone is playing ]

 

tungsten dioxide whats this: lowkey feeling like doing a backflip…

 

avril lavigne: wait can you actually do a backflip 

 

tungsten dioxide whats this: 

 

tungsten dioxide whats this: sally are you fr rn

 

avril lavigne: what

 

tungsten dioxide whats this: i did like six of them off the flatiron building two days ago

 

avril lavigne: well what the fuck were you doing up there

 

tungsten dioxide whats this:

 

Murphy’s law: 

 

Murphy’s law: sally

 

avril lavigne: what??

 

Murphy’s law: spider-man.

 

avril lavigne: OH RIGHT

 

President lincoln: idk if peter could pull of those jumpsuits though

 

tungsten dioxide whats this: perhaps not

 

moonmoon: i mean…he does wear a skintight suit every day

 

tungsten dioxide whats this: but i dont have the

 

tungsten dioxide whats this: well

 

Murphy’s law: ?

 

tungsten dioxide whats this: the benson bulge

 

nedleedle: WHAT

 

tungsten dioxide whats this: i feel like i shouldn't have to explain myself on this one

 

president lincoln: i feel like you absolutely do, peter

 

tungsten dioxide whats this: he just

 

tungsten dioxide whats this: uh

 

tungsten dioxide whats this: when he wears his little jumpsuits and is on stage

 

tungsten dioxide whats this: uhm

 

moonmoon: that thang swinging

 

tungsten dioxide whats this:

 

tungsten dioxide whats this: what cindy said

 

Murphy’s law: what the actual fuck peter

 

tungsten dioxide whats this: moving on

 

Avril lavigne: NO NOT MOVING ON

 

tungsten dioxide whats this: MOVING ON

 

tungsten dioxide whats this: i DO think i am definitely smooth enough

 

tungsten dioxide whats this: the man is like a dolphin

 

nedleedle: wow

 

nedleedle: who is playing a benson boone song in the tower though

 

tungsten dioxide whats this: i dont know but it seems to be the whole album

 

tungsten dioxide whats this: im wandering through the living areas and i can hear it all over

 

moonmoon: fascinating

 

 

 

 

*kills you in russian*

 

natatouille: are you back??

 

bucky bear: shit

 

bucky bear: yes im sorry

 

bucky bear: i have your cinnabon

 

natatouille: you said you would bring it to me

 

bucky bear: i did say that and im sorry

 

bucky bear: but i cant any more

 

natatouille: ??

 

bucky bear: im hiding with percy

 

natatouille: hiding??? Why

 

bucky bear: take your headphones off

 

natatouille: 

 

natatouille: what the hell is this

 

bucky bear: benson boone

 

natatouille: who is that

 

natatouille: why are we hiding from him

 

bucky bear: we are hiding from tony

 

bucky bear: tony does not like benson boone

 

natatouille: really?

 

natatouille: this is actually kinda catchy

 

bucky bear: do not say that to percy

 

bucky bear: i do not need two benson boone enthusiasts in my life

 

bucky bear:

 

bucky bear: percy would like the correction that benson boone fans are called ‘booners’ to be known

 

natatouille: fun name

 

natatouille: idk i like it

 

natatouille: ill be a booner

 

natatouille: i vote we should finish the album

 

bucky bear: tony is on a WARPATH

 

bucky bear: i think FRIDAY is a booner as well because she won’t turn it off

 

natatouille: angry tony pulled from a lab bender…

 

natatouille:

 

natatouille: where are you guys hiding?

 

bucky bear: giant air bubble at the bottom of the pool. come join us

 

natatouille: on my way

 

 

SSEA

 

Tony Stank: IM GOING TO KILL EVERYONE IN THIS TOWER

 

baby avenger:

 

 

Tony Stank: NOT YOU PETER JUST EVERYONE ELSE

 

Tony Stank: WHERE THE FUCK ARE YOU ASSHOLES

 

 

 

*kills you in russian*

 

bucky bear: oh god

 

bucky bear: percy’s making that face

 

natatouille: what face

 

natatouille: he looks normal to me

 

bucky bear: its subtle but its there

 

bucky bear: he’s going to start ragebaiting tony i just know it

 

natatouille: WHAT

 

bucky bear: he’s so good at being so aggravating and he has no fear in his body

 

bucky bear: oh my god im so scared right now

 

natatouille: if tony finds us will percy protect us????

 

bucky bear: lets pray the answer is yes.



SSEA

 

percenary: booning out 🔥

 

percenary: feeling mystical magical in the tower tonight

 

Tony Stank: YOU

 

percenary:

 

 

Tony Stank: TURN IT OFF

 

percenary: no

 

percenary:

Tony Stank: IM GOING TO FUCKING KILL YOU

 

percenary: going to backflip my way out of it

 

Tony Stank: FUCK YOU

 

percenary: bro is NOT feeling mystical magical…

 

Tony Stank: WHERE THE FUCK ARE YOU

 

Tony Stank: IM GOING TO STRANGLE YOU

 

percenary:

Notes:

guys i fucking love benson boone. not even ironically. i love him and his backflips and his little jumpsuits. people were so upset about the him showing bulge in his jumpsuits but i think he should show more benson bulge

i accept NO benson boone slander. i love feeling mystical magical

benson boone now canon in The File universe btw. i know i said most of the texts fic is sort-of-not-canon/soft-canon, but this part is absolutely canon

percy is a no.1 ragebaiter btw, i firmly believe that about his character. he does it with malicious glee

plumbing baby. goodbye

Chapter 56: ragebait the ex-assassin guys trust me. boomix soob

Notes:

(See the end of the chapter for notes.)

Chapter Text

our family tree is a wreath

 

horse girl: are any of you free right now?

 

mcshizzle: whats up?

 

horse girl: i want to play uno

 

horse girl: did you know they have online uno? I just found out! 

 

sparky: we would all love to play uno with you

 

sparky: every single one of us. 

 

sparky: right, guys?

 

pied piper: of course hazel!

 

RARA: I will demolish both of you.

 

my chemical ron weasley: sure

 

mcshizzle: im in

 

framk: we’re setting the game up!

 

framk: percy?

 

furby slayer: one sec peter is helping me ragebait jamie lmao

 

sparky: jesus christ

 

mcshizzle: ragebaiting the fucking winter solider is WILD stay safe

 

pied piper: “be his peace” 

 

RARA: I don’t think Percy has ever been anybody’s peace.

 

pied piper: well. results please✊🖐️✊🖐️✊🖐️✊🖐️

 

framk: what is that

 

pied piper: grabby hands

 

pied piper: just discovered that combo

 

framk: oh its nice

 

pied piper: thanks frank

 

framk: yeah man of course

 

mcshizzle: is percy dead?

 

furby slayer: [Video attachment:

 

Peter walks into the common room, discreetly holding his phone. Percy is sitting cross-legged on the couch, fiddling with a rubik's cube—each little square has a bump on it, indicative of the color of the square. The television is playing faintly in the background. Bucky is in the kitchen behind them, making tea. 

 

“Hey, Percy,” Peter says, sitting across from him. “It’s, like, normal for people to have rules for their significant others, right?” 

 

Percy tips his head to the side, still focused on the rubik's cube. “Oh, yeah. Why?” 

 

“Argument with my friends. It’s a whole thing.” 

 

“Yeah, it’s totally fine. Like, Jamie has rules for me. It’s no big deal.” Percy brushes off. Bucky looks up at his name, but when it’s clear Percy isn’t talking to him, he returns to his tea. 

 

“Like what?” Peter asks, valiantly fighting down a giggle. 

 

“Well, he has all my passwords and goes through my phone twice a day,” Percy says. “And he makes sure I don’t have any guys in my phone—he removed them.” 

 

Bucky’s head snaps up. “What?” He calls from the kitchen. 

 

Percy ignores him. “Including my cousins and step-father.” 

 

Bucky puts his mug down and turns towards the two of them. “I have your passwords because you fucking forget them—”

 

“No family.” Percy continues. “I’m also not allowed to wear shorts or anything revealing outside of our apartment, in case, like, a guy sees me.”

 

“What the fuck are you talking about?” Bucky yells from the kitchen. He rounds the counter towards them. “You’re wearing shorts right now!” 

 

Peter zooms out a bit, and Percy is, indeed, wearing a pair of sleep shorts. “I have no clue what you’re talking about.” Percy says blandly. “Anyway, another one is, like, I used to have this screenreader software, but the robot voice was a guy, so he deleted it.” He shrugs. “Can’t read any more.”

 

“What the fuck are you saying?” Bucky demands, appalled. “Babe, what?” 

 

“He says I don’t need to read, so, it’s whatever, I guess.” Percy continues. He’s still fiddling with the rubik's cube. “But, yeah, I’m also supposed to have dinner ready for him when he gets home, or else my basic human rights get taken away for a bit.” 

 

Peter discreetly turns to camera to Bucky, who is standing, flabbergasted. His mouth opens and closes a few times, clearly trying to find words. 

 

“I’m also, supposed to, like, do all his laundry and stuff.” Percy finishes the rubik's cube and places it on the coffee table. “But it’s not a big deal.” 

 

Bucky’s eyes narrow, and he walks over to the couch, stopping right in front of Percy. Peter has to lean to the side a bit to get both of them properly in frame. 

 

“And, like, I’m not supposed to work, either, so he had me quit my job when we got together.” Percy continues, unbothered. “And—” Abruptly, Bucky leans down and scoops an arm under Percy’s thighs, the other around his lower back. He lifts Percy and settles him against his hip, easily supporting his weight with one arm. His free hand covers Percy’s mouth. “No.” Bucky says. “No more of this.” He looks at Peter, who, seemingly, has lost the giggle war. “Is this a joke, you little shit?” Bucky asks. 

 

Peter snickers. 

 

Bucky sighs. Against his hand, Percy is still talking, though it’s muffled enough to be unintelligible. “To be clear about whoever this fuckass video is being sent to—Percy can wear whatever he wants, he looks good in everything and I mind my damn business. I’m trying to get him to use his screen reader more but he refuses and just tells me he can’t read even though he literally fucking can, he cooks because he likes to and I’m shit at it, I do the laundry, and I couldn’t get him to quit his job if I tried—not that I even would.” Bucky shakes his head. “Rules,” He scoffs under his breath. He looks at his boyfriend, squirming a little in his hold. “You’re suck a fucking shithead. Did you—” To Peter, “He just licked my palm.”

 

“Gross.” Peter says.

 

“My tongue has been down your throat,” Bucky says to Percy, equal parts perplexed and exasperated. “Literally why would I be grossed out at you licking me?” 

 

Percy shrugs. 

 

“Yeah, you’ve had enough,” Bucky says. Percy still in his hold, he turns to leave. “Bye, Peter,” He calls. Percy makes a muffled noise of longing that sounds like boomix soob, and Bucky stops in the doorway with a sigh. He slings Percy over one broad shoulder, and with his free hand, he grabs the rubik's cube off the table. 

 

Hanging upside down, Percy continues speaking as Bucky walks down the hall. “And now he’s silencing me!” He calls. Bucky’s grumbled you’re the worst is heard, then a did you just bite my ass?

 

“It’s right in front of my face, to be fair.” Percy defends. “Also, your hand has been on mine for like five minutes.” 

 

Then the elevator closes. ]

 

pied piper: IM FUCKING CRYING WHAT

 

framk: why do you treat him like this oh my gods

 

furby slayer: idk he just likes me

 

furby slayer: loves*. I love him. 

 

furby slayer: phone thief sorry

 

sparky: are you guys together?

 

furby slayer: trapped

 

horse girl: ???

 

furby slayer: he got fed up enough that i got put in boyfriend jail

 

my chemical ron weasley: ?????

 

furby slayer: all four limbs wrapped around me

 

furby slayer: like koala if koala weighed over 200 pounds

 

furby slayer: i can’t really move

 

pied piper: oh!! waiter!! waiter!! my steak is too juicy and my potatoes too buttery!!

 

pied piper: thats how you sound

 

pied piper: ugh

 

furby slayer: should i start chewing on his clavicle yes or no

 

furby slayer: its right in front of my face

 

mcshizzle: are you in a fucking full body bind

 

furby slayer: cant even type if i wanted to tbh, thank god for text to speech

 

furby slayer: jamie said he’ll be my eyes for uno though :)

 

horse girl: yay!!!!!

 

furby slayer: and also maybe my arm because he’s not letting go of me

 

sparky: i cant believe there’s a person out there that can handle percy

 

RARA: It’s shocking.

 

my chemical ron weasley: like a zookeeper…

 

horse girl: i was going to defend percy against the wild animal allegations but he did just ask for a vote on whether or not he should chew on his boyfriend

 

RARA: A vote. Democratic until the end. I respect that.

 

mcshizzle: bro is not beating the feral animal allegations

 

furby slayer: bucky now. you’re lucky percy is like half asleep right now or he would be very indignant. 

 

pied piper: and he uses big words…

 

framk: indignant is NOT a big word bro

 

pied piper: we dyslexic here 😛

 

sparky: did you say he was asleep??

 

furby slayer: he’s halfway there. 

 

furby slayer: his neurodivergent ass still gets defeated by a weighted blanket (me)

 

pied piper: SOBBING

 

furby slayer: why do you think I do this when he’s being a shithead? 

 

furby slayer: he’s much sweeter when he’s like this. no psychological torment. 

 

sparky: i think it was from a tiktok

 

furby slayer: same thing

 

mcshizzle: that’s fair

 

furby slayer: so…uno?

 

horse girl: i’ll send the link! 

 

 

 

bucky’s victims and also percy’s bimbos

 

The News(™): check in

 

The News(™): how we doing everyone

 

tungsten dioxide what’s this: im eating my choccy muffin with my snickerdoodle latte

 

tungsten dioxide what’s this: dont let this fool you i would do well in a war

 

moonmoon: this guy out here protecting the streets…

 

nedleedle: This body craves red 40

 

moonmoon: idk where i am rn. i was trying to go to kohls

 

Avril lavigne: 911

 

The News(™): HWAT

 

tungsten dioxide what’s this: please tell me you're not in trouble and need me to come help

 

tungsten dioxide what’s this: im still eating my choccy muffin with my snickerdoodle latte

 

tungsten dioxide what’s this: i would do well in a war but i dont particularly want to have to

 

murphy’s law: 911 THE TV SHOW

 

moonmoon: seriously where am i

 

president lincoln: I HATE IT HERE

 

mindiana jones: bobby dead eddie “straight” buddie not canon

 

nedleedle: i dont know what any of those words mean

 

mindiana jones: well, buddie is like

 

mindiana jones:

 

mindiana jones:

 

mindiana jones:

 

mindiana jones: dead?

 

mindiana jones: fucking dead?

 

mindiana jones: not? 

 

mindiana jones: you don't know what ANY of those fucking words mean?

 

nedleedle: 🤪

 

mindiana jones: i

 

Avril lavigne: she’s fucking speechless

 

tungsten dioxide what’s this: so…i can keep eating?

 

Avril lavigne: yes peter you can keep eating

 

tungsten dioxide what’s this: yippie!!

 

tungsten dioxide what’s this: swinging my feet and sipping my little drink in the park :)

 

moonmoon: i saw you throw a car at somebody on the news yesterday

 

tungsten dioxide what’s this: mhm :)

 

moonmoon: right

 

moonmoon: don’t worry about them, they’re just tweaking out over the latest season of their show

 

Murphy’s law: THERE'S NO WAY BUCK AND EDDIE AREN'T IN LOVE

 

Murphy’s law: IM WEEPING ON THE FLOOR

 

president lincoln: EDDIE LITERALLY PUT BUCK IN HIS WILL AS THE GUARDIAN OF HIS CHILD

 

president lincoln: BUCK MOVED INTO HIS FUCKING HOUSE

 

Avril lavigne: we’re waiting on season nine. it’s tough. 

 

nedleedle: …this has been going on for eight seasons? 

 

president lincoln: it’ll be canon one day. trust me. I swear

 

nedleedle: …right

 

tungsten dioxide what’s this: 

tungsten dioxide what’s this: nationally ranked science school btw

 

Avril lavigne: eat shit parker

 

moonmoon: seriously where the hell am i

Notes:

i will never stop my percy ragebaiting agenda. never

hazel is very good at uno btw. her and bucky were the overall winners. reyna did demolish piper and jason though, and she put literally all her energy into that. she did not give a gaf about winning the overall game

grabby hands emoji combo my beloved...

percy: or else my basic human rights get taken away for a bit
bucky:
bucky: babe you are a disabled, enhanced, bisexual man of color. i am the least of your worries

so i googled how much bucky weighs and most sources said 260 lbs???? beefed up ig. normally he would squish somebody like a bug but his neurodivergent demigod boyfriend likes being smushed recreationally. and he's sturdy. so

percy, calmly snuggling in his boyfriend's arms: :)
bucky: why aren't you like this all the time. why do you act the way you do

peter's choccy muffin bit i saw from a screenshot of pintrest pin of a text. obviously

you know i had to put my buddie agenda in here...being a 911 fan is really rough guys
bobby is genuinely not dead to me. im so delusional he's alive in my head

i keep seeing all these jokes about the trump administration banning yaoi and yuri and i need you guys to know that they will NEVER get me. i will be scratching toxic yuri situationships into the wall of my cell with a screwdriver. i'll be whispering slowburn yaoi to the other prisoners during yard time. they will not stop me

plumbing baby. goodbye

Chapter 57: temu vape

Notes:

(See the end of the chapter for notes.)

Chapter Text

SSEA: 

 

Mr. Miyagi: shuri is landing in half an hour

 

Mr. Miyagi: do we need to go over the rules again

 

Tony Stank: no collaborative ultron p2: mega-vibranium edition 🙄

 

the 𝓰𝓲𝓷𝓰𝓮𝓻: do not try to obtain blackmail on the wakandan royal family

 

baby avenger: do not let her obtain ME

 

Mr. Miyagi: which includes…?

 

baby avenger: any sort of removal, addition, or replacement of my body parts, do not relinquish any forms of my DNA, or allow her to put me in any sort of Device

 

Mr. Miyagi: good

 

Mr. Miyagi: the last thing we need is spider-shuri

 

Mr. Miyagi: or more accurately her turning herself into some sort of abomination because we are fairly sure if anybody else got bit like you did, they would have gotten super arachnid cancer and died

 

baby avenger: 😝

 

mindiana jones: no interrogations about the impact of Wakanda’s isolation on the rest of the African continent during the 17th to 19th century for my history paper

 

gitc: no attempting to get on wakandan tiktok

 

Mr. Miyagi: good

 

Mr. Miyagi: percy?

 

percenary: i will be soooo nice and kind and docile

 

Mr. Miyagi: i am less convinced than everyone else’s response

 

Mr. Miyagi: but i know thats the best i’ll be getting from you, so

 

 

 

 

areyoushuriaboutthat and furrycon attendee

 

areyoushuriaboutthat: i want to eat an american new york hot dog

 

furrycon attendee: Go buy one, then

 

furrycon attendee: 

 

furrycon attendee: Shuri, both mother and I have talked to you about this. The mantle of the Black Panther has a great cultural and historical significance. It is most definitely older than the concept of a furry. 

 

areyoushuriaboutthat: but you get so mad every time its so funny

 

areyoushuriaboutthat: i really expected it to have lost its sparkle by now but nope! still funny

 

furrycon attendee: I hope your hot dog is disgusting.

 

areyoushuriaboutthat: WOAH

 

areyoushuriaboutthat: uncalled for

 

areyoushuriaboutthat: ooooooooooh i see the tower!!

 

areyoushuriaboutthat: mehehehehe

 

furrycon attendee: Mother would like me to remind you that you are representing our entire nation. Act right, at least in public.

 

 

 

our family tree is a wreath

 

pied piper: bush is so good idk

 

pied piper: if you’re anti bush you dont deserve to be having sex

 

mcshizzle: he invaded iraq and didnt even find any weapons of mass destruction???

 

pied piper:

 

pied piper: oh, babe…

 

mcshizzle: what

 

mcshizzle: OH

 

mcshizzle: OHHH

 

mcshizzle: THIS IS YOU BEING A FREAK

 

pied piper: yes!

 

 

centenarian, 30 ton hell puppy, toph from avatar = blended family

 

pb&j: holy shit

 

pb&j: ross and piper can never fucking meet

 

jamie <3: the thought alone just sent a shiver down my spine.

 

 

 

 

 

*kills you in russian*

 

bucky bear: a few rounds into strip poker and its becoming increasingly clear im wearing a bomb vest

 

natatouille: i like how you told specifically only me this because you know anybody else would be extremely concerned

 

 

 

 

bucky’s victims and also percy’s bimbos

 

tungsten dioxide whats this: who the FUCK brought the expired mt dew to the function

 

moonmoon: me bitch

 

The News(™): woah this expired like three years ago

 

The News(™): and yet, still carbonated…

 

president lincoln: fascinating

 

moonmoon: right??

 

moonmoon: i figure we’d all take little sips and see who starts quivering the fastest

 

murphy’s law: im down

 

avril lavigne: peter go first

 

avril lavigne: in case it turns out to be evil

 

avril lavigne: you’re sturdier than the rest of us

 

tungsten dioxide whats this: i was gonna be a lil mad then i remembered how frail you people are lowkey

 

tungsten dioxide whats this: yeah im in

 

murphy’s law: wait can we test the bug milk first

 

moonmoon: i think i may have missed this one

 

moonmoon: bug milk?

 

murphy’s law: yeah

 

nedleedle: guys i feel like something important was happening today but tbh i forgot what

 

The News(™): so clearly not that important then

 

nedleedle: true

 

tungsten dioxide whats this: everybody bring your stuff to one of the conference rooms

 

tungsten dioxide whats this: i talked to friday and shes down for us to conduct our experiments but only if she can watch

 

tungsten dioxide whats this: something about having poison control on speed dial or whatever

 

Avril lavigne: fuck yeah fancy tower time

 

 

 

 

Bucky and areyoushuriaboutthat

 

areyoushuriaboutthat: hoe pull up

 

Bucky: is this your way of telling me you’re here?

 

areyoushuriaboutthat: yes

 

Bucky: ohhh

 

Bucky: thats why percy just perked up like a dog hearing a car down the block

 

areyoushuriaboutthat: eek!

 

 

 

areyoushuriaboutthat and furrycon attendee

 

areyoushuriaboutthat: i have landed on starks roof

 

areyoushuriaboutthat: brother if barnes’s rabid boyfriend attacks me you must promise to avenge me

 

furrycon attendee:

 

furrycon attendee: Sorry. Don’t have jurisdiction in America. 

 

areyoushuriaboutthat: WHAT

areyoushuriaboutthat: THATS NEVER STOPPED YOU BEFORE?????

 

furrycon attendee: You will be missed.

 

areyoushuriabouthat: im posting that video of your own suit flinging you across my lab on pinterest

 

furrycon attendee: PINTEREST?!

 

areyoushuriabouthat: BARNES !!!

 

areyoushuriabouthat: [Image Attachment: It’s Shuri, an arm tossed around Bucky’s shoulders (she’s on her tiptoes) with a peace sign thrown up. Bucky is smiling.]

 

furrycon attendee: He looks well. 

 

areyoushuriabouthat: MEETING STARKS AI

 

areyoushuriabouthat: I FEEL LIGHT HEADED

 

furrycon attendee: Mother said no AIs for you.

 

areyoushuriabouthat: FUCK

 

areyoushuriabouthat: whatever. i didnt even want one anyway

 

areyoushuriabouthat: oh shit??

 

furrycon attendee: Yes?

 

areyoushuriabouthat: whaaaat the fuck

 

areyoushuriabouthat: Barnes said i could meet his boyfriends dog

 

areyoushuriabouthat: so he went to go get the dog

 

areyoushuriabouthat: and obviously i, left unsupervised, started to wander about

 

areyoushuriabouthat: went down a hallway

 

areyoushuriabouthat: i hear people

 

areyoushuriabouthat: poking my head in a room and there are teenagers inside

 

areyoushuriabouthat: im nervous

 

areyoushuriabouthat: do i go say hello

 

furrycon attendee: Yes, Shuri. Introduce yourself! 

 

furrycon attendee: Mother told me to tell you that you need more friends your age. 

 

areyoushuriabouthat: ough

 

areyoushuriabouthat: ok im going

 

 

 

 

Buck and areyoushuriabouthat

 

Bucky: where the fuck did you go

 

Bucky: shuri do not play games with me

 

 

 

AcDec Official Chat

 

Cindy: pulling out the ancient texts…

 

Charles: the groupchat from before we were #squadgoals

 

Ned: do you guys really want to introduce ourselves to the princess of WAKANDA in a groupchat called ‘bucky’s victims and also percy’s bimbos’

 

Betty: …no

 

Abe: also like all the evidence of peter being. Uhm

 

Sally: a special boy ♥️

 

Peter: i’d rather you just out my identity than speak around it like that tbh

 

[areyoushuriaboutthat has been added to the group]

 

Ned: OH SHIT

 

[Ned removed Flash from the group]

 

Sally: flash thompson jumpscare…

 

areyoushuriabouthat: abundant lore…

 

Betty: dont even worry about that one

 

Betty: hi!!! Im betty :) sorry we cant really talk aloud, the temu vape charles brought is louder than expected!

 

areyoushuriabouthat: do they normally sound like that? to be frank, we don’t have vapes in wakanda

 

Charles: god the news stations were so right when they said you guys were way more advanced than us

 

Peter: imagining a world without massive clouds of tutti frutti when i emerge from the school bathroom

 

Peter: its a beautiful one

 

MJ: to answer your question: no. normally vapes are near silent. we’re not sure what’s up with this one

 

Ned: it sounds like a jet engine

 

areyoushuriabouthat: fascinating

 

areyoushuriabouthat: is that expired mountain dew?

 

Abe: yes it is!

 

areyoushuriabouthat: woah

 

Abe: and wait until you find out about the bug milk

 

 

 

 

areyoushuriabouthat and furrycon attendee

 

areyoushuriabouthat: stop calling me

 

areyoushuriabouthat: i think i am exactly where i need to be

Notes:

always forget how scary ao3 gets in october. jumpscares left and right. get that freak on ig

t'challa pretending to be a reasonable responsible big brother and not a lowkey crash out is so important to me

piper pro bush agenda is my official stance btw

bomb vest bit not mine...once again i have found it bootlegged on pinterest with the original tweeter gone

crashing out trying to come up with ideas for my halloween chapter. toeing the line between silly haha funny that you guys are here for vs. halloween horror
its not going very well...

plumbing baby. goodbye

Chapter 58: halloweenie 4: REALLY big pumpkin...slim jim ?

Notes:

(See the end of the chapter for notes.)

Chapter Text

“There are definitely worse places,” Bucky offers, closing the trunk, bag over his shoulder. “Once, I hid out in a sniper’s nest for three days in an abandoned building in Dushanbe. That fucking sucked.” 

 

Leaning against the passenger door, Tony looks at him over the rim of his sunglasses. “I’m sure.” 

 

All things considered…the house is really nice, actually, and they’re all pretty sure Tony has something to do with it. Not that Natasha’s complaining, of course. If she can piggyback off his demands for luxury, she’s absolutely going to. 

 

It’s within walking distance, barely two blocks out, from the river, and while the Delaware, apparently, isn’t on Percy’s top ten American rivers, he likes it well enough. The house itself is a grand thing, at least a century old, red brick and a charming chimney sticking out from the side. Two stories, a cobblestone path winding through the yard, set on the corner in the historic district. It’s a nice place, definitely. 

 

It’s a damn shame they’re here, then. 

 

Percy, climbing out from the back seat from where he’d been asleep against the window, kicks lightly at the cluttered pile of leaves lining the curb. “Dushanbe?” 

 

“Tajikistan.” 

 

Percy scrubs at his eyes, hair sticking up on end. “Haven’t been.” 

 

Natasha adjusts her scarf against the wind. “This is a bullshit op,” She mutters, arms crossed. “Seriously, they couldn’t pick anybody that could pass as a family?”

 

“Offended.” Peter chimes in. 

 

Natasha pats him consolingly on the head. “Seriously, though…what the fuck do they expect us to do, here?”

 

Percy shrugged. “It’s only a couple of days. Does it really matter?”

 

“Yes,” Natasha muttered mulishly. She gestures to Tony and Peter. “We could play the father and son bit with those two, but,” She waves her hand at the three of them. “What about us?” 

 

Bucky looks between Natasha and Tony, then her and Peter, then at Percy. “Yeah…” He says. “I got nothing.” 

 

“I love a good backstory,” Peter says, drawing his shoulders into the warmth of his coat, “But, like, aren’t we just here as a response team? Not, like…infiltrating anything, right? Because, I don’t know if you guys know this about me, but I’m not a very good liar.” 

 

“We know.” The four of them chorus. 

 

Peter sighs. 

 

“We’re just here to make sure nothing…happens.” Percy affirms. His sunglasses are sliding down the tip of his nose, and Natasha pushes them up with her fingertip. “It’s mostly speculation,” She continues for him. “It’s probably nothing, but, the past couple years, there’s been issues around Halloween. Local PD started thinking it was an Enhanced, and it was either us or them in riot gear.” 

 

Peter makes a dubious face, and she exhales, puff of air pushing the hair in front of her eyes away. “Congressman and his family live about a block that way,” She juts her chin down the street. “He started making some noise, some favors got called in…and here we are.” She kicks at a stray leaf. “With no decent cover.” 

 

“It’s not like we’ll get recognized,” Bucky says. “I mean, me without the thousand yard stare of depression and Tony without a suit is like Tony Hawk without a skateboard.” 

 

Natasha sighs. 

 

Percy tilts his head. “You really like covers, don’t you?”

 

Natasha shrugs, hands shoved in her pockets. “Maybe,” She mutters. 

 

“We can do a cover.” Tony offers. “We can make one up. Here,” He claps a hand on Peter’s shoulder. “You already said we could pass as father and son.” 

 

“Can I still be Peter? I like being Peter.”

 

“Yeah, you can still be Peter.” Bucky assures. “The rest of us, though—”

 

“Hey, neighbors!” 

 

Five heads snap to the left. A woman in yoga pants and a puffer jacket jogs up to them, a sunny smile on her face. “Glad I caught you,” She continues. “My husband and I saw the moving van and figured it was about time somebody moved in.” A pause. “You know, after…the accident.” 

 

Tony blinks. “I’m sorry, accident?”

 

She holds a hand out. “I’m Evelyn. I live just down the street.”

 

Peter pokes his head out from around the other four. “Nice to meet you!” He chirps. “I’m Peter, and this is my dad.” 

 

Automatically, Tony shakes her hand. “Tony.” He introduces.

 

Evelyn, still smiling, nods. When they offer nothing else, her eyes slowly shift to Percy, Bucky, and Natasha. “Family friends?” She guesses. “It’s lovely of you to help these two settle in.” 

 

A long, silent moment passes. God, Natasha wants a cover so bad right now. 

 

Then, she feels the weight of Percy’s arm around her shoulders. Bucky, on his other side, has gotten the same treatment. “Actually,” he says. “We’re moving in, too.” 

 

Evelyn blinks. “Oh! I didn’t realize you were…” She trails off, looking between the three of them and Tony and Peter. 

 

“Well,” Percy says, completely casual, tipping his head towards Natasha. “Tony’s her brother. And we,” He pulls Natasha and Bucky closer. “Are dating.” 

 

“...All three of you?” Evelyn asks politely. 

 

“Yep. My partners.” Percy confirms cheerily, eyes completely blank. He’s smiling. “Couldn’t live without ‘em.” 

 

Behind his back, Natasha and Bucky make eye contact. God, he’s terrifying, Natasha communicates silently. Look at his eyes. Almost imperceptibly, Bucky nods. 

 

“Right!” Evelyn says. “Well…um, welcome to the neighborhood! Carson and I will have to invite you over for a…a barbeque, or something. Good luck moving in!” 

 

She takes a few steps back, then jogs back towards her house. Percy’s plain smile remains fixed onto his face until she’s up the porch. “Nosy,” He mutters through it. 

 

Natasha, eyes fixed on Evelyn’s front door, makes a disgruntled noise, though she doesn’t lean away from Percy’s unnatural warmth. Bucky, similarly, is pressing himself further into his furnace of a boyfriend. “Partners, really?”

 

“Give me literally any other reason that would explain the dynamic the five of us have that would result in us moving in together.” He raises a brow. “Quickly.”

 

Natasha thinks for a second, then groans. “Fine,” She grunts. “But, just for the record, you—” She leans around and points at Bucky. “Are the last person I’d be in a polycule with.” 

 

He makes a face at her. “Rude.” 

 

“You shot me.” Natasha reminds. “And while that is a perfectly good basis for a friendship, I draw the line at throuple.” 

 

Percy blinks. “But not believing me about Hydra infiltrating SHIELD is fine? And I was supposed to kill Jamie, for a bit.” 

 

“Also, I stabbed him.” Bucky reminds. 

 

“And I’ve been eating your strawberry yoghurts.” Percy adds on. 

 

She smacks him on the side. “What the fuck? Too far, man.” Then she looks at Bucky. “Also, you’re gay.” 

 

“Fuck, right.” He mutters. 

 

Tony puts his face in his hands. “I hate all of you. Did you really have to tell her that?”

 

Percy waves a dismissive hand. “It’s a blue state.” 

 

 

 


 

 

 

The move-in is easy, the van mostly for show. The house is already furnished, and they’ve all packed a duffel with a week’s worth of clothes and the like. There’s a sitting room, living room, dining room, and breakfast nook downstairs, along with an extra bedroom and a screen porch, off to the side, in addition to the regular porch out front. The stairs are between the bedroom and sitting room, and Peter leaps over them to scramble up to the second floor. 

 

“Dibs on first room pick!” He yells over his shoulder. 

 

“Motherfuck—” Natasha runs after him. 

 

He stakes his claim on what the realtor called the ‘primary bedroom’ by webbing the door shut with him inside. Natasha, eyes narrowed, takes the bedroom right down the hall from it, and Tony, after drifting in and out of the sun room, office space, and ‘recreation room’, according to the sticky note on the door, takes the only remaining bedroom on the opposite side of the other two. 

 

“There’s no windows in this one.” Bucky notes. 

 

Tony nods. “Just the way I like it.” 

 

The white walls and overhead lights of the room, nestled on the interior with the office and rec room wrapping around it, do remind Bucky of the labs, oddly enough. 

 

He turns to Percy, who’s still on the threshold of the sunroom. “I think we’re downstairs.” He says with a sigh. Nobody wanted that one—Peter, who’s lived in an apartment since the day he was born, claims that being that close to the ground while you sleep is contrary to the words of the Lord. Tony had muttered something about the windows of that room, which faced the sidewalk, letting in too much noise from the neighbors in the morning, and neither Natasha or Bucky had been a fan of the lack of high ground. 

 

Percy wordlessly points in the direction of the staircase, and Bucky blinks. “Oh.” There’s another set leading upwards. “I can’t believe we didn’t notice that.” 

 

At the top of the flight, Bucky plucks a sticky note from the door. “In-law suite?” He reads aloud, confused. 

 

Percy shrugs. “I don’t speak extremely upper middle class.” 

 

…God, Bucky wishes he’d been born in this tax bracket, he thinks as the door swings open. There’s a fucking kitchenette, along with a full bath and walk in closet. Silently, he holds up his hand, and Percy smacks their palms together. 

 

 


 

 

Beyond claiming rooms, the first day is quiet. They reconvene later in the living room to talk the case, which essentially boils down to stick around and find out. There’s not even any investigating to do, which makes Natasha groan. 

 

Percy and Tony head out for groceries. Peter gets denied— “Tomatoes don’t set of your Peter tingle.”, Tony had said flatly. 

 

“They do!” Peter exclaims, throwing his hands up. “And it’s my spidey sense!” 

 

“Peter tingle.” Percy says flatly. 

 

Peter narrows his eyes at him. “If I didn’t know you’d give me a wet willy, I’d jump you right now.” 

 

Natasha and Bucky, the former with a deep passion for pickled items and canned fish, the latter with food expectations set by the Great Depression and Soviet rations, both get left behind, as well. They both protest, but stop complaining when, an hour and a half later, Percy and Tony return with a trunk full of groceries. 

 

After that, they settle back into the living room and cue up a few movies, which lasts them until night. Peter scuttles off—literally, he’s on the ceiling—to call Ned and MJ before bed around nine. Percy’s already half-asleep, so Bucky follows him to bed. Natasha sticks it out another hour with Tony—he’s her new brother, after all—before heading up herself. 

 

Tony sits on the couch, the remote on his lap, eyes drifting back and forth to the screwdriver left by the moving company on the coffee table. 

 

He could just…

 

What’s a home without a few modifications?

 

 

 


 

 

 

Later that night, Percy wanders downstairs. For all their excitement about the kitchenette, they’d forgotten the obvious—to stock it. 

 

His hip presses against the countertop, socked foot rubbing against the side of his shin. Percy shuts off the tap and takes a sip of his water. He’s not a huge fan of the glasses that were stocked in the cabinets. They were fucking hexagonal. Who buys those?

 

Percy puts his empty glass in the dishwasher and pads out of the kitchen, past the damn breakfast nook and into the hallway. Everyone’s upstairs by now, but he steps softly anyway—Bucky is probably at least half awake, by now, but Peter’s definitely still asleep. Super hearing is a bitch. 

 

He’s just about to turn and head up the stairs when the phone—that damn landline—rings. Percy groans but shuffles towards it. Anybody with case information would call their cells, right? 

 

Ugh. Maybe not. Bastards. 

 

He picks up the phone. “Hello?” Percy asks groggily. 

 

“Hi, there,” A voice on the other end croons. Percy scrunches his nose. “Eugh,” He mutters under his breath. Then, clearer, “Sorry, who’s this?”

 

“Who’s this?” The voice responds. 

 

…Okay, so not about the case. “Nobody important.” Percy replies dryly. “I think you’ve got the wrong number. Night.” He pulls the phone away from his ear and hangs up, putting the phone back in its cradle. He turns and heads back for the stairs, only to halt at the sound of the phone ringing again. 

 

“Motherfucker,” Percy grumbles, picking it up again. This time, he waits for the other person to speak, which he does. “You don’t want to talk to me?” 

 

“Not really.” Percy replies tiredly. “I don’t know if you’ve noticed, but it’s damn near two in the morning.” He rubs at his eyes. “Is it important?” 

 

“I just want to talk to you. Don’t you want to talk to me?” He can almost hear the smile. “What’s your name?” 

 

Percy hangs up.

 

“Weirdo,” He mutters. 

 

When he gets upstairs, Bucky is sitting up in bed. “You alright?” His boyfriend asks groggily. 

 

“Yeah,” Percy hums, climbing into bed. Bucky lifts the covers for him, and he worms his way into his boyfriend’s space. Bucky’s arm wraps around him, hand sliding under his sweatshirt to rest on his bare stomach. “Some scam call, or something.”

 

Bucky buries his nose in the nape of his neck. “Mkay.” He mumbles. 

 

“Also, there’s loose unidentified metal parts on the coffee table.”

 

“Tony.” 

 

 

 


 

 

 

Outside, on the back porch, a long shadow drifts past the sliding glass door. 

 

 

 


 

 

Though she didn’t get the master bedroom—damn kid—Natasha’s pretty happy with her room. Her bed is right under a vent, so she spent the night pleasantly toasty. 

 

When she wakes up, stretching out in the bed like a cat, it’s still dark out. The days are already getting shorter, autumn taking hold. She climbs out of bed and grabs a sweatshirt she’s left hanging on the doorknob and pulls it on as she walks down the stairs. 

 

Natasha’s the second one up, only beat, apparently, by Bucky. When she makes her way down to the kitchen, he’s already standing there, a pot of coffee brewing. The smell envelops the kitchen, and she hums contentedly, taking the offered mug from him. He’s smiling at her, a teasing quirk of his lips as she takes a sip. “Gotta treat all members of the polycule right,” 

 

She rolls her eyes. “Go spoon your boyfriend.” 

 

He puts his own, now empty, mug in the sink. “You know what? I just might.” He tosses a glance over his shoulder to the microwave clock. “Not like he’s getting up anytime soon.” 

 

Fair. Percy is many things—the majority of them wonderful—but a morning person is absolutely not one of them. She’s seen him before eight. It’s not pretty. 

 

With a wave, Bucky disappears up the stairs, each old floorboard releasing a soft sigh of a creak as he goes. 

 

Natasha hops up on the counter, shoulderblades leaning back against the cabinet. It wasn’t the most comfortable, but she was rather content, watching the burnished orange-yellow leaves lazily drop from the large oak tree outside the kitchen window, only barely illuminated by the streetlamp. 

 

The doorbell’s chime is quite pleasant, surprisingly. Natasha hops off the counter, exchanging her mug for the carving blade sitting in the knife block, and saunters towards the door. She raises up on her tiptoes and peers through the peephole. Then, she steps back and opens the door to an empty porch. 

 

The motion lights overhead are on. 

 

Natasha pokes her head out, looks both ways, then shrugs, closing it and returning to her spot. 

 

She gets a quiet half-hour like that, savoring her coffee, cracks of the cool autumn breeze sneaking in through the edges of the window pane, before Peter stumbles into the kitchen. She’s not entirely sure how the kid can exceed Olympic-level gymnasts one second and trip on his own fuzzy socks the next, but he manages. “Morning,” Nat says, soft amusement coloring her voice. Peter grins back at her. “Morning!” 

 

He goes straight for the pantry. Natasha didn’t know they even made boxes of cereal that big, but apparently today is a learning day for her. Peter seats himself at the island and pours himself a large bowl (probably one of three or four, if she had to guess). 

 

It takes another hour for Tony to emerge, and once he does, he gives Peter an unimpressed look and starts a familiar admonishment about protein for growing spiders. The hour after that, Bucky returns. Percy’s arms are lightly looped around his neck, face pressed into his shoulder blade, and Bucky is half-dragging him (effortlessly, of course, the supersoldier bastard). 

 

Tony huffs a quiet laugh into his coffee. “You alright?”

 

Percy grunts. He’s wearing a sweatshirt Natasha is fairly sure belonged originally to Bucky, sleep shorts paired with fuzzy socks that match Peter’s. 

 

“Any news?” Natasha asks. 

 

Tony shakes his head. “Situation is still being monitored. Crossing fingers, but it looks good.” He raises his mug in a mock toast. “If things keep going as they are, I’d say we’ve just scored ourselves a little vacation.” 

 

Bucky deposits Percy in the barstool next to Peter. “It’s boring as shit here.” He says. Percy slumps to the side, leaning into Bucky, who wraps an arm around him. “I could use boring for a week.” 

 

“If you get bored, there’s a shithead prank caller,” Percy offers tiredly. “He annoyed me. You could kill him.” 

 

Bucky looks a little too interested in the idea.

 

Natasha raised a brow. “You got prank called?” 

 

Peter gasps. “Did they do the Temu vape one? Cindy’s brother did that, and the NSA contacted their parents.” 

 

Tony paused. “Temu—uh, Peter…I don’t think that’s why the NSA was at their house.” 

 

Peter slowly shook his head. “You’re clearly unfamiliar with the prank.” 

 

Natasha did not envy mentorship-fatherhood.

 

With a yawn, Percy nods. “It was at, like, two in the morning, the bastard. Kept asking me weird shit.” 

 

Bucky looks down at him, a small crease in his brow. “Like what?”

 

Percy shrugs a shoulder. “Kept asking for my name and got all weird when I, obviously, didn’t want to talk to him.” Bucky’s eyes narrow, just a little, and his eyes drift to the silverware drawer where he and Natasha had both stashed a gun.

 

“No.” Natasha says. “...Not yet, anyway, you protective freak.” 

 

Bucky, looking distinctly unhappy, says nothing. Percy reaches up and pats him on the chest. 

 

 


 

 

The second day is, somehow, more boring than the first. Tony disappears into the basement they apparently have, and Bucky swears, at some point, he hears a saw, which should be impossible, considering he and Percy both frisked Tony for any and all tools before they’d left. 

 

Natasha finds a local pumpkin patch, and they all go out and pick one. Peter manages to find a massive 40-pound on that he named Edmund and vows to take home and turn into a ‘glorious jack’o’lantern’. Percy spends half an hour delighted by the ones with the little warts, poking at them like a dog with a sensory mat. 

 

Natasha hefts one up, weighing it between her hands. 

 

“Good one?” Bucky asks, the tiniest white pumpkin resting in his palm. 

 

She rolls it a little, then hands it over. 

 

Bucky holds it for a second, looking down at it. “You know, this is like, the perfect weight and shape for a—”

 

“Decapitated human head!” Natasha finishes, nodding. 

 

 

 

Ten feet away, a very distressed pumpkin patch worker looks between them and a man who almost looks like Tony Stark, if he had a suit, do something in the corner by the fence with a blowtorch. 

 

 

 

They have soup for dinner, courtesy of Percy and Peter, along with a loaf of sourdough. 

 

“You brought that thing with you?” Natasha asks, fascinated, peering into the jar. 

 

“Her name is Patricia and she must feed.” Bucky responds, adding his flour-water mixture to the starter. 

 

“Horrifying.” Peter whispers. “And yet, I can’t look away.” 

 

 

 


 

 

 

They argue over Christmas movies. “It’s not even fucking Halloween.” Natasha groans.

 

“Three days.” Tony argues. “It’s basically already December.” 

 

“November.” Bucky reminds. 

 

Peter rolls his eyes. “Fake month.” 

 

That starts a whole new argument that lasts until they all go their separate ways for the night. 

 

Up in the suite, Percy emerges from the bathroom, a tiny smudge of toothpaste at the corner of his mouth. “Jamie,” Percy says slowly. “Did you hear that?” 

 

Bucky looks up from his book. “What?” 

 

After a second, Percy shakes his head, walking to the bed. “Never mind.” He flicks lightly at a stray strand of his hair, hanging in front of his face. “I should probably get this cut soon,” He comments. Bucky reaches forward and lightly tugs at the strand—at the length it’s grown, shaggy and in front of his face, some of his natural curl is beginning to show. “I like it,” he replies. “It’s cute.” 

 

Percy huffs. “Pretty sure I’m supposed to come off a mix of professional and intimidating.” 

 

His boyfriend grins crookedly at him. “Maybe,” he agrees. “But not to me.” Bucky pats the bed next to him. “C’mere.” 

 

After a second of narrowed-eye frowning, Percy relents, crawling over to him and settling into his side. Bucky wraps an arm around him and presses a kiss to his temple. “Love you,” 

 

“Love you too,” Percy replies easily, half-muffled into Bucky’s shirt. “What’chya reading?” 

 

“Edgar Allen Poe,” Bucky brushes an absent thumb across the corner of his page. “Poetry.” 

 

“Macabre.” Percy shuffles his legs under the blanket. “Read me some.” 

 

“Yeah?” Amusement flickers in Bucky’s eyes. 

 

“Yeah. C’mon.” 

 

Bucky clears his throat. “Once upon a midnight dreary, while I pondered, weak and weary,” He starts. Percy loves his voice—the soft rasp and the low timbre, the barely noticeable mixed accent that color his words. “Over many a quaint and curious volume of forgotten lore—While I nodded, nearly napping, suddenly there came a tapping,” 

 

Percy leans his head on Bucky’s shoulder, check pressed against his shirt. “As of some one gently rapping, rapping at my chamber door.” He continued. 

 

Downstairs, Peter is messing around by the porch—Percy can hear him, vaguely, and wonders what he must be doing. Looking for raccoons, maybe. Gods, Tony really has his work cut out for him, especially since Percy doesn’t plan on intervening. 

 

““’Tis some visitor,” I muttered, “tapping at my chamber door—Only this and nothing more.”

 

Peter had gone to bed an hour ago. 

 

Abruptly, Percy sat up. 

 

Bucky stills, looking over at him. “You alright?” When Percy says nothing, he frowns at his book. “I get it’s a bit overdone, but The Raven is a classic. It’s Halloween.” He defends. 

 

There shouldn’t be anybody downstairs. 

 

…Eh. Whatever. 

 

“No, no, I love your poems, Jamie,” He says.  “Are you hungry?” 

 

“Ugh, yes,” Bucky grumbles. “We weren't equipped to feed three Enhanced people.” 

 

Percy rolls onto his side, grabbing his laptop from the nightstand. “I want mozzarella sticks. You in?”

 

Bucky’s chin rests on Percy’s shoulder as he starts typing. “Are you about to DoorDash mozzarella sticks at midnight?” 

 

“Yeah.” 

 

“God, I wish I would have met you sooner in life.” Bucky points at the screen. “Pancakes?”

 

“Denny’s.” Percy responds. “You want ‘em?” 

 

“Eh…is that a steak?” Bucky leans closer, squinting at the screen. “Why haven’t you taken me to Denny’s before?” 

 

Percy absently pats him on the arm. “You only go to Denny’s past eight.” He explains. “And we’re either on a mission or in bed.” 

 

A moment of silence, Bucky clearly reflecting on his words. “Are we boring?” He asks. 

 

“A little, when we can afford to be.” Percy replies. “So…Denny’s steak?” 

 

Bucky nods against his shoulder. “Should we get some for Peter?” 

 

“He’s asleep,” Percy responds. “That’s why I’m ordering now. I love him to pieces, but I cannot face a delivery driver handing over a waffle meal with chocolate chips added ‘ludicrous style’. I still don’t know what that means, and I definitely don’t understand why he keeps putting it in the special instructions box.” 

 

A benefit to high-ranking, black ops work—the paycheck. 

 

Which they can both spend on DoorDashing mozzarella sticks. 

 

Downstairs, there’s a quiet thud. As Percy goes through the order confirmation, Bucky casts a glance around the room. “Did you hear that?” 

 

Percy shuts his laptop. “Hm?”

 

“That noise. Sounded like it came from the porch.” 

 

Percy goes absolutely still. “There’s no way Peter could have already found raccoons here, right?”

 

“Definitely not.” Bucky replies, but there’s an undercurrent of fear in his voice. “Fuck, we should probably check, shouldn’t we?” 

 

Percy groans. “Yes. Peter already got in trouble with New York’s governor—we do not need to add Delaware. If this was the West coast or Midwest, I’d care less but—”

 

“The states are too close together.” Bucky finishes. "Jersey's fair game, which brings him dangerously close to a legal trouble Connect Four.” 

 

With nearly identical sighs, they both kick off the blankets and stand. Bucky’s neck cracks on the side of his prosthetic, and Percy snorts. “Old.”

 

“Do not.” 

 

“Old.” Percy repeats.

 

“We’re not talking about problematic age gap yaoi again.” Bucky says firmly. 

 

“Hypocrite. MJ told me about your BookTok review account.” 

 

Bucky’s fist clenched, eyes narrowed. “Traitor.” He whispered. As they crept down the hallway, he whispered, “And I don’t like being the old one in the problematic age gap yaoi. It makes me feel evil.” 

 

“It is unfair that the older one is typecasted as the toxic manipulative one,” Percy agrees. “I’m plenty evil and conniving. Like, none of them have a ten step plan to get ahold of that sweet social security money?” 

 

“You only love me for my retirement checks.” Bucky muttered, flipping on the lights to the kitchen. 

 

Percy pats him on the shoulder and wanders towards the fridge. “The army backpay is a benefit.” He concedes.

 

Down the hall, the phone rings. 

 

“I’m not getting that.” Percy says at the same time as Bucky’s “Don’t answer that.” Percy quirks a brow, and Bucky makes a face. “I don’t want you talking to weirdos on the phone!” He defends. Percy’s responding smile is undeniably sweet, brushing a quick thumb across Bucky’s cheekbone as he heads for the front door. “Going to go talk to a stranger in person, though—” He brandishes his phone. “Denny’s.” 

 

“Acceptable risk.” Bucky says solemnly, holding his straight face for a few seconds before they both crack up. 

 

Percy’s shaking his head, still smiling. “Go answer the phone, weirdo.” 

 

Bucky definitely grabs his ass as he walks past him. As Percy slips out the front door (they picked the curbside pickup. Tony had been left unsupervised for about half an hour, and they were both now a little worried about the trellis on the side of the house coming to life and vaporizing intruders) Bucky picks the phone up from its cradle. “Hello?” He asks, only half paying attention, watching Percy through the little windows on either side of the door. 

 

“Who’s this?” The voice is oddly melodic, soft and low. 

 

Bucky makes a face. “Who the hell is this?” 

 

“What number is this?” 

 

“Probably the one you dialed,” Bucky responds absently. God, he loves how Percy looks in his sweatshirts. 

 

“Who am I speaking to?” 

 

Bucky rolls his eyes a little. “Wrong number, buddy. Clearly, you don’t know me.” He’s just about to hang up when the voice responds. “Oh, but I’d like to.” There’s a quiet shuffle, crackling over the line. “What’s your greatest fear?” 

 

Outside, Percy takes the bag from the driver, and steps back onto the sidewalk, the overhead street lamp illuminating his smile as he waves, thanking the driver.

 

“Dick falling off.” Bucky responds instantly. 

 

“What?” 

 

Bucky coughs. “What?” Aw, Percy’s swinging the bag a little as he walks back up the driveway. “Listen, you’ve got the wrong number. Have a good night.”  

 

He pulls the phone away from his ear and hangs up, dropping it back in its cradle right as Percy opens the front door, balancing the large bag on his hip, elbow deep in it and a suspiciously mozzarella stick-shaped item in his cheek. Percy brushes past him and drops the bag on the kitchen counter, immediately sticking in his other hand inside and rustling around. 

 

“Same weirdo?” Percy asks. “By the way, the Denny’s steak weighs like three pounds.” 

 

“It said sixteen ounces,” Bucky marvels, grabbing silverware. “And, yeah, seems so.” He peers over into the bag. “Did you get me my own mozzarella sticks?” 

 

“Well, I sure as shit wasn’t giving you mine.” Percy snips, cheeks warm. 

 

Love language through midnight mozzarella sticks. 

 

Yeah, Bucky could absolutely deal with being boring. 

 

 


 

 

The next morning, they’re all settled in the kitchen, going over a nonexistent case update. 

 

“Hey, what’s all this in the trash can?” Peter asks, peering inside. “Did you guys order—” 

 

“Nothing.” Percy says immediately. 

 

Bucky makes direct eye contact with Peter. “Close the bin.” 

 

Slowly, Peter obeys. 

 

Natasha, next to Bucky, raises her eyebrows. When he shakes his head, she just sighs and turns back to her computer. “No new updates,” She relays morosely. “It’s been quiet.” 

 

“So…politicians wasting resources?” Tony asks. “We could be, like, fighting supervillains, or something.” 

 

Natasha groans, thunking her head on the counter. Peter hops up on the countertop, swinging his legs. “I miss New York,” He complains. “The violent crime rate here is like, in the negatives.” 

 

“Sorry, you want violent crime?” Bucky asks. 

 

Peter sighs. “Shanon says I’ve got anger issues.” 

 

“Shanon, Bucky’s therapist?” Natasha asks, face still down on the countertop. 

 

“It’s called trickle-down therapy. Look it up.” Peter replies primly. “Shanon is helping me adjust to this century, and I won’t hear a word against her.” 

 

“Peter, you were born sixteen years ago.”

 

“Well she doesn’t know that.” Peter says like it’s obvious. 

 

“Peter, you—Bucky and you have very different issues, you know that, right? You definitely both have them, but I’d say they’re almost opposite ends of the same spectrum.” 

 

“We both have super strength.” Peter points out. “And dead parents.” 

 

“My parents died of old age.” Bucky chimes in.

 

“Super strength.” 

 

“That has literally nothing to do with this.” 

 

Peter blinks. 

 

Natasha looks at him for a long time, then slowly shakes her head. “Sure.” She relents. Then, “Fuck, I’m arguing with a teenager. That’s how bored I am.” 

 

“Domestic life isn’t all that you had hoped, huh?” Percy deadpans. 

 

Natasha throws a pen at him. “I’m not above double matricide.” She hisses. 

 

“Rude, babe.” Bucky’s voice is toneless, but his eyes are full of malicious joy. 

 

“Just find something to do,” Tony interjects. He’s got his own computer out, a thin laptop that, knowing him, has the processing power of the entire tower back home. His phone is in his left hand, he’s typing with his right, and there’s a tablet balancing on his thigh he glances at occasionally. 

 

Bucky is staring at him, fascinated. 

 

“The most interesting thing has been prank calls.” Percy says with a shrug. “It’s not that bad.” 

 

Natasha makes a face at him. “Easy for you to say.” 

 

“You have enemies hunt you down. They do the work for you.” Peter complained. 

 

“...I’m sorry, are you jealous that ancient monsters have been hunting me down my entire life because they can smell my bloodline from a hundred miles away?” Percy checks, raising a brow. 

 

Peter and Natasha exchange slightly contrite looks. “A little.” They confirm. 

 

“I’ll send the next one your way.” Percy says flatly. 

 

Both distinctly mortal and lacking godly weapons, they both shake their heads. “We’re good!” 

 

“That’s what I thought.” 

 

“Prank calls?” Tony asks, not looking up from his screen and completely ignoring the other three. Peter watches him turn his tablet into split-screen mode. “When?”

 

“Last night and the night before.” Percy says. 

 

A small frown tugs the corners of Tony’s mouth downwards. “There’s nothing on the call logs.” He says. 

 

“Are we at the point in our relationship where we share hallucinations?” Bucky asks Percy, who shrugs. “Perchance.”

 

“Sick,” Peter says. “I can’t wait until I have what you guys do.” 

 

“Well, you know what they say,” Bucky replies. “Bloodshed is the lube of a healthy relationship.” 

 

Tony finally looks up at them. “What the fuck? Don’t tell him that.” 

 

Bucky shrugs. 

 

 


 

 

Later that night, Peter sits in his room, idly tapping his pen against the edge of his desk as he turns the page of his book. 

 

The house is oddly, almost eerily, silent at night. Natasha and Bucky are both extremely quiet (when they want to be) but practically nothing living can escape Peter’s hearing. Even now, they’re both asleep, he can distantly hear their soft breathing. Percy’s, too, though he occasionally mumbles in his sleep. Tony is still awake, which isn’t too surprising, and Peter can hear him typing. He’ll give it an hour or two before going in and bothering him until he passes out. 

 

His room is big. He’s got a king sized bed and a walk-in closet, and there’s a large bay window with a cushioned bench. It opens outwards, and, though Peter loathes the cold, he stands up to open it, joints cracking in the odd manner they’ve taken to after the bite. 

 

He crawls onto the bench and unlatches the window, then scooches over to the ledge and sticks his legs out. Sure, he’s having fun on the mission—if you can even call it that—but he misses the city already. The autumn breeze brushing past his legs, if he closes his eyes, almost feels like webslinging on a calmer night. 

 

The moon is nearing full, Peter notes, craning his neck up at the sky. 

 

Maybe that’s the one thing this place has on the city—he can see the stars. 

 

Below him, around the side of the house, he hears the soft rustle of leaves. Peter looks down, squinting in the darkness. The house blocks the street lamps around the corner, leaving the only illumination from his bedroom, backlighting him. 

 

It’s coming from the bushes, he realizes, down below, almost right under him. 

 

Slowly, Peter eases his way back through the window, his eyes never leaving the bushes beneath him. He pushes off the bench, backs up towards his desk, and blindly reaches into one of his drawers. 

 

He pulls out a fistful of Slim Jims and snaps one open. “You are mine.” He whispers. 

 

 


 

 

As the days pass—officially marking half a week since their arrival—the house’s occupants start to go a little stir crazy. Tony’s thrown himself headfirst in some new project all of them are hesitant to ask about, Peter’s been wildly oscillating between homework, videogames online with his friends, and running amok outside, with a dash of wistful sighing. Natasha entertains herself by working out and, they’re beginning to suspect, spying on the neighbors. 

 

The mission itself is incredibly boring—a combination of no new updates and the political maneuvering that landed them there coats the idyllic house and town with a sheen of bitterness. 

 

Percy and Bucky are trying to make the most of it, and mostly succeeding. They both love New York, but the town undeniably has its autumnal charm. 

 

“These people really aren’t good at chilling out.” Bucky says, voice muffled into Percy’s sweater. Percy’s hands, scratching lightly at his scalp, momentarily pause as he huffs out a laugh, and Bucky feels it under his cheek. “They really aren’t.” 

 

Percy’s on the couch, legs stretched out and Bucky on top of him. They’ve just finished a movie and made homemade apple cider with ingredients from the farmer’s market they’d visited earlier. There’s a blanket thrown over the both of them, trapping Percy’s excessive body heat into a hazy cloud around Bucky, who soaks it up happily. 

 

Tony has taken over the television upstairs, bringing himself up to a grand total of five screens, two of which are in splitscreen. Peter is outside somewhere, likely on all fours, trying to goad a family of raccoons into either coming home with him or fighting him—they’re not entirely sure. Natasha is in the rec room sharpening knives. She’s been doing it for at least an hour, and there’s a fair chance she’s not fully lucid. 

 

Bucky yawns, lightly headbutting Percy’s chest when he stops scratching. 

 

“I’ve made you such a diva,” Percy mutters. 

 

“Peter and his friends call it the sassy man apocalypse.” Bucky informs him. 

 

“...Hey, amor?” 

 

“Yes, I heard the drilling happening in the basement earlier.” Bucky says tiredly, snuggling further into his chest. “No, I was not planning on acknowledging whatever the fuck Tony is doing.” 

 

“‘Kay.” 

 

 

 


 

 

 

Natasha leans forward onto the mat, shifting her weight as she lifts her hips. Elbows slightly bend, back rounded, knees on her triceps, she slowly lifts one foot off the floor, then the other. She tilts her head, neck in line with her spine as she leans into the crow pose. 

 

“God,” She mutters under her breath, feeling the subtle burn in her core and arms. “I hate yoga.” 

 

Yes, she knows it’s good for her, and, yes, she does it daily, but that does not mean she likes it. 

 

“I’m having fun,” Peter offers cheerily. 

 

She looks up at him then quickly averts her eyes. There’s definitely no name for the pose Peter is in—well, not a yoga name. A speciality emergency room may have a name for whatever’s going on there, though. One of his feet is resting on the top of his head. 

 

“Sometimes,” Natasha says as she leans out of the position, “I really resent you people.” 

 

“Woah, you’re arachnophobic?” 

 

“Violently.” 

 

He giggles softly, and Natasha can’t help the smile that twitches onto her face. 

 

“Tony understands me,” She sighs. “Supersoldiers and demigods.” They both drop into a downward dog. “Though, I have always had my suspicions about him.” 

 

“Suspicions?” 

 

“I’m half-convinced he’s, at the very least, put some sort of machinery in his brain. That shit is not normal, Pete.” 

 

“The funny part is, I have a couple guesses about what you could be referring to.” 

 

“The caffeine abuse, mainly.” She replies, leaning into the stretch. “It’s insane he handles it better than you and Percy.” 

 

Peter does a weird little shrug, still in the pose. “It’s hypocritical, is what it is. He stands between me and those Alani packets.” 

 

“Packets?”

 

“Energy drink powder. You’re supposed to dump them in water.”

 

“And you…”

 

“Put them in my eggs. It’s easier. Or, at least, it was, until he found out and put up a ban.” He grins at her. “Don’t worry, I’m working my way around it.”

 

“Peter, my beloved spider sibling…I cannot emphasize to you how little I was worried.” 

 

His head perks up like a dog. “Did you hear that?” He’s staring out her window. Peter scrambles upwards and lurches towards the window, opening it and sticking his head out. “Do you have any snacks in here? Preferably small sausages?” 

 

“Can’t say that I do.” 

 

“That’s okay,” He says, already halfway out of the bedroom, calling over his shoulder. “I’m going outside!” 

 

Natasha watches him go, then shrugs. She holds her last pose for a second longer before smoothly standing and rolling up her mat, storing it in the closet on the far side of the room. She drops down on the edge of her bed, listening to the distant sound of Peter’s voice coming from the backyard. 

 

Then, the doorbell rings. 

 

Bucky was out—he’d found some secondhand bookstore and had been gone for at least two hours so far. Percy had braved going down the basement steps to drag Tony outside for a walk, muttering something about vitamin D deficiencies. With Peter doing…whatever it is he does outside, Natasha’s alone in the house.

 

She stands and makes her way down the stairs, checking through the peephole before opening the door.

 

Nobody’s there. 

 

Natasha makes a face and closes the door, then goes upstairs to have a shower. With everyone out of the house, she won’t feel bad about using all the hot water. 

 

 

 


 

 

 

Bucky is awoken by the shrill sound of the phone ringing. It seems louder than normal, but that may just be his increasing irritability. 

 

Next to him, Percy makes a displeased and rolls over. Bucky stumbles out of bed. “Gonna—” He yawns. “Gonna go answer.” 

 

“Why?” His boyfriend groans. “Prob’ly t same stupid piece of shit asshole.”  

 

“Cranky,” Bucky mutters, which gets him a nasty look. Apologetically, he leans down and presses a kiss to the top of Percy’s head and tucks the duvet around his shoulders. “Be back in a second. If they’re case details, and Nat finds out we missed them…” He shakes his head. 

 

The stairs creak as he walks downstairs—more than he remembered. The house is full of windows, moonlight and street lamps casting shadows from the bushes and trees wrapping around the house, stretching across the floorboards. They’ve been keeping the curtains closed, at least on the ground floor—somebody, Peter, maybe, probably opened them and forgot to close them. 

 

He grabs the phone from the cradle, holding it between his ear and shoulder as he walks down the hall and into the living room, drawing the lacy curtain shut. “Hello?”

 

“Hi, again,” 

 

It takes everything within Bucky to not groan out loud. 

 

“Dude.” He says tiredly. “What?” 

 

“Do you live in a nice house?” When Bucky doesn’t respond, the man tacks on, “You always take so long to pick up, I have to wonder if it's a bit of a walk for you to get it.” 

 

 “...It’s fine.” Bucky says flatly, like a liar. It’s a goddamn four story, four bedroom plus suite with a massive finished basement. He grew up in Great Depression-era Brooklyn. This is like a goddamn castle. 

 

“You have a lot of windows.” 

 

Bucky pauses. “Excuse me??

 

“Big house,” The man muses. “Lots of windows. Remembering to close them all must be hard.” 

 

Bucky shrugs, scratching at his nose. “It’s fine.” 

 

“Really, you should be more vigilant about that.” The man whispers. “You never know who might slip in.” 

 

“...Okay? Are you with a security company, or something? For the last time, we don’t want fucking ADT or SimpliSafe of whoever you are.”

 

“I’m not from a security company.” The man snaps, suddenly hostile. “I’m—”

 

“You’re not? Oh.” Bucky pulls the phone away from his ear. “Well, listen, man, I’ve got, like, a really cute guy in my bed right now, so if this isn’t important…” 

 

“If you hang up on me I’m going to gut you from groin to chest—” 

 

Bucky heads back up for bed. 

 

 


 

 

As Bucky walks up the stairs, in her room, Natasha digs the heel of her palms into her eyes. The fucking doorbell. 

 

The first two times, it hadn’t been a big deal. Stupid neighborhood kids ding dong ditching, or whatever. Three times, four times, she checked to see if Tony had somehow made the doorbell bluetooth or something ridiculous and was fucking with her, only to find him passed out on the couch.

She’d thought for a precious second that Bucky was going down to deal with it, but after a couple minutes of silence, he’d walked back up the stairs. 

 

Natasha rolls over, grabbing her pillow and shoving it over her head to muffle her ears as the doorbell rings again. 

 

She groans, angrily tossing the pillow to the floor and pushing herself off the bed. Above her head, she can hear Bucky’s footsteps, the subtle creak as he climbs back into bed. Barely mindful of Peter and Percy’s ears—not Bucky, not after he’s failed her like this—she throws open her door and stalks downstairs. 

 

The windows are open, and she crosses her arms as a chill crawls across her skin. “Goddamnit,” She mutters. “Couldn’t close the windows either, Barnes?” 

 

She strides down the hallway, anger simmering in her chest, and throws open the front door. “What?” She roars—but there’s nobody there. “What do you want? Stop ringing our fucking bell!” She slams the door shut and whirls around, back to her room. 

 

Natasha throws herself back into bed, inhaling deeply, holding it, then exhaling. “Christ,” She mutters under her breath. The house was freezing—how long had the windows been open? It’s nearing the end of October, and while that’s not dangerously cold, somebody, who shall remain unnamed, has thermoregulation problems.  

 

She used to think the sound of the doorbell was pleasant—a soft little chime. 

 

As it sounds again, she can’t help but compare it to a drawn out scream. 

 

Natasha yanks the blanket off of herself and mechanically stands, nostrils flaring. Barely making a sound, she crosses the room to her closet. She slides open the door and reaches behind the coat she’d hung up earlier, pulling out a large duffel bag concealed in the corner. 

 

Her hands are smooth and her motions methodic as she unloads the bag and assembles the rifle. 

 

Natasha unlatches the window and eases her way out onto the roof. She straddles the edge, one led hooked around the ledge as she lowers her torso down, hanging off the edge. Natasha raises the rifle, takes in a measuring breath and—

 

Bang. 

 

The doorbell shatters. 

 

She pulls herself back into her bedroom, latching the locking the window behind her. With the same serenity, she disassembles the rifle and shoves it back into the shadows of her closet. 

 

Then, she goes back to sleep. 

 

 


 

 

Percy is fairly sure the sound had crept into his dreams. 

 

The odd usual—flashes of prophecy, both new and old, equally indecipherable. Odd omens that amount to very little. Memories. 

 

The phone is going off again, and, next to him, Bucky is completely still. 

 

It’s only fair—he’d gotten up the last time. 

 

Quietly, Percy slips out of bed and pads down the stairs to the bottom floor. With an odd sense of deja vu, he creeps to the foyer and picks up the phone. 

 

“Hello, Percy.” 

 

His jaw cracking in a yawn, Percy replies, “Hey.” Finally, something about the fucking case? He takes the phone with him into the kitchen, opening the fridge and reaching into the back for the yoghurt Nat thinks she’d successfully hidden. 

 

“I’ve been waiting to talk to you again.” 

 

“...Kay.” He opens the silverware drawer and starts digging for an appropriate spoon. 

 

“Do you want to play a game with me? I want to play a game with you.” 

 

He picks one up, but it’s unsatisfactorily large. “Uh, like, solitaire?” 

 

“Solitaire is a single player—No.” 

 

Percy picks a different spoon and deems it worthy, closing the drawer with his hip. 

 

“I want to play a guessing game.” 

 

He tosses the yoghurt lid in the trash. “Right.” 

 

“There are three doors to your lovely house. Three doors and many, many more windows, but for the first round, I’ll take it easy on you. I want you to guess, Percy, which door I’m standing on the other side of.” 

 

A pause. “Sorry?”

 

“Go on. Guess. Is it the back door by the kitchen? The front door, where we meet for our little chats? Or is it the beautiful French doors on the screened porch. Give me your best guess.” 

 

Percy tips his head to the side. Alongside his own, he can hear Tony’s heartbeat upstairs, accompanied with the quiet hum of the arc reactor. Peter’s, across the hall, a little faster than human average, and Natasha’s steady in sleep. Above that, Bucky’s, strong and firm, better than he knows his own. He can feel each of them, distantly, how Nat’s curled up and Tony’s sprawled out, Peter’s rolled onto the wall in his sleep and Bucky’s reaching out unconsciously from his side of the bed. 

 

Percy rolls his eyes. “None of them. Goodnight.” He hangs up, drops the phone on the kitchen counter, and tosses the yoghurt cup in the trash. “Loser,” He adds under his breath, shuffling back down the hallway and up the stairs. 

 

 


 

 

The next day is surprisingly cheerful. Tony’s emerged from the basement of his own free will, and is currently sitting in the living room with his feet up, wearing an obnoxiously yellow hat that Peter had dropped onto his head. The kid is perched on the back of the couch, wearing a monkey onesie, both of them watching the argument unfold in front of them. 

 

“This is stupid.” Natasha groans, face down on the couch—though they can tell she doesn’t truly mean it. 

 

“You just don’t take this seriously enough.” Percy insists, tilting his head to the side so Bucky can get the applicator on his roots. 

 

Natasha rolls her head to squint at him. “You’re the commander of an elite, classified WSC squad.” She says flatly. “And you’re letting your boyfriend give you bright ass pink hair.” 

 

“It’ll wash out.” Bucky dismisses. Percy nods, best he can in Bucky’s hold. “Also…you’re one to talk. I’d argue dyed hair is more common here than bright ass ginger.” 

 

Her eyes narrow. “Tread carefully.” 

 

“Just saying,” Bucky mutters. “Only one of us was a spy, not an assassin. What the fuck are you infiltrating, the Weasley family?”

 

Natasha stands up.

 

“No.” Percy says firmly. “Fight later. Pink hair now.” He scrunches his nose. “I refuse to have poorly dyed hair.” 

 

Natasha huffs and flops back down onto the couch. “Are we even supposed to be doing this on this carpet?”

 

“Eh,” Bucky gives the dye bottle a good shake. “This is the ugliest one. If anything, we’re doing the realtor a favor.” 

 

“...Right.” She says, dubious. Natasha herself is in costume, a blue coat and a red hat. 

 

“So, what are you?” Tony finally asks. 

 

“Gary.” Percy replies. 

 

“...Gary?” 

 

“Yeah, Gary and Marshall Lee.” 

 

Peter gasps. “Adventure Time?” 

 

“The spin-off, yeah.” Bucky confirms. 

 

“Aw.” 

 

“Thanks.” 

 

“I’m a monkey.” 

 

“Yeah.” 

 

“Curious George.” He pats Tony on the head. “Man in the Yellow Hat.” 

 

“Ominous name.” Bucky notes. 

 

“...I mean, I guess.” 

 

 


 

 

They put out Halloween decorations with an almost fervent zeal, getting Peter to string up lights on the roof. Percy and Nat go out and buy truly irresponsible amounts of candy, and, by the time the sun starts to dip, they’re ready for the influx of trick-or-treaters. 

 

“I didn’t think we’d actually be here for Halloween.” Tony says with a sigh. “There goes Pepper, Rhodey and I’s group costume streak.” 

 

Natasha pats him consolingly on the head—or, hat. 

 

For a house without a doorbell, they do pretty good. A group of excited preteens recognize Percy and Bucky’s costumes, and a few parents coo about Peter and Tony matching. A small child compliments Natasha’s hat. 

 

By ten, the neighborhood kids are all corralled inside, and the five of them retire to the living room to devour the leftover candy. 

 

“Aw, rats.” Peter mutters. “No more Almond Joys.” 

 

“How old are you?” Natasha asks, making a face. “Almond Joys? Really?” 

 

“I think there’s another bag,” Percy says, standing. “I’ll grab it.” He turns and exits the living room, and is just about to turn down the hallway when the phone rings. He stops, wondering for a second whether or not he should answer it, truly considering letting it ring out. Percy wanders to the kitchen, locates the candy bag, and, on his way back, the phone starts ringing again. 

 

“Final time,” He mutters. “One more, then I’m smashing that damn thing.” He picks up, and before he can even get a word out, an incensed voice rings out. “You hung up on me, you little bitch.” 

 

“Woah.”

“You didn’t like last night’s game? Fine! Fine! We’ll play a new one. You couldn’t guess which door I was by, so, instead, why don’t you guess which fucking window I used to let myself into your house to slit your fucking throats!” He screams. 

 

Slowly, Percy pulls the phone away from his ear, candy bag still under one arm. 

 

“Hey, Percy?” Peter calls from the other room. 

 

“One sec, I’m on the phone!” He returns. Then, into the receiver, “...Do I get any hints?” 

 

“Percy!” This time it’s Tony. Percy walks into the living room—everyone’s standing, now. “What’s up?” 

 

The voice from the phone—but this time, it seems to be coming from somewhere else. “You! Get the fuck in here! Stand next to them—line up!” 

 

Nobody argues, so Percy goes and takes his place next to Bucky. 

 

The stranger is pacing, it sounds like, back and forth across the living room. “A week,” he says. “A week! I have been here, harassing you, taunting you, haunting you, for a week!” There’s a gun in his left hand. 

 

“But you—you—” He breaks off, moving wildly around the living room. “You’re all idiots!” 

 

Peter made a noise of disagreement, and the man whirled around, leveling the gun at his face. “I have spent days outside, rustling bushes and scraping against the drain pipe and tapping on windows and you, you piece of shit, started leaving out raccoon bait! Who the fuck does that?” He demands. 

 

“Well, maybe you shouldn’t have acted suspiciously similar to a raccoon family.” Peter says imperiously, sticking his nose up at the gun in his face. 

 

“And when it wasn’t him, it was you!” The stranger roared, turning to Natasha. “You hear the doorbell ringing, all hours of the night, and nobody else can hear it? And instead of acting normally, going out there an investigating, you climbed out the window and fucking shot down at the doorbell! 

 

Percy slowly turns to Natasha. “You said the neighbor kids threw a rock at it.” 

 

Natasha stared straight ahead, not looking at Percy. “I…was frustrated.” 

 

“I popped those kids' bike tires.” Bucky whispers. “Nasha, I almost threw a brick into their window.” 

 

“Wait, the doorbell’s broken?” Tony interjected. "Is that where those parts came from?"

 

The man in the mask screamed in anger. “Of fucking course you didn’t notice!” He waved the gun around wildly. “Nine screens! Nine! You could've pissed yourself and not noticed!” 

 

Tony put his hands on his hips. “No, I notice that.” 

 

“Notice? Present tense, notice?” Percy asked, eyebrows raised in concern. “Tony, have you peed your pants?” 

 

“Not recently.” 

 

“Nine screens, though?” Natasha asked. 

 

“It’s like when I put a Subway Surfers gameplay video and a robot voice reading Reddit stories over top of my homework.” Peter says wisely, nodding. 

 

“Sorry, you do what?” Bucky asks. Percy, on the other hand, tips his head to the side, considering. “I see the appeal.” 

 

“You,” Bucky sighs, squeezing Percy’s forearm, “Have ADHD, and listen to Spotify recordings of monks doing Gregorian chants while you do paperwork.” 

 

“At least that’s only audio. Peter’s watching videos, too—” Natasha cuts herself off, lips pursed.

 

“Yeah?” Percy asks. “Do you want to expand on that? Should I start watching videos, Nasha?”

 

Bucky coughs to hide a laugh, but immediately winces when the guy who broke into their house turns the gun on him. “You…” The masked man hisses. “You, for the love of God, you.” 

 

“...me,” Bucky agrees slowly. 

 

“I call you in the middle of the night, threaten you and imply that I’ve broken into your house, threaten to gut you, and you fucking hang up?” 

 

Bucky pauses. “Right. I did do that.” A second. “My bad.” He adds contritely. “It’s just, well, uhm…” 

 

“You were too busy ogling your fucking boytoy.” 

 

They all go silent for a second before Percy slowly points at himself, a questioning look on his face. 

 

“Yes, you!” The man roars. “Who the fuck else? Are you fucking stupid?”

 

“Don’t call him stupid.” Bucky and Natasha say at the same time. 

 

“Could have been Natasha. We’re in a polycule, you know.” Percy says. “We’re living in modern times. Women can be boytoys if they want.” 

 

“I do not want, to be fair.” Natasha tacks on. 

 

“And, just for a second, I thought that maybe you weren’t so irredeemably idiotic that you’d be, at least a little bit fucking scared when there was a face in your doorway!” He screamed at Percy, ignoring the others. “But no!” 

 

“...You put a face in my door?” Percy asked, making a face.

 

“No, I didn’t—I was at the door!” 

 

Percy’s eyes go distant, head tipping upwards slightly as he thinks. “No, I don’t remember that.” He admits. “Sorry.” 

 

There’s a wordless scream as the man lunges at him. Percy stumbles, a stricken look on his face as a hand closes around the front of his shirt. “What the fuck?!” Percy screams, lurching back. 

 

Bucky lunges, driving his shoulders into the man’s chest and bringing them both to the ground. Peter jumps up onto the ceiling, shooting a web at the stranger’s hand. 

 

“What the fuck was that?” Percy demands shrilly, rolling onto his back. 

 

Natasha darts out of the room, into the kitchen, and returns not a second later with a pistol in her hands, aimed right at the struggling man beneath Bucky. “Who are you?” She demands. 

 

The man snarls, and suddenly Bucky is thrown off, his back hitting the far wall. The man stands, and then—

 

He’s gone. 

 

Percy’s hands are shaking as he kneels next to Bucky. “You okay?” 

 

Bucky nods, rubbing the side of his head. “Yeah. Jesus, what the hell was that?” 

 

“Someone was in the room with us?” Percy asks, eyes wide. 

 

Tony turns to him, slow. “You…couldn’t tell?” 

 

Percy shakes his head. “I…I thought it was just us, like the noise was coming from a call or something until he grabbed me.” Bucky’s face twists in a snarl. “I’m going to kill that son of a bitch.” 

 

“He got through my webs,” Peter says with a frown, looking down at his webshooters. 

 

“How could you not sense him?” Natasha asks. 

 

“I—I don’t know. There was…nothing. No heartbeat, and I couldn’t feel anything, either. Until he touched me…it was like he wasn’t there.” 

 

Bucky and Tony make eye contact for a long, deliberate second. “Magic.” Tony says. “It’s gotta be.” 

 

“Not my kind,” Percy says. “That’s for sure.” 

 

“Fuck, I hate magic.” Natasha grumbles. Tony, usually with a very strong stance on the matter, says nothing. 

 

“How are we supposed to kill something that doesn’t physically exist when he doesn’t want to?” Bucky hisses. 

 

It’s then that a slow grin spreads onto Tony’s face. “I think I’ve got an idea.” He says. “How easy do you think we can get him into the basement?” 

 

A second of uneasy silence. “We lure him.” Natasha says, stuffing the gun into the waistband of her pajama pants. 

 

“Oh, my God,” Peter whispers. “Are we about to split up and look for clues?” 

 

Natasha rubs her temples. “Shit,” She mutters. “We totally are.” 

 

 


 

 

Bucky hasn’t let go of Percy’s hand. 

 

Natasha stalks off upstairs and Peter slips out the back door while Tony jogs down the basement steps. 

 

Percy breaks the silence. “It’s been a while since I’ve been taken off guard like that.” He makes a face. “I hate it.” 

 

Despite the anger simmering in his chest, Bucky snorts. “I was more shocked by how angry he was.” 

 

“He called me your boytoy.” Percy recalls, scrunching his nose. “What did you do to piss him off so bad?’

 

“...Nothing. What did you do?” 

 

“Honestly, I’m not quite sure. I’m quite pleasant, really.” Percy replies easily. Then, he pauses. “Oh, my God. The other night, I was up eating Nasha’s yoghurt—” 

 

“She’s going to stab you one day.” 

 

“Polycule introduction ritual,” Percy dismisses. “Keep you two on equal grounds. So, I was up eating her yoghurt, and I picked up the phone, and he was trying to get me to guess which door he was at, and—” Percy tips his head back, eyes closed. “Jamie, I couldn’t feel him anywhere, so I said ‘none’ and hung up and went to bed.” 

 

“Oh my God.” Bucky can’t help the slightly hysterical noise that escapes him. “He was probably standing right in front of you.” 

 

“Fuck, he probably was.” Percy covered his mouth with his free hand to stifle a giggle. “Oh, that’s so humiliating for him.” 

 

Behind them, there’s a roar of absolute rage, and Bucky barely yanks Percy out of the way as the masked figure comes barreling down on them from behind, kitchen knife held high above his head. He swings wildly, and Bucky ducks. 

 

“I’m sorry, for the record!” Percy cries as Bucky tugs him to the side, avoiding a jab. “I didn’t mean to disrespect your profession!” 

 

“Stop apologizing to the serial killer!” Bucky snaps, aiming a kick at the side of the man’s knee. He goes down, just for a second, and Bucky grabs Percy around the middle, pulling him out of the living room and into the hallway. 

 

“This is why he called me your boytoy!” Percy protests as Bucky lurches to the side to avoid another swipe. “I lack agency!” 

 

“We’re not fucking talking about power imbalance yaoi right now!” Bucky yells back. The man advances, chest heaving with anger as he tightens his grip on the blade. 

 

Just then, down at the end of the hallway, the back door is thrown open. There’s a sudden wave of angry chittering, claws scrabbling across the hardwood as five raccoons sprint into the house. They launch themselves at the stranger, and he cries out, stumbling back and away from Bucky and Percy. 

 

“I slipped a Slim Jim in his cloak pocket!” Peter yells over the noise. “They’ve gotten a taste for them!” 

 

He grabs both of them by their free hands and, together, they sprint to the basement stairs, scrambling down them. 

 

“Is it weird I’m more scared of whatever Tony’s done down here than the masked killer in our hallway?” Percy asks. 

 

“Absolutely not.”

 

“Completely valid,” Peter agrees, shouldering the door open. 

 

They all stop, frozen, at the top of the stairs. 

 

“Jesus Christ.” Bucky breaths. “Tony…what the fuck is wrong with you?” 

 

One of the walls is lined with televisions. Some of them have scrolling code, others a rotating 3D rendering of something Bucky could never hope to understand, a few packed tightly with handwritten notes and scribbles. 

 

The countertop off to the side is covered in what appears to be oil, tools littering the floor and the collapsible table off to the side. 

 

And…in the middle…

 

“What is that?” Percy whispers. 

 

It was about the size of an oven, sitting innocuously in the middle of the floor. Similar to the arc reactor, it hummed quietly, and it cast a pale purple light across the entire basement. It was circular in some areas, square in others—the longer they took it in, the more parts they recognized. 

 

“Is that our TV remote?” Peter asks indignantly. “I spent two hours looking for that?” 

 

“Tony…” Percy shakes his head. “I’m so telling Pepper about this.” 

 

The man himself pops up from behind a stack of—are those tires? “What?” He asks indignantly.

 

Above them, there’s a loud bang. “Looks like they got the Slim Jims.” Peter whispers ominously. 

 

The door is thrown open with enough force for it to bang against the wall. Wide-eyed, Peter leaps upwards and attaches himself to a shadowy corner in the ceiling. Bucky grabs Percy by the elbow and they both duck down behind a stack of empty cardboard boxes against the far wall. 

 

The stranger slowly walks down the stairs, fury outlined in every movement. “Where are you?” He roars. “Don’t you want to come out and play?” 

 

At the bottom of the landing, he flexes his grip on the gun. “I,” He breathes, “Am going to give you all five seconds to come out. Understood?”

 

“Five…” 

 

As quietly as he can, Peter inches towards the stairs, belly pressed to the ceiling. 

 

“Four…” 

 

Tony slowly reaches into his pocket, fingers closing tight around a small metal object. 

 

“Three…” 

 

Bucky tugs Percy closer, a firm hand between his shoulder blades. 

 

“Two…” 

 

A million things happen at once. 

 

Tony jabs his thumb into the device in his pocket, and the humming machine in the middle of the room suddenly ramps up, bathing the room in a near-blinding red glow. 

 

Behind and above them all, the door leading down the basement slams shut. At the top of the stairs, Natasha stands, gun out and raised. 

 

The stranger turns, a snarl forming behind the mask, and his own weapon is suddenly yanked out of his hands and attached to the far wall with a web. 

 

The machine beeps one final time, and Natasha, the brilliant red and blue of her Paddington Bear costume contrasting against the overwhelming shadows, and pulls the trigger. 

 

The stranger falls backwards. 

 

Slowly, Percy stands. “I…I can feel him.” He whispers. He scrambles towards the fallen man. “What…” 

 

Tony leans back against the wall. “I do my best work under pressure.” 

 

“Don’t lie, you didn’t know any of this was fucking happening.” Natasha snips, walking down the stairs to join them. “You built a weapon of mass destruction in the basement, Tony. We’re renting.” 

 

Tony rocks back on his heels. “WMD is a bit strong.” 

 

Natasha pointedly looks down at the body—it seems to be seeping, almost, an oil-like substance that leeches outwards. The body itself is shrinking, melting. 

 

Tony waves a hand. “It…well, it just disrupts magic. That’s all.”

 

They all stare at him for a long, heavy minute. 

 

“Why?” Percy whispers. “Why do you do these things?” 

 

“...Stephen bet me I couldn’t.” Tony whispers. 

 

“Jesus Christ.” 

 

Peter is making a face. “There’s a name for your kind.” 

 

“Woah, excuse me—” 

 

“You don’t get to be offended! You built an anti-magic fucking thing in our basement with the television remote and parts of the doorbell Nasha shot!” Bucky exclaims. 

 

“...But aren’t you glad I did?” 

 

Bucky throws his hands up. 

 

Percy is lightly toeing at the body. “This smells weird.”

 

“It’s dissipating,” Natasha notes, head tilted. Indeed, the oil-like substance is evaporating as more slips out, the body caving in and liquifying. “Do we want to know what fucked up creature this was?” 

 

“Whatever it was, it was pretty bad at its job.” Bucky grumbles. 

 

“I think we’re just haunt-proof, actually.” Peter states. 

 

Percy pauses, thinking for a moment. “Do you think we can put that on business cards?” 

 

“Ooh, maybe.” Just then, Peter’s stomach growls. 

 

“Well,” Bucky says, standing up from where he was crouched, inspecting the rapidly disappearing remains. “Looks like we won’t have any cleanup. Everyone else hungry?” 

 

After a round of agreements, Percy pulls his phone out from his back pocket. “Denny’s DoorDashes.” 

 

“And how would you know that?” 

 

“...No particular reason.”

Notes:

percynatbucky polycule if you care. btw

what accident was evelyn talking about? you'll never know. is it related to the Stranger? perhaps.

furthering my tony basement creature agenda

this is dennys propaganda btw

problematic age gap yaoi!! (i have watched the pitt recently)

'dick falling off' shout out to pete davidson for putting that phrase in my head

tony my screenager ipad baby <3 <3 <3

"They all go silent for a second before Percy slowly points at himself, a questioning look on his face."

almost 50 pages of confirmation that some people are simply too stupid to haunt

happy halloween :)

plumbing baby. goodbye

Notes:

s̸̢͉̯̖̬͇̺͇̜͖̗͆̋̇̏̓̈̇̽̌͛̄̓̇̑ơ̸̧͙̣̣̜̤̹̤͕͐͋͒͑͂̋̋̏̊̈́̾̆͐̑̿̋͆̚u̴̢̧̱̰͍̫̻̣̲̲͈͚̝̮̠̤̜̞̣̩̐̉̒̾̋̐̇͗͑̋̅̈́̊̋̌̌́̉̄̔̾͂͜͝ͅp̸̧̧͕̠͍̝̰̦͔̈́̇̎̽̏̌̀̊̊̉̍̅͂̐̎̃͆͘͜͝

Series this work belongs to: